1. Neuroscience

Oligodendrocytes control potassium accumulation in white matter and seizure susceptibility

  1. Valerie A Larson
  2. Yevgeniya Mironova
  3. Kimberly G Vanderpool
  4. Ari Waisman
  5. John E Rash
  6. Amit Agarwal  Is a corresponding author
  7. Dwight E Bergles  Is a corresponding author
  1. Johns Hopkins University School of Medicine, United States
  2. Colorado State University, United States
  3. University Medical Center of the Johannes Gutenberg University, Germany
https://doi.org/10.7554/eLife.34829
Share this article
Cite this article
  1. Valerie A Larson
  2. Yevgeniya Mironova
  3. Kimberly G Vanderpool
  4. Ari Waisman
  5. John E Rash
  6. Amit Agarwal
  7. Dwight E Bergles
(2018)
Oligodendrocytes control potassium accumulation in white matter and seizure susceptibility
eLife 7:e34829.
https://doi.org/10.7554/eLife.34829
  2. Download BibTeX
  3. Download .RIS
8 figures, 1 table and 1 additional file

Figures

Figure 1 with 2 supplements
Download asset Open asset
The fate of oligodendroglia following constitutive deletion of Kir4.1 from the CNS.

(A) A P24 Nes-Cre;Kcnj10fl/fl (nKir4.1cKO) mouse and a Nes-Cre;Kcnj10fl/+ (control) littermate. (B) nKir4.1cKO mice display ataxic gate (see Figure 1—video 1). (C) Coronal brain sections from …

https://doi.org/10.7554/eLife.34829.002
Figure 1—figure supplement 1
Download asset Open asset
Immunostaining for MBP in layer 1 of cortex (flat mount preparation) (A), striatum (B), cerebellum (C), and spinal cord dorsal column (D) of control and nKir4.1cKO mice.
https://doi.org/10.7554/eLife.34829.003
Figure 1—video 1
Download asset
Nes-Cre;Kcnj10fl/fl (nKir4.1cKO) mouse at P24 displays an ataxic gait.
https://doi.org/10.7554/eLife.34829.004
Figure 2 with 2 supplements
Download asset Open asset
Effect of specific Kir4.1 deletion on the membrane properties of OPCs.

(A) Experimental protocol: 4-hydroxytamoxifen (2 × 1 mg) was administered to Pdgfra-CreER;RCE (control) and Pdgfra-CreER;RCE;Kcnj10fl/fl (pKir4.1cKO) mice i.p. at P21, and mice were sacrificed at …

https://doi.org/10.7554/eLife.34829.005
Figure 2—figure supplement 1
Download asset Open asset
Kir4.1 deletion from cortical OPCs.

(A) I-V plot showing the average current-voltage relationship of control OPCs in cortex (n = 15) in regular ACSF (gray) and ACSF + 100 μM BaCl2 (black). (B) I-V plot showing the average …

https://doi.org/10.7554/eLife.34829.006
Figure 2—figure supplement 2
Download asset Open asset
EGFP+ OPCs in pKir4.1cKO animals can be classified in two groups based on membrane currents.

(A) Scatterplot of membrane resistance (X-axis) vs. resting membrane potential (Y-axis) of control (gray) and pKir4.1cKO (red) OPCs in cortex, corpus callosum, and hippocampus. 49/65 (76%) of pKir4.1…

https://doi.org/10.7554/eLife.34829.007
Figure 3 with 3 supplements
Download asset Open asset
Deletion of Kir4.1 from OPCs does not affect their proliferation or differentiation.

(A) Experimental protocol: 4-hydroxytamoxifen (2 × 1 mg) was administered to Pdgfra-CreER;R2R-EYFP (control) and Pdgfra-CreER;R26R-EYFP;Kcnj10fl/fl (pKir4.1cKO) mice i.p. at P21. BrdU (2 × 50 mg/kg …

https://doi.org/10.7554/eLife.34829.008
Figure 3—figure supplement 1
Download asset Open asset
Recombination efficiencies of ROSA26-CAG-EGFP and R26R-EYFP reporter lines.

(A) Protocol for 4-HT injection. Pdgfra-CreER;RCE (n = 3) and Pdgfra-CreER;R26R-EYFP (n = 6) animals were injected i.p. with 2 × 1 mg 4-HT at P21, and sacrificed at P35 for histologial analysis. (B) …

https://doi.org/10.7554/eLife.34829.009
Figure 3—figure supplement 2
Download asset Open asset
Deletion of Kir4.1 from OPCs does not affect their density.

(A) Immunostaining for EYFP (green) and PDGFRα (red) in brain sections from control (top) and pKir4.1cKO (bottom) mice. Dashed lines demarcate the corpus callosum (CC). (B) Quantification of the …

https://doi.org/10.7554/eLife.34829.010
Figure 3—figure supplement 3
Download asset Open asset
OPC proliferation and differentiation in hippocampus.

(A–B) Immunostaining for EYFP (green), PDGFRα (red), and BrdU (cyan) in the hippocampus of a control (A) and pKir4.1cKO (B) mouse. Top insets show EYFP+ PDGFRα+ BrdU+ OPCs, bottom insets show EYFP− P…

https://doi.org/10.7554/eLife.34829.011
Figure 4 with 4 supplements
Download asset Open asset
Oligodendrocyte membrane properties and myelin are preserved following selective Kir4.1 deletion.

(A) Membrane resistance of corpus callosum oligodendrocytes recorded in acute slices from control (Mog-iCre;RCE, n = 17 cells) and oKir4.1cKO (Mog-iCre;RCE;Kcnj10fl/fl, n = 26 cells) mice at 5 to 6 …

https://doi.org/10.7554/eLife.34829.012
Figure 4—figure supplement 1
Download asset Open asset
Genetic deletion of Kir4.1 specifically from oligodendrocytes.

(A) Relative quantity of CNPase and MOBP mRNA (expressed in log10) between FACS-sorted EGFP+ oligodendrocytes from Mog-iCre;RCE mice (n = 6) and FACS-sorted EGFP+ astrocytes from Mog-iCre;Slc1a2-EGFP…

https://doi.org/10.7554/eLife.34829.013
Figure 4—figure supplement 2
Download asset Open asset
Effect of barium on oligodendrocyte membrane resistance.

(A) Membrane resistance of oligodendrocytes in the corpus callosum and alveus of control (gray, n = 25) or oKir4.1cKO (blue, n = 32) mice, in ACSF (gray/blue) and 100 µM BaCl2 (black). Membrane …

https://doi.org/10.7554/eLife.34829.014
Figure 4—figure supplement 3
Download asset Open asset
Example of extracellular field recordings in corpus callosum.

(A) Schematic depiction of recording set-up: extracellular field recordings were made in the corpus callosum, while axons were stimulated at a distance of 0.5–1 mm. (B) Example of a corpus callosum …

https://doi.org/10.7554/eLife.34829.015
Figure 4—figure supplement 4
Download asset Open asset
Kir4.1 deletion from oligodendrocytes does not lead to axon degeneration.

(A–B) Immunostaining for non-phosphorylated neurofilament (SMI32) in the brains of control (A) and oKir4.1cKO (B) mice. Right: higher magnification images of corpus callosum. No SMI32+ axons were …

https://doi.org/10.7554/eLife.34829.016
Figure 5 with 1 supplement
Download asset Open asset
Kir4.1 deletion from oligodendrocytes results in early mortality and reduced seizure threshold.

(A) Kaplan-Meier curve showing the probability of survival of control (black) vs. oKir4.1cKO (blue) mice from birth to one year of age. Dashed lines represent the 95% confidence interval. oKir4.1cKO …

https://doi.org/10.7554/eLife.34829.017
Figure 5—video 1
Download asset
Control and oKir4.1cKO mice undergoing PTZ-induced seizures.

Time displayed is time after PTZ injection. The control mouse (first) displays a typical modified Racine stage four seizure, with myoclonic jerks, rearing, and falling over onto the side. The oKir4.1…

https://doi.org/10.7554/eLife.34829.018
Figure 6 with 1 supplement
Download asset Open asset
K+ clearance after high-frequency stimulation of corpus callosum axons is impaired following deletion of Kir4.1 from oligodendrocytes.

(A) Recording set-up: EGFP+ oligodendrocytes in the corpus callosum were targeted for whole cell recording in control; RCE and oKir4.1cKO;RCE mice. Axons were stimulated at 100 Hz for 1 s with a …

https://doi.org/10.7554/eLife.34829.019
Figure 6—figure supplement 1
Download asset Open asset
K+ clearance after high-frequency stimulation of alveus is impaired following deletion of Kir4.1 from oligodendrocytes.

(A) Recording set-up: EGFP+ oligodendrocytes in the alveus were targeted for whole cell recording in control;RCE and oKir4.1cKO;RCE mice. Axons were stimulated at 100 Hz for 1 s with a bipolar …

https://doi.org/10.7554/eLife.34829.020
Figure 7 with 1 supplement
Download asset Open asset
Recovery of axonal firing patterns after high frequency activity is slowed following deletion of Kir4.1 from oligodendrocytes.

(A) Schematic diagram of optic nerve recording set-up. Nerve is inserted into suction electrodes, stimulated at the retinal end, and recorded at the chiasmatic end. A reference electrode is placed …

https://doi.org/10.7554/eLife.34829.021
Figure 7—figure supplement 1
Download asset Open asset
Recovery of CAP integral and median conduction latency are slowed following deletion of Kir4.1 from oligodendrocytes.

(A) CAP integral, as a fraction of the baseline value, of control and oKir4.1cKO nerves during 100 Hz stimulation and recovery. Integral was calculated over a period of 6 ms following the stimulus …

https://doi.org/10.7554/eLife.34829.022
Figure 8
Download asset Open asset
Deletion of Kir4.1 from oligodendrocytes results in activity-dependent motor deficits.

(A) Quantification of total beam breaks and rears per minute during 30 min in an open field chamber. No significant difference was observed between control (n = 13) and oKir4.1cKO (n = 11) mice in …

https://doi.org/10.7554/eLife.34829.023

Tables

Key resources table
Reagent type (species)
or resource		DesignationSource or referenceIdentifiersAdditional information
Gene (Mus musculus)Kcnj10; Kir4.1NAOMIM: 602208
Genetic reagent (M. musculus)B6.129-Kcnj10tm1Kdmc/JK. McCarthy, UNC Chapel Hill.Djukic et al., 2007. PMID:17942730.RRID:IMSR_JAX:026826
Genetic reagent (M. musculus)Mog-iCre (knock-in)A. Waisman, Johannes Gutenberg University.Buch et al. (2005). PMID:15908920NA
Genetic reagent (M. musculus)B6.Cg-Tg(Nes-cre)1Kln/JJackson LaboratoryRRID:IMSR_JAX:003771
Genetic reagent (M. musculus)B6N.Cg-Tg(Pdgfra-cre/ERT)467Dbe/JBergles Lab, Johns Hopkins University.Kang et al. (2010). PMID:21092857RRID:IMSR_JAX:018280
Genetic reagent (M. musculus)STOCK Gt(ROSA)26Sortm1.1(CAG-EGFP)Fsh/MmjaxG. Fishell, NYU.Sousa et al., 2009. PMID:19363146RRID:MGI:4412377
Genetic reagent (M. musculus)B6.129 × 1-Gt(ROSA)26Sortm1(EYFP)Cos/JJackson LaboratoryRRID:IMSR_JAX:006148
Genetic reagent (M. musculus)STOCK Tg(Mobp-EGFP) IN1Gsat/MmucdMMRRCRRID:MMRRC_030483-UCD
Genetic reagent (M. musculus)Slc1a2-EGFP (BAC-transgenic)J. Rothstein, Johns Hopkins University.Regan et al. (2007). PMID:17581948NA
AntibodyAnti-ASPA (rabbit polyclonal)GenetexCat# GTX113389; RRID:AB_2036283(1:1500)
AntibodyAnti-BrdU (rat monoclonal)BioRadCat# OBT0030G; RRID:AB_609567(1:500); Clone BU1/75
AntibodyAnti-APC (CC1) (mouse monoclonal)EMD Millipore (Calbiochem)Cat# OP80; RRID:AB_2057371(1:50)
AntibodyAnti-GFAP (rabbit polyclonal)DakoCat# Z0334; RRID:AB_10013382(1:500)
AntibodyAnti-GFP (chicken polyclonal)Aves LabsCat# GFP-1020; RRID:AB_10000240(1:4000)
AntibodyAnti-GFP (goat polyclonal)SICGENCat# AB0020-200; RRID:AB_2333099(1:5000)
AntibodyAnti-Ki67 (rabbit polyclonal)AbcamCat# Ab15580; RRID:AB_443209(1:1000)
AntibodyAnti-Kir4.1 (rabbit polyclonal)Alomone LabsCat# APC-035; RRID:AB_2040120(1:2000)
AntibodyAnti-MBP (chicken polyclonal)Aves LabsCat# MBP; RRID:AB_2313550(1:500)
AntibodyAnti-MBP (mouse monoclonal)BioLegendCat# 808401; RRID:AB_2564741(1:500)
AntibodyAnti-NG2 (guinea pig polyclonal)Bergles Lab, Johns Hopkins University. Kang et al., 2013. PMID:23542689NA(1:10000)
AntibodyAnti-PDGFRα (rabbit polyclonal)W. Stallcup, Burnham Institute. Nishiyama et al., 1996.PMID:8714520NA(1:500)
AntibodyAnti-PDGFRα (rabbit polyclonal)Cell Signaling TechnologyCat# 3174S; RRID:AB_2162345(1:500)
AntibodyAnti-Neurofilament-H (SMI32) (mouse monoclonal)BioLegendCat# 801702; RRID:AB_2715852(1:1000)
AntibodyDonkey anti-chicken Alexa 488Jackson ImmunoresearchCat# 703-546-155; RRID:AB_2340376(1:2000)
AntibodyDonkey anti-goat Alexa 488Jackson ImmunoresearchCat# 705-546-147; RRID:AB_2340430(1:2000)
AntibodyDonkey anti-rabbit Alexa 488Jackson ImmunoresearchCat# 711-546-152; RRID:AB_2340619(1:2000)
AntibodyDonkey anti-chicken Cy3Jackson ImmunoresearchCat# 703-165-155; RRID:AB_2340363(1:2000)
AntibodyDonkey anti-guinea pig Cy3Jackson ImmunoresearchCat# 706-166-148; RRID:AB_2340461(1:2000)
AntibodyDonkey anti-mouse Cy3Jackson ImmunoresearchCat# 715-166-151; RRID:AB_2340817(1:2000)
AntibodyDonkey anti-rabbit Cy3Jackson ImmunoresearchCat# 711-166-152; RRID:AB_2313568(1:2000)
AntibodyDonkey anti-chicken Alexa 647Jackson ImmunoresearchCat# 703-605-155; RRID:AB_2340376(1:2000)
AntibodyDonkey anti-mouse DyLight 650Thermo Fisher ScientificCat# SA5-10169; RRID:AB_2556749(1:2000)
AntibodyDonkey anti-rabbit DyLight 650Thermo Fisher ScientificCat# SA5-10041; RRID:AB_2556621(1:2000)
AntibodyDonkey anti-rat Cy5Jackson ImmunoresearchCat# 712-175-153; RRID:AB_2340672(1:2000)
Sequence-based reagentCnp primers: TTTACCCGCAAAAGCCACACA (f); CACCGTGTCCTCATCTTGAAG (r)MGH PrimerBankPrimerBank ID:6753476a1
Sequence-based reagentMobp primers: AGTACAGCATCTGCAAGAGCG (f); TCCTCAATCTAGTCTTCTGGCA (r)MGH PrimerBankPrimerBank ID:678910a1
Sequence-based reagentGfap primers: CGGAGACGCATCACCTCTG (f); TGGAGGAGTCATTCGAGACAA (r)MGH PrimerBankPrimerBank ID:6678910a1
Sequence-based reagentKcnj10 primers: GTCGGTCGCTAAGGTCTATTACA (f); GGCCGTCTTTCGTGAGGAC (r)MGH PrimerBankPrimerBank ID:34328498a1
Sequence-based reagentGapdh primers: AAGATGGTGATGGGCTTCCCG (f); TGGCAAAGTGGAGATTGTTGCC (r)Rhinn et al. (2008). PMID: 18611280NA
Commercial assay or kitNeural Tissue Dissociation Kit (P)Miltenyi BiotecCat# 130-092-628
Commercial assay or kitFastLane Cell cDNA KitQiagenCat# 215011
Commercial assay or kitQuantiTect SYBR Green PCR KitQiagenCat# 204143
Chemical compound, drug(Z)−4-Hydroxytamoxifen (4-HT)Sigma-AldrichCat# H7904; CAS:68392-35-8
Chemical compound, drug5-Bromo-2′-deoxyuridine (BrdU)Sigma-AldrichCat# B5002; CAS:59-14-3
Chemical compound, drugPentylenetetrazolSigma-AldrichCat# P6500; CAS:54-95-5
Chemical compound, drugTetrodotoxin citrateAbcamCat# Ab120055; CAS:18660-81-6
Software, algorithmAdobe Illustrator CS6AdobeRRID:SCR_014198
Software, algorithmFijihttp://fiji.scRRID:SCR_002285
Software, algorithmImageJhttps://imagej.nih.gov/ij/RRID:SCR_003070
Software, algorithmOrigin 8.0OriginLab Corp.RRID:SCR_014212
Software, algorithmpClamp10, pClamp9.2Molecular DevicesRRID:SCR_011323
Software, algorithmPython programming languagehttps://www.python.org/RRID:SCR_008394
Software, algorithmStepOne softwareApplied BiosystemsRRID:SCR_014281
Software, algorithmZen BlueZeissRRID:SCR_013672

Additional files

Transparent reporting form
https://doi.org/10.7554/eLife.34829.024

Download links