Measuring NDC80 binding reveals the molecular basis of tension-dependent kinetochore-microtubule attachments
- Harvard University, United States
- Washington University in St. Louis, United States
- Washington University in St Louis, United States
Figures
Figure 1 with 5 supplements
FLIM-FRET measurement of NDC80-kMT binding in human tissue culture cells.
(A) Engineered U2OS cell expressing mTurquoise2-NDC80 and β-tubulin-TC-FlAsH. NDC80 (gray), mTurquoise2 (blue) and TC-FlAsH (green). (B) Two-photon microscopy images of the engineered U2OS cells not …
Figure 1—figure supplement 1
β-tubulin labeling fraction measurement.
(A) Two-photon fluorescent microscopy images of 9 mitotic cells with β-tubulin-TC-FlAsH. 5 μm scale bar. (B) Example 3D segmentation using active contour algorithm. (C) (top left) The number of …
Figure 1—figure supplement 2
Kinetochore FLIM-FRET measurement.
(A) Illustration of fluorescence decay acquisition in a TCSPC (time-correlated single photon counting) FLIM system. A Ti:Sapphire pulsed laser is used for excitation and a photomultiplier tube (PMT) …
Figure 1—figure supplement 3
Negative control data for NDC80-kMT FLIM-FRET measurements.
(A) to (D) Schematic descriptions, example cell images, and example mTurquoise2 fluorescence decay curves from three different FRET-negative control experiments and a nocodazole treatment …
Figure 1—figure supplement 4
Förster radius estimation by FLIM-FRET measurements and Monte Carlo protein simulations.
(A) Fluorescence decay curves of cells expressing mTurquoise2-TC in the absence (green circle) and the presence (orange triangle) of FlAsH. A single-exponential model (black solid line) was fit to …
Figure 1—figure supplement 5
Characterization and calibration of NDC80-kMT FLIM-FRET measurement.
(A) The conformational ensemble of the flexible tether between mTurquoise2 and Nuf2 (red) and the disordered C-terminal tails of beta-tubulins around the NDC80 (green) were modeled by large-scale …
Figure 2
NDC80-kMT binding is regulated in a chromosome-autonomous fashion.
(A) Example cell images and time course of NDC80 FRET fraction from prometaphase to metaphase to anaphase (n = 11 cells). Black squares are the mean, y-error bars are the SEM, and x-error bars are …
Figure 3 with 2 supplements
NDC80-kMT binding is correlated with kMT dynamics and centromere tension.
(A) (left) kMTs predominantly depolymerize at leading kinetochores and polymerize at trailing kinetochores. (right) K-K distance is a proxy for centromere tension. Measuring NDC80-kMT binding along …
Figure 3—figure supplement 1
K-K distance and kinetochore velocity are not correlated.
(A) Each data point represents the fraction of leading kinetochores within a group of kinetochores with similar K-K distances. Gray region is the 95% confidence interval of the linear fit. (B) …
Figure 3—figure supplement 2
NDC80 FRET fraction of poleward- and anti-poleward-facing kinetochores in STLC-treated cells with monopolar spindles.
NDC80 FRET fraction vs. K-K distance for poleward-facing kinetochores (purple square, same as Figure 3D) and anti-poleward-facing kinetochores (pink triangles) in cells treated with 5 μM STLC (n = 16…
Figure 4 with 1 supplement
Aurora B kinase regulates NDC80-kMT binding in a graded fashion in vivo.
(A) (top) Cell images showing mTurquoise2-NDC80 (blue) and beta-tubulin-TC-FlAsH (green). (bottom) Time course of NDC80 FRET fraction in response to Aurora B inhibition by 3 μM ZM447439 (n = 15 …
Figure 4—figure supplement 1
Supplemental data for Aurora B inhibition experiments.
(A) Time course of NDC80 FRET fraction in response to 0.03% DMSO (n = 5 cells, negative control for Figure 4A). (B) The design of Aurora B FRET biosensor. The FRET sensor contains a kinesin-13 …
Figure 5 with 1 supplement
Haspin-dependent centromere-localized Aurora B is responsible for the tension dependency of NDC80-kMT binding.
(A) NDC80 FRET fraction vs. K-K distance for 9A-Hec1-expressing cells with no drug treatment (green circle, n = 12 cells, 803 kinetochores/data point), with 10 μM taxol treatment (orange triangle, n …
Figure 5—figure supplement 1
NDC80 FRET fraction of poleward and anti-poleward kinetochores in STLC-induced monopolar spindles of 9A-Hec1-expressing cells and haspin inhibited cells.
NDC80 FRET fraction vs. K-K distance for poleward-facing kinetochores (purple squares, same as Figure 5) and anti-poleward-facing kinetochores (pink triangles) in (A) 9A-Hec1-expressing cells …
Figure 6
The concentration of Aurora B at the location of NDC80 decreases with centromere tension.
(A) Spinning-disk confocal microscopy image of mNeonGreen-Nuf2 (green) and INCENP-mCherry (red). 3 µm scale bar. The location of NDC80 was determined to sub-pixel accuracy, using the mNeonGreen-Nuf2 …
Figure 7
A biophysical model of tension dependent NDC80-kMT binding.
(A) Plot of NDC80 binding fraction, fbound, (converted from NDC80 FRET fraction in Figures 3D and 5E) vs. Aurora B concentration at NDC80, [A] (converted from INCENP-mCherry intensity in Figure 6B, …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | U2OS | ATCC | HTB-96 | |
| Transfected construct (Homo sapiens) | pBABE-puro mTurquoise2-Nuf2 | this paper | Nuf2 N-terminally labeled with mTurquoise2; in retroviral vector with puromycin selection marker | |
| Transfected construct (Homo sapiens) | pBABE-hygro mTurquoise2-Nuf2 | this paper | Same as above, but with hygromycin selection marker | |
| Transfected construct (Homo sapiens) | pBABE-blast mTurquoise2-Nuf2 | this paper | Same as above, but with blasticidin marker | |
| Transfected construct (Homo sapiens) | pBABE-blast Aurora B FRET sensor (mTurquoise2/YPet) | this paper | modified from Addgene #45215; Fuller et al. (2008) | |
| Transfected construct (Homo sapiens) | Nuf2-targeted Aurora B FRET sensor (mTurquoise2/Ypet) | this paper | modified from Addgene #45215; Fuller et al. (2008) | |
| Transfected construct (Homo sapiens) | mTurquoise2-TC | this paper | mTurquoise2 with tetracysteine motif at the C-terminus | |
| Transfected construct (Homo sapiens) | WT-Hec1-LSSmOrange | this paper | modified from WT-Hec1-GFP from Jennifer DeLuca | |
| Transfected construct (Homo sapiens) | 9A-Hec1-LSSmOrange | this paper | modified from 9A-Hec1-GFP from Jennifer DeLuca | |
| Transfected construct (Homo sapiens) | 2D(S44,55D)-Hec1 -LSSmOrange | this paper | modified from 2D-Hec1-GFP from Jennifer DeLuca | |
| Transfected construct (Homo sapiens) | 9D-Hec1-LSSmOrange | this paper | modified from 9D-Hec1-GFP from Jennifer DeLuca | |
| Transfected construct (Homo sapiens) | INCENP-mCherry | other | Gift from Michael Lampson | |
| Recombinant DNA reagent | pSpCas9(BB)−2A-GFP (pX458) | Ran et al. (2013) | Addgene: #48138 | |
| Sequence-based reagent | Donor single-stranded DNA for TC tag insertion at the C-terminus of TUBB | IDT | ssDNA: cgtctctgagtatcagcagtacca ggatgccaccgcagaagaggaggaggattt cggtgaggaggccgaagaggaggcctGCT GTCCCGGCTGTTGctaaggcagagcccc catcacctcaggcttctcagttcccttagccgtc ttactcaactgcccctttcctctccctcaga; sgRNA target sequence: GAGGCCGAA GAGGAGGCCTA | |
| Sequence-based reagent | Hec1 siRNA | Qiagen | Cat#: SI02653567 | |
| Peptide, recombinant protein | TC-peptide | Genscript | Custom designed | Synthesized, Ac-AEEEACCPGCC-NH2 |
| Commercial assay or kit | Amaxa Cell Line Nucleofector Kit V | Lonza | Cat#:VCA-1003 | |
| Commercial assay or kit | Ingenio Electroporation Kit | Mirus | Cat#: MIR 50118 | |
| Commercial assay or kit | Lipofectamine RNAiMax | Thermo Fisher | Cat#:13778075 | |
| Chemical compound, drug | FlAsH-EDT2 | Thermo Fisher | Cat#:T34561 | |
| Chemical compound, drug | 1,2-Ethanedithiol (EDT) | Alfa Aesar | Cat#:540-63-6 | |
| Chemical compound, drug | ZM447439 | Enzo Life Sciences | Cat#:BML-EI373 | |
| Chemical compound, drug | Paclitaxel (Taxol) | Enzo Life Sciences | Cat#:BML-T104 | |
| Chemical compound, drug | 5-iodotubercidin (5-ITu) | Enzo Life Sciences | Cat#:BML-EI29 | |
| Chemical compound, drug | S-Trityl-L-cysteine | Sigma Aldrich | Cat#:164739–5G | |
| Chemical compound, drug | Alexa Fluor 488 | Thermo Fisher | Cat#:A20000 | |
| Chemical compound, drug | Sodium 2- mercaptoethanesulfonate | Sigma Aldrich | Cat#:M1511 | |
| Software, algorithm | Interactive kinetochore FLIM-FRET analysis GUI (MATLAB 2016) | This paper | http://doi.org/10.5281/zenodo.1198705; copy archived at https://github.com/elifesciences-publications/FLIM-Interactive-Data-Analysis | |
| Software, algorithm | Aurora B concentration at NDC80 analysis (Python 3) | This paper | http://doi.org/10.5281/zenodo.1198702;copy archived at https://github.com/elifesciences-publications/AuroraConcentrationAnalysis | |
| Software, algorithm | CAMPARI (v2) | Pappu Lab | http://campari.sourceforge.net/V2/index.html | |
| Software, algorithm | Rosetta 3.8 | RosettaCommons | RRID:SCR_015701 | |
| Other | 25 mm #1.5 poly-D-lysine coated round coverglass | neuVitro | Cat#:GG-25–1.5-pdl | |
| Other | FluoroBrite DMEM | Thermo Fisher | Cat#:A1896701 | |
| Other | Microtubule structure | Zhang et al. (2015) | PDB 3JAS | |
| Other | Human NDC80 bonsai decorated tubulin dimer | Alushin et al. (2010) | PDB 3IZ0 | |
| Other | mTurquoise structure | Stetten et al. (unpublished) | PDB 4B5Y |
Table 1
| Figure | Parameter | Mean | 95% CI |
|---|---|---|---|
| 4A | A | 0.088 | (0.069,0.106) |
| (min) | 3.26 | (1.31,5.21) | |
| c | 0.089 | (0.080,0.099) | |
| 4D | A | 0.024 | (0.011,0.038) |
| (min) | 0.50 | (−0.70,1.71) | |
| c | 0.059 | (0.048,0.071) | |
| 4E | A | 0.17 | (0.16,0.18) |
| (min) | 1.95 | (1.46,2.45) | |
| c | 0.37 | (0.36,0.38) | |
| 4-S1D | A | 0.076 | (0.061,0.090) |
| (min) | 1.12 | (0.23,2.00) | |
| c | 0.56 | (0.55,0.57) |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.36392.020
