1. Neuroscience
Download icon

Depleting Trim28 in adult mice is well tolerated and reduces levels of α-synuclein and tau

  1. Maxime WC Rousseaux
  2. Jean-Pierre Revelli
  3. Gabriel E Vázquez-Vélez
  4. Ji-Yoen Kim
  5. Evelyn Craigen
  6. Kristyn Gonzales
  7. Jaclyn Beckinghausen
  8. Huda Y Zoghbi  Is a corresponding author
  1. Baylor College of Medicine, United States
  2. Jan and Dan Duncan Neurological Research Institute at Texas Children’s Hospital, United States
Research Advance
Cite this article as: eLife 2018;7:e36768 doi: 10.7554/eLife.36768
4 figures, 1 table and 2 additional files

Figures

Figure 1 with 1 supplement
Trim28 mediates the SUMOylation of α-Syn and tau.

(A) Blocking SUMOylation – by either pharmacological inhibition using viomellein or siRNA-mediated suppression of the sole SUMO E2 ligase, UBC9 – decreases α-Syn and tau levels by western blot. (B) SUMO assay in human cells reveals that TRIM28 mediates the formation of SUMO2 adducts on α-Syn and tau. This effect is lost upon mutation of the RING domain of TRIM28 (TRIM28-Mut). (C) In vivo SUMO assay from denatured mouse brain lysates of WT and Trim28+/- mice. Snca-/- and Mapt-/- mice and IP: IgG serve as negative controls. *, **, *** and ns denote p<0.05, p<0.01, p<0.001 and p>0.05, respectively.

https://doi.org/10.7554/eLife.36768.002
Figure 1—figure supplement 1
Ablating endogenous Trim28 catalytic activity dramatically reduces its stability, concomitantly decreasing α-Syn and tau levels.

(A), Structural rationale for targeting the RING domain of Trim28. Alignment of human TRIM28 (hsTRIM28) with mouse (mmTrim28) and Drosophila melanogaster (dmTRIM28) TRIM28 in addition to human TRIM32 (hsTRIM32). * denotes the sequence upon which modeling was conducted. Modeling of RING domain disruption in PyMOL using the TRIM32 RING domain (PDB: 5FEY). (B), Approach to mutate endogenous Trim28 catalytic activity and Sanger sequencing confirmation of mutation insertion. (C), Western blot and qPCR analysis of Trim28, Snca and Mapt transcripts in Trim28 E3 mutant heterozygous mice (Trim28E3MT/+) compared to littermate controls. In (C), n = 4–9 mice per genotype. Error bars denote s.e.m. **, **** and ns denote p<0.01, p<0.0001 and p>0.05, respectively.

https://doi.org/10.7554/eLife.36768.003
Figure 2 with 2 supplements
Trim28 adult knockout mice are viable and demonstrate reduced α-Syn and tau levels.

(A) Experimental approach to delete Trim28 from the adult body. (B) Kaplan-Meier survival curve of Adult knockout mice (UBC-CREERT2; Trim28flox/flox + TAM vs littermate controls). No significant differences in survival are observed. (C) qPCR analysis for Trim28 expression in midbrain (MB), cortex (CTX) and hippocampus (HIP) of Trim28 adult knockout mice and control littermates. (D) Western blot analysis of α-Syn, tau and Trim28 levels in hippocampi from Trim28 adult knockout mice and control littermates. In (B), n = 14–33 per group. In (C and D), n = 12–13 per group.

https://doi.org/10.7554/eLife.36768.004
Figure 2—figure supplement 1
Perinatal suppression of Trim28 in the brain is safe and decreases α-Syn and tau levels.

(A) Approach to deplete Trim28 in the postnatal brain via RNAi. (B) Left panel demonstrates widespread expression of AAV across the brain. Epifluorescence of YFP expression in a representative 10-week-old mouse demonstrating widespread expression of the AAV throughout various brain regions. Brain regions depicted: (i) whole forebrain; (ii) caudal cortex; (iii) caudal cortex (zoom); (iv) hippocampus; (v) hippocampal CA1 region (zoom); (vi) Purkinje cells; and (vii) brainstem). Right panel denotes evidence of Trim28 depletion by qPCR from mice harboring AAV-encoded shRNAs against Trim28 (shTrim28) compared to control, shRNAs against Luciferase (shLuci). (C) Histological examination at the level of the cortex (left panel) and hippocampus (right panel) of mice expressing shTrim28 or shLuci. Cortical and CA1 thickness are measured via cresyl violet staining and astrogliosis is measured using GFAP staining. In (B) and (C), n = 4–6. *** and ns denote p<0.001 and p>0.05, respectively.

https://doi.org/10.7554/eLife.36768.005
Figure 2—figure supplement 2
α-Syn and tau levels are reduced in multiple brain regions from Trim28 adult knockout mice.

(A) Western blot analysis of α-Syn, tau and Trim28 levels in the midbrain from adult knockout mice and littermate controls. (B) Correlation analysis between normalized Trim28 levels and α-Syn or tau levels in hippocampal or midbrain extracts from Trim28 adult knockout mice and littermate controls (obtained from Western blot analysis in Figure 2D and Figure 2—figure supplement 2A). R2 values are presented for each linear regression. (C) qPCR analysis of Trim28 expression from peripheral organs in adult knockout mice and littermate controls. In (A and B), n = 12–13 per group. In (C), n = 7–8 per group. *, ** and **** denote p<0.05, p<0.01 and p<0.001, respectively.

https://doi.org/10.7554/eLife.36768.006
Adult depletion of Trim28 does not cause behavioral abnormalities.

Adult knockout mice and littermate controls were subjected to: (A) Open field assay where total distance, speed, vertical activity and time in center were measured over a period of 30 min. (B) Parallel rod footslip analysis where number of footslips and time spent immobile were measured on a grid over a period of 10 min. (C) Pole test where the time to turn and descend were measured to a mouse on top (facing upward) of a 18’ pole. (D) Elevated plus maze measured the time spent in open vs. closed arms during a period of 10 min. (E) Pavlovian conditioned fear analysis in both context and cued settings (day 2). (F) Novel object recognition assay showing the discrimination index for identifying the novel vs. familiar object. (G) Hole poke analysis of repetitive behavior measuring the number of sequential nose pokes. (H) Rotarod analysis measuring the motor coordination and learning of mice over a period of four days. For each test, n = 5–33; ns denotes p>0.05.

https://doi.org/10.7554/eLife.36768.007
Figure 4 with 3 supplements
Adult depletion of Trim28 does not cause pathological abnormalities in the adult brain.

Representative photomicrographs of the cortex, hippocampus and cerebellum stained with (A) H and E and (B) GFAP. (C) Quantification of cortical and hippocampal width as well as normalized GFAP intensity. For each test, n = 3; ns denotes p>0.05.

https://doi.org/10.7554/eLife.36768.008
Figure 4—figure supplement 1
Trim28 is expressed in the adult brain and can be effectively excised from adult mice.

(A) Representative photomicrographs of Trim28 staining in the CA1 and dentate gyrus (DG) of the hippocampus, striatum (STR) and cerebellum (CB) in Trim28 adult knockouts (KO) compared to littermate controls (CTRL). (B) qPCR on genes previously reported to be disrupted upon Trim28 loss in the juvenile hippocampus.

https://doi.org/10.7554/eLife.36768.009
Figure 4—figure supplement 2
Adult depletion of Trim28 does not cause peripheral pathological abnormalities.

Representative photomicrographs of (A) Heart, (B) Liver, and (C) Spleen from Trim28 adult knockouts compared to littermate controls stained for hematoxylin and eosin. Each photomicrograph is representative of three independent animals for both genotypes.

https://doi.org/10.7554/eLife.36768.010
Figure 4—figure supplement 3
Loss of Trim28 in adult mice does not disrupt global blood chemistry or iron homeostasis.

Complete blood chemistry of Trim28 adult knockout mice compared to control littermates. Adjusted P-values from multiple t-tests (Holm-Sidak corrected) for each value are presented on the right. Legend for each analyte is presented below.

https://doi.org/10.7554/eLife.36768.011

Tables

Key resources table
Reagent type (species)
or resource
DesignationSource or referenceIdentifiersAdditional information
Strain, strain background
(M. musculus)
Trim28E3MT (C66A, C69A, R72G)This studyPure C57Bl/6J background
Strain, strain background
(M. musculus)
Trim28flox B6.129S2(SJL)-
Trim28tm1.1Ipc/J
Jackson laboratoryStock #018552Pure C57Bl/6J background
Strain, strain background
(M. musculus)
UBC-CreERT2 B6.Cg-Ndor1
Tg(UBC-cre/ERT2)1Ejb/1J
Jackson laboratoryStock #007001Pure C57Bl/6J background
Strain, strain background
(M. musculus)
FVB/NCrlCharles RiverCode #207Pure C57Bl/6J background
Strain, strain background
(M. musculus)
Trim28+/-Rousseaux et al. (2016);
this study
Crossing Jax stock #018552
to #006054
Strain, strain background
(M. musculus)
Snca-/- B6;129 × 1-Sncatm1
Rosl/J
Jackson laboratoryStock #003692
Strain, strain background
(M. musculus)
Mapt-/- B6.129 × 1-Mapttm1
Hnd/J
Jackson laboratoryStock #007251
Cell line (H. sapiens)293TATCCCRL-3216
Cell line (H. sapiens)293T-shScramThis study; shScram
from
Rousseaux et al. (2016).
293 T cells infected with
retrovirus (pMSCV) harboring
shScramble. Selected with
1 µg/mL of puromycin for at
least 1 week before
commencing experimentation
Cell line (H. sapiens)293T-shTRIM28This study; shTRIM28 from
Rousseaux et al. (2016).
293 T cells infected with
retrovirus (pMSCV) harboring
shTRIM28. Selected with
1 µg/mL of puromycin for at
least 1 week before
commencing experimentation
Transfected construct
(H. sapiens)
Flag-SUMO2This study
Transfected construct
(H. sapiens)
pKH3-HA-TRIM28Addgene#45569
Transfected construct
(H. sapiens)
pKH3-HA-TRIM28-C65A/
C68A
Rousseaux et al.
(2016); Addgene
#92199
Transfected construct
(H. sapiens)
pKH3Addgene#12555
Transfected construct
(M. musculus)
AAV8-YFP-shScrambleThis studyaccgcctgaagtctctgattaa
Transfected construct
(M. musculus)
AAV8-YFP-shTrim28This studyttgttgaactgtttgaacatgc
Antibodyalpha-synuclein (C-20),
Rabbit polyclonal
Santa Cruz
Biotechnology
sc-7011-RThis antibody has been
discontinued.
Antibodyalpha-synuclein (Clone 42),
Mouse monoclonal
BD Biosciences610786
AntibodyTau, Rabbit polyclonalDakoA0024
AntibodyTau (Tau-5), Mouse
monoclonal
Abcamab80579
AntibodyTrim28 (20C1), Mouse
monoclonal
Abcamab22553
AntibodySUMO2/3, Rabbit
polyclonal
Abcamab3742
AntibodyFlag (M2), Mouse
monoclonal
Sigma AldrichF1804
AntibodyUBC9, Goat polyclonalNovus BiologicalsNB300-812
AntibodyVinculin (hVIN-1), Mouse
monoclonal
Sigma AldrichV9131
AntibodyGFAP (G-A-5), Mouse
monoclonal
Sigma AldrichG3893
Sequence-based reagent
(M. musculus), qPCR
Mkrn3-fccatggagaaatatgcgaca
Sequence-based reagent
(M. musculus), qPCR
Mkrn3-rctgagctgcatcccaagg
Sequence-based reagent
(M. musculus), qPCR
Tcf5-ftgatgcaatccggatcaa
Sequence-based reagent
(M. musculus), qPCR
Tcf5-rcacgtgtgttgcgtcagtc
Sequence-based reagent
(M. musculus), qPCR
Pcdhb6-fgccactagaagggctcgaat
Sequence-based reagent
(M. musculus), qPCR
Pcdhb6-rtgtctccacatctagctgcaa
Sequence-based reagent
(M. musculus), qPCR
Klhdc4-fcctggacaaaagttgacatcc
Sequence-based reagent
(M. musculus), qPCR
Klhdc4-rcaaactccccaccgaagac
Sequence-based reagent
(M. musculus), qPCR
Stac2-ftgtctactagaaatcggtagccaag
Sequence-based reagent
(M. musculus), qPCR
Stac2-ragcgtcttgttctccacctg
Sequence-based reagent
(M. musculus), qPCR
Smad3-fctcttggagcacatcctggt
Sequence-based reagent
(M. musculus), qPCR
Smad3-rgcccagctggaaatatgc
Sequence-based reagent
(M. musculus), qPCR
Cdkn1c-fcaggacgagaatcaagagca
Sequence-based reagent
(M. musculus), qPCR
Cdkn1c-rgcttggcgaagaagtcgt
Sequence-based reagent
(M. musculus), qPCR
C1ql2-ftcacgtaccacattctcatgc
Sequence-based reagent
(M. musculus), qPCR
C1ql2-rtgttgctggcgtagtcgta
Sequence-based reagent
(M. musculus), qPCR
Snca-fgaagacagtggagggagctg
Sequence-based reagent
(M. musculus), qPCR
Snca-rcaggcatgtcttccaggatt
Sequence-based reagent
(M. musculus), qPCR
Mapt-fgagaatgccaaagccaagac
Sequence-based reagent
(M. musculus), qPCR
Mapt-rgtgagtccaccatgtcgatg
Sequence-based reagent
(M. musculus), qPCR
Trim28-fgctgctgccctgtctacatt
Sequence-based reagent
(M. musculus), qPCR
Trim28-rcacactggacaatccaccat
Sequence-based reagent
(M. musculus), qPCR
S16-faggagcgatttgctggtgtgg
Sequence-based reagent
(M. musculus), qPCR
S16-rgctaccagggcctttgagatg
Sequence-based reagent
(H. sapiens), siRNA
siScrambleThermoFisher
Scientific
AM4611
Sequence-based reagent
(H. sapiens), siRNA
siUBC9ThermoFisher
Scientific
AM16708-120322
Chemical compound,
drug
ViomeillinBioVioticaBVT-0359-C500
Chemical compound,
drug
N-ethylmaleimide (NEM)Sigma AldrichE3876-5G
Chemical compound,
drug
TamoxifenSigma AldrichT5648-5G

Data availability

No datasets were generated in this study. All data are presented in this manuscript.

Additional files

Supplemental file 1

Detailed statistical analysis for all data throughout the manuscript.

https://doi.org/10.7554/eLife.36768.012
Transparent reporting form
https://doi.org/10.7554/eLife.36768.013

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)