A selective gut bacterial bile salt hydrolase alters host metabolism
- Harvard Medical School, United States
- Brigham and Women’s Hospital, United States
Figures
Figure 1
Enzymatic activity of gut bacterial bile salt hydrolase (BSH) enzymes.
(A) BSH cleave the amide bond linking primary bile acids to taurine or glycine. (B) Structures of the two most abundant murine-conjugated bile acids, tauro-β-muricholic acid (TβMCA) and tauro-cholic …
Figure 2 with 3 supplements
Identification of selective BSH activity in the human gut bacterial phylum Bacteroidetes.
(A) Deconjugation ability of twenty prevalent Bacteroidetes strains and two Firmicutes strains found in the human gut represented as heat maps. Individual strains were incubated for 48 hr total with …
Figure 2—figure supplement 1
Biological duplicates of percent deconjugation at 48 hr, glyco-conjugated bile acids.
https://doi.org/10.7554/eLife.37182.005
Figure 2—figure supplement 2
Biological duplicates of percent deconjugation at 48 hr, tauro-conjugated bile acids.
https://doi.org/10.7554/eLife.37182.006
Figure 2—figure supplement 3
Deconjugation heat maps, 24 hr timepoint.
Assays were performed in biological duplicate. Group I (red): Bacteroidetes species that deconjugate primary bile acids based on steroidal core structure (C12 = H but not C12 = OH); Group II (gray): …
Figure 3
Homology-based classification of Bacteroidetes strains and putative BSH genes.
(A) Phylogenetic tree of 20 Bacteroidetes strains using alignment-based whole proteome phylogeny (PhyloPhlAn). Bacteroidetes strains from Group II (gray; deconjugation based on amino acid) form a …
Figure 4 with 2 supplements
Monocolonization of GF mice with BT WT and Bt KO results in predictably altered bile acid pools.
(A) Male germ-free C57BL/6 mice were monocolonized with either Bt WT or BT KO and fed a high-fat diet (HFD) for 4 weeks (monocolonization experiment). In a second experiment, monocolonized mice (Bt …
Figure 4—figure supplement 1
Confirmation of in vivo expression of Bt BSH.
(A) Bt BSH qRT-PCR results from mouse cecal contents from CLAMS experiment on day 32, using 16S ribosomal RNA as the housekeeping gene. (B) Gel electroporation results of the same qRT-PCR products. …
Figure 4—figure supplement 2
Bile acid composition in the liver and plasma.
No significant differences in bile acid pool composition were noted in the liver (A) or plasma (B). Data are presented as mean ± SEM. BA (bile acid). For the monocolonization experiment, n = 12 mice …
Figure 5
Bt BSH colonization status affects weight gain and lipid profiles.
(A) Weight-matched, male, germ-free C57BL/6 mice monocolonized with Bt KO gained less weight during a 4-week diet challenge than Bt WT-colonized mice. n = 12 mice per group, multiple t test analysis …
Figure 6 with 1 supplement
Bt WT-colonized, Bt KO-colonized, and GF mice display distinct metabolic phenotypes.
Mice were monitored in metabolic cages during the final week of the CLAMS experiment and continued on a HFD. Mice were allowed to acclimate to cages for 24 hr prior to the start of data acquisition. …
Figure 6—figure supplement 1
Locomotor activity.
(A) Locomotor activity was measured by the number of beam breaks. Each dot represents the mean for a given mouse. Data are represented as mean ± SEM, where the number of samples is the number of …
Figure 7
Detergent properties of ileal bile acid pools do not significantly differ.
(A) Bile acid pools were reconstituted in vitro using the mean values measured from the distal ileum of Bt KO- and Bt WT-colonized mice (CLAMS experiment). Pools were added to four different …
Figure 8 with 2 supplements
Global transcription analysis revealed changes in metabolism, circadian rhythm, immune response, and histone modification pathways in the distal ileum of Bt KO- vs.
Bt WT-colonized mice (monocolonization experiment). (A) Log2-transformed fold change in normalized RNA-seq gene counts in the distal ileum of GF mice colonized with Bt KO relative to mice colonized …
Figure 8—figure supplement 1
RNA-seq workflow.
https://doi.org/10.7554/eLife.37182.017
Figure 8—figure supplement 2
RNA-seq, biological coefficient of variation.
Low variation within biological replicates was observed.
Figure 9
Bt BSH status affects transcription of genes in FXR-dependent and FXR-independent pathways.
(A) Plasma glucose and hormone levels, CLAMS experiment. Mice were fasted for 4 hr prior to terminal blood draw. n = 7–8 mice per group, data are presented as mean ± SEM, one-way ANOVA followed by …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Bacteroides thetaiotaomicron) | VPI 5482 [CIP 104206T, E50, NCTC 10582] | ATCC | ATCC 29148 | |
| Strain, strain background (Bacteroides caccae) | VPI 3452A [CIP 104201T, JCM 9498] | ATCC | ATCC 43185 | |
| Strain, strain background (Bacteroides ovatus) | [NCTC 11153] | ATCC | ATCC 8483 | |
| Strain, strain background (Bacteroides vulgatus) | [NCTC 11154] | ATCC | ATCC 8482 | |
| Strain, strain background (Bacteroides uniformis) | Not applicable | ATCC | ATCC 8492 | |
| Strain, strain background (Parabacteroides distasonis) | [NCTC 11152] | ATCC | ATCC 8503 | |
| Strain, strain background (Bacteroides fragilis) | VPI 2553 [EN-2; NCTC 9343] | ATCC | ATCC 25285 | |
| Strain, strain background (Parabacteroides merdae) | VPI T4-1 [CIP 104202T, JCM 9497] | ATCC | ATCC 43184 | |
| Strain, strain background (Bacteroides eggerthii) | Not applicable | DSMZ | DSM-20697 | |
| Strain, strain background (Bacteroides finegoldii) | 199 | DSMZ | DSM-17565 | |
| Strain, strain background (Bacteroides dorei) | 175 | DSMZ | DSM-17855 | |
| Strain, strain background (Bacteroides dorei) | 5_1_36/D4 | BEI | HM-29 | |
| Strain, strain background (Bacteroides sp.) | 1_1_6 | BEI | HM-23 | |
| Strain, strain background (Bacteroides sp.) | 9_1_42FAA | BEI | HM-27 | |
| Strain, strain background (Bacteroides sp.) | D2 | BEI | HM-28 | |
| Strain, strain background (Bacteroides sp.) | 3_1_19 | BEI | HM-19 | |
| Strain, strain background (Bacteroides sp.) | 2_1_16 | BEI | HM-58 | |
| Strain, strain background (Parabacteroides sp.) | 20_3 (Deposited as Bacteroides sp., Strain 20_3) | BEI | HM-166 | |
| Strain, strain background (Bacteroides sp.) | 2_1_22 | BEI | HM-18 | |
| Strain, strain background (Bacteroides fragilis) | 638R | Other | Gift from Seth Rakoff-Nahoum, Boston Children's Hospital | |
| Strain, strain background (Lactobacillus plantarum) | NCIMB 8826 [Hayward 3A, WCFS1] | ATCC | BAA-793 | |
| Strain, strain background (Clostridium perfringens) | NCTC 8237 [ATCC 19408, CIP 103 409, CN 1491, NCIB 6125, NCTC 6125, S 107] | ATCC | ATCC 13124 | |
| Strain, strain background (Escherichia coli S17-1 λ pir) | E. coli S17-1 λ pir | Other | Gift from Michael Fischbach, Stanford University | |
| Strain, strain background (B. thetaiotaomicron VPI-5482 Δtdk) | Bt WT | Other | Gift from Michael Fischbach, Stanford University | |
| Strain, strain background (B. thetaiotaomicron VPI-5482 ΔtdkΔ2086) | BtΔ2086 | This paper | See Materials and methods, ‘Construction of Bacteroides thetaiotaomicron knockout mutants’ | |
| Strain, strain background (B. thetaiotaomicron VPI-5482 ΔtdkΔ1259) | BtΔ1259 | This paper | See Materials and methods, ‘Construction of Bacteroides thetaiotaomicron knockout mutants’ | |
| Strain, strain background (B. thetaiotaomicron VPI-5482 Δtdk Δ2086 pNBU2_erm_us1311_BT2086) | BtΔ2086,2086+ | This paper | See Materials and methods, ‘Construction of Bacteroides thetaiotaomicron complementation strains’ | |
| Strain, strain background (B. thetaiotaomicron VPI-5482 Δtdk Δ2086 pNBU2_erm_us1311_CTRL) | BtΔ2086,CTRL+ | This paper | See Materials and methods, ‘ Construction of Bacteroides thetaiotaomicron complementation strains’ | |
| Recombinant DNA reagent | pExchange-tdk (plasmid) | PMID: 18611383 | ||
| Recombinant DNA reagent | pNBU2_erm_us1311 (plasmid) | PMID: 25574022 | ||
| Sequence-based reagent (knockout primer pairs) | BT2086_UF | Eurofins Genomics | GAA AGA AGA TAA CAT TCG AGT CGA CAT CCA AAC CCA GTG TGA ACT | |
| Sequence-based reagent (knockout primer pairs) | BT2086_UR | Eurofins Genomics | CAT ATT ACT TCC AAA TTA AAT AGT TGA TAC TC | |
| Sequence-based reagent (knockout primer pairs) | BT2086_DF | Eurofins Genomics | GAG TAT CAA CTA TTT AAT TTG GAA GTA ATA TGT AGT CGA TAG TTA GTT ATG TGG TAA G | |
| Sequence-based reagent (knockout primer pairs) | BT2086_DR | Eurofins Genomics | CCA CCG CGG TGG CGG CCG CTC TAG AAG CAG ACG TTA TCC TGG TTT C | |
| Sequence-based reagent (knockout primer pairs) | BT1259_UF | Eurofins Genomics | GAA AGA AGA TAA CAT TCG AGT CGA CGG ATG ATT ATT GCC CCA TTT TG | |
| Sequence-based reagent (knockout primer pairs) | BT1259_UR | Eurofins Genomics | CGT ACA CAT AAT TTC GAT TTT TAG TTA TAG | |
| Sequence-based reagent (knockout primer pairs) | BT1259_DF | Eurofins Genomics | CTA TAA CTA AAA ATC GAA ATT ATG TGT ACG TAA ATT GAT AGC AGC TTG CTG C | |
| Sequence-based reagent (knockout primer pairs) | BT1259_DR | Eurofins Genomics | CCA CCG CGG TGG CGG CCG CTC TAG ACG TTT TTC TAC CGG ACG AAT C | |
| Sequence-based reagent (complementation primer pairs) | us1311-BT-For-NdeI | Eurofins Genomics | GGG TCC ATA TGA AGA AAA AAC TTA CGG GTG TTG C | |
| Sequence-based reagent (complementation primer pairs) | BT-Rev-XbaI | Eurofins Genomics | CTA GTC TAG ACT ACA TCA CCG GAG TTT CGA A | |
| Sequence-based reagent (diagnostic primer) | pExchange_seq_UF | Eurofins Genomics | CGG TGA TCT GGC ATC TTT CT | |
| Sequence-based reagent (diagnostic primer) | pExchange_seq_DR | Eurofins Genomics | AAC GCA CTG AGA AGC CCT TA | |
| Sequence-based reagent (diagnostic primer) | BT2086_seq_F1 | Eurofins Genomics | CAA CTG TCC GGG TGA ATA TAA AG | |
| Sequence-based reagent (diagnostic primer) | BT2086_seq_F2 | Eurofins Genomics | GAA GTT TTC GTT GGG TGA ATG | |
| Sequence-based reagent (diagnostic primer) | BT1259_seq_F1 | Eurofins Genomics | AGA AGG TAC ATC GCC TGT AC | |
| Sequence-based reagent (diagnostic primer) | BT1259_seq_F2 | Eurofins Genomics | TAC TAT TCA CGC ACC ACA CC | |
| Sequence-based reagent (diagnostic primer) | pNBU2_UNIV-F | Eurofins Genomics | TAA CGG TTG TGG ACA ACA AG | |
| Sequence-based reagent (diagnostic primer) | pNBU2_UNIV-R | Eurofins Genomics | CAC AAT ATG AGC AAC AAG GAA TCC | |
| Sequence-based reagent (qRT-PCR primer) | qBTBSH_F | Eurofins Genomics | GCGTGCGGGACACAATAAAG | |
| Sequence-based reagent (qRT-PCR primer) | qBTBSH_R | Eurofins Genomics | TAGCCTGTTGCGATTACGCT | |
| Sequence-based reagent (qRT-PCR primer) | qBT16s_F | Eurofins Genomics | GTGAGGTAACGGCTCACCAA | |
| Sequence-based reagent (qRT-PCR primer) | qBT16s_R | Eurofins Genomics | CTGCCTCCCGTAGGAGTTTG |
Additional files
-
Supplementary file 1
Mouse experiment analyses.
- https://doi.org/10.7554/eLife.37182.020
-
Transparent reporting form
- https://doi.org/10.7554/eLife.37182.021
