1. Stem Cells and Regenerative Medicine
  2. Developmental Biology
Download icon

Hair follicle epidermal stem cells define a niche for tactile sensation

  1. Chun-Chun Cheng
  2. Ko Tsutsui
  3. Toru Taguchi
  4. Noriko Sanzen
  5. Asako Nakagawa
  6. Kisa Kakiguchi
  7. Shigenobu Yonemura
  8. Chiharu Tanegashima
  9. Sean D Keeley
  10. Hiroshi Kiyonari
  11. Yasuhide Furuta
  12. Yasuko Tomono
  13. Fiona M Watt
  14. Hironobu Fujiwara  Is a corresponding author
  1. RIKEN Center for Biosystems Dynamics Research, Japan
  2. Nagoya University, Japan
  3. Niigata University of Health and Welfare, Japan
  4. Tokushima University Graduate School of Medical Science, Japan
  5. RIKEN Center for Life Science Technologies, Japan
  6. Shigei Medical Research Institute, Japan
  7. King’s College London, United Kingdom
Research Article
Cite this article as: eLife 2018;7:e38883 doi: 10.7554/eLife.38883
5 figures, 4 tables, 1 data set and 1 additional file

Figures

Figure 1 with 1 supplement
Upper-bulge epidermal stem cells are molecularly specialized for hair follicle–nerve interactions.

(A) Graphical illustration of epidermal stem cell compartments. APM, arrector pili muscle. (B) Distinct epidermal stem cell compartments in 8-week-old telogen skin were visualized with specific eGFP reporters and cell surface markers. Brackets indicate target cell populations for sorting. (C) Z-score heat map representing the normalized enrichment score (NES) of GSEA using the transcriptome data of each epidermal stem cell population. (D) Scheme of the extraction of genes highly expressed in the Gli1+ population (Group I) and in both the Gli1+ and CD34+ populations (Group II). (E) Lists of the genes highly expressed in Gli1+ population (Group I) and in both Gli1+ and CD34+ populations (Group II). (F) Expression levels of neurotrophic factor and ECM genes highly expressed in upper-bulge stem cells. Basal, basal epidermal stem cell pool. Data are mean ±SD, n = 3–4.

https://doi.org/10.7554/eLife.38883.002
Figure 1—source data 1

Raw numerical data for Figure 1 and associated figure supplements.

https://doi.org/10.7554/eLife.38883.004
Figure 1—source data 2

Normalized Enrichment Score (NES) of Gene Set.

https://doi.org/10.7554/eLife.38883.005
Figure 1—figure supplement 1
FACS-based cell isolation procedures for distinct epidermal stem cell populations.

(A) FACS sorting procedures of all basal epidermal cell populations using wild-type C57BL/6N mice, Lgr6+ lower-isthmus epidermal stem cells using Lgr6-GFP-ires-CreERT2 mice, Gli1+ upper-bulge epidermal stem cells using Gli1-eGFP mice, CD34+ mid-bulge epidermal stem cells using wild-type C57BL/6N mice, Cdh3+ hair germ epidermal cells using Cdh3-eGFP mice. Gates are indicated by red-line boxes and cells in the gates were further analysed in the next plots or sorted. The numbers in the plots represent the percentage of cells in the gates. Lin- indicates lineage-negative cells, which are negative for the markers of haematopoietic and endothelial cells (lineage-positive cells). (B) Z-score heat map representing qRT-PCR analysis of sorted cells with compartment-specific gene primers. See Methods for more detail. Data are mean of 3–4 independently isolated biological replicates. (C) Expression levels of Spon1 gene in different stem cell pools. Immunostaining pattern of SPON1 protein in 8-week-old telogen dorsal hair follicle was shown. White arrow indicates the restricted localization of SPON1 in dermal papilla and the basement membrane between dermal papilla and hair germ. This restricted expression and deposition of SPON1 corroborates little contamination of hair germ cells into the Gli1 + upper bulge population. FPKM, fragments per kilobase of transcript per million mapped reads. Basal, basal epidermal stem cell pool. Data are mean ± SD, n = 3–4. Scale bar, 10 μm.

https://doi.org/10.7554/eLife.38883.003
Figure 2 with 1 supplement
Upper-bulge epidermal stem cells deposit EGFL6 into the collar matrix.

(A) Immunostaining pattern of upper-bulge-specific ECM in 8-week-old telogen skin. Brackets: upper-bulge. (B) EGFL6 was colocalized with βIII-tubulin+ nerve endings in the upper-bulge of dorsal guard (‘G’), awl/auchene (‘A’) and zigzag (‘Z’) hair follicles. (C) Magnified images of EGFL6 and βIII-tubulin in telogen skin. (D) The protrusions of the terminal Schwann cells (white brackets) were colocalized with EGFL6 in the upper-bulge of 8-week-old telogen hair follicle (open arrowheads). Asterisks: nonspecific signals. (E) CD31+ blood vessels did not show direct contact with EGFL6 in 7-week-old telogen hair follicle. Arrowheads: gaps between EGFL6 (green) and blood vessels (white). (F) The dorsal skin and dorsal root ganglia (DRG) of an 8-week-old Egfl6-H2b-Egfp mouse was stained for eGFP, EGFL6, nestin and βIII-tubulin. eGFP (closed arrowheads) staining was observed in the upper-bulge (open arrowhead) epidermis of old bulge (Old), but not in other cellular components around the upper-bulge. (G) Statistical examination of Egfl6-H2BeGFP-positive cells around the upper bulge. tSC, termimal Schwann cell. Data are mean ± SD. (H) Transmission electron microscopic image of the upper-bulge of P35 zigzag hair follicle showing an electron-dense amorphous ECM structure, the collar matrix (black arrowheads) and ensheathed lanceolate complex endings [A, axon (green); tSC, terminal Schwann cell (pink); EpSC, epidermal stem cell (gold); white arrowheads, epidermal basement membrane]. (I) The EGFL6-gold particles were localized in the collar matrix (arrows). (J) Schematic representation of the localization of EGFL6 in the upper-bulge. Scale bars, 10 μm (A), 20 μm (C–F), 100 μm (B), 2 μm (H), 1 μm (I).

https://doi.org/10.7554/eLife.38883.006
Figure 2—source data 1

Raw numerical data for Figure 2.

https://doi.org/10.7554/eLife.38883.008
Figure 2—source data 2

List of ECM proteins screened for upper-bulge localization with immunohistochemical analysis.

https://doi.org/10.7554/eLife.38883.009
Figure 2—figure supplement 1
EGFL6 localization and lanceolate complex formation during hair follicle development.

Maximum projection images of P5, P9, P14 and P35 mouse dorsal hair follicles stained for βIII-tubulin, nestin and EGFL6. Brackets indicate upper-bulge regions. Asterisks indicate the caudal sides of dorsal skin. Scale bars, 10 μm.

https://doi.org/10.7554/eLife.38883.007
Cell adhesion to EGFL6 is mediated by αv integrins.

(A) Coomassie Brilliant Blue (CBB) staining and western blotting of purified EGFL6, RGE-mutant EGFL6, and nephronectin (NPNT) are shown. (B) Heat map display of the results of cell adhesion assays. The number of adhered cells was converted to arbitrary units (A.U.). FN, fibronectin; LN511-E8, laminin-511 E8 fragment. n = 3. Cell lines used are human primary keratinocytes, human embryonic kidney epithelial cell line HEK293, human glioblastoma cell line T98G, Human glioma cell line KG-1-C, human skin fibroblast cell line SF-TY, human embryonic fibroblast cell line NTI-4, human sarcoma cell line HT-1080, human myelogenous leukemia cell line K562 and K562 transfected with human integrin α8 cDNA K562-a8. (C) Cell adhesion assays with T98G and KG-1-C cells plated on EGFL6 or RGE-mutant EGFL6-coated dishes. Data are mean ± SEM, n = 3. (D) A maximum projection image of 8-week-old telogen dorsal hair follicles stained for EGFL6, integrin α8 and βIII-tubulin. Scale bar, 50 μm. Integrin α8 was detected in arrector pili muscles (white arrow), periphery of dermal papilla (open arrowheads) and periphery of lanceolate complexes (see the inset), but not in EGFL6-positive lanceolate complexes (see the inset). (E) Cell adhesion inhibition assays with integrin antibodies. Data are mean ± SEM, n = 3. (F) 8-week-old telogen dorsal hair follicles of wild-type and Egfl6 knockout mice were stained for EGFL6, integrin αv and nestin. Scale bar, 10 μm. Blue dashed lines indicate the surface of follicle epidermis and white dashed lines indicate cross-section positions. (G) Quantification of αv integrin signal intensity in lanceolate complexes. Data are mean ± SD. (H) 8-week-old telogen dorsal hair follicles of wild-type mice were stained for nestin, βIII-tubulin, integrins αv, β1, α3 and α6. Sagittal view (x–y) and transverse view (x–z) images are shown. HF, hair follicle. Scale bar, 5 μm. Statistics (C, E, G): two-tailed unpaired t-test.

https://doi.org/10.7554/eLife.38883.010
Figure 4 with 5 supplements
EGFL6 is required for the patterning and touch responses of lanceolate complexes.

(A and B) 3D reconstituted images and filament tracings of axonal endings (A) and terminal Schwann cells (B) in the old bulge of wild-type and Egfl6 knockout 8-week-old skin. Ret-eGFP, a marker for C-LTMRs and TrkB, a marker for Aδ-LTMRs. Open arrowhead: overlapping points of axonal endings and terminal Schwann cell processes. Grid width, 5 μm. (C) Overlapping points of axonal endings and terminal Schwann cell (tSC) processes were counted. Data are mean ± SEM. Two-tailed unpaired t-test. (D) Mechanical sensitivity of Aδ-LTMRs was analyzed using von Frey hairs in wild-type and Egfl6 knockout skin–nerve preparations from 10 to 12 week-old telogen skin. (E) Touch response patterns of Aδ-LTMRs in wild-type and Egfl6 knockout skin–nerve preparations. A ramp-and-hold touch stimulus was applied using a piezo-controlled micromanipulator (see Methods and Figure 4—figure supplement 5A). (F) Threshold displacement of Aδ-LTMRs. (G) Number of action potentials during the course of the touch stimulus protocol (i.e., magnitude of touch responses) was measured. Data are median with interquartile range (IQR) in (D, F, G) and mean ± SEM in (E). Statistics: Mann-Whitney U-test (D, F, G).

https://doi.org/10.7554/eLife.38883.012
Figure 4—source data 1

Raw numerical data for Figure 4 and associated figure supplements.

https://doi.org/10.7554/eLife.38883.018
Figure 4—figure supplement 1
Quantification of morphological characteristics of axonal endings and terminal Schwann cell processes in wild-type and Egfl6 knockout mice.

(A) Number of axonal endings in the old bulge of zigzag hair follicles in 8-week-old mice was counted. Data are mean ± SEM, n = 32 hair follicles for wild-type and n = 33 hair follicles for knockout from three mice each. (B) Length of axonal endings in the old bulge of zigzag hair follicles was measured. Data are mean ± SEM, n = 444 axonal endings for wild-type and n = 455 axonal endings for knockout from three mice each. (C) Length and width of terminal Schwann cell processes were measured. Data are mean ± SEM, n = 70 tSCs (terminal Schwann cells) for wild-type and n = 46 terminal Schwann cells for knockout from three mice each. (D) Width of terminal Schwann cell processes were measured. Data are mean ± SEM, n = 69 terminal Schwann cells for wild-type and n = 45 terminal Schwann cells for knockout from three mice each.

https://doi.org/10.7554/eLife.38883.013
Figure 4—figure supplement 2
Ultrastructural examination of lanceolate complexes in wild-type and Egfl6 knockout mice.

Transmission electron microscopic images of the upper-bulge of P35 zigzag hair follicles of wild-type and Egfl6 knockout mice. Electron-dense plaques, characteristic structures for cell–ECM and cell–cell adhesions, are indicated by open arrowheads (cell–ECM adhesion sites) and closed arrowheads (cell–cell adhesion sites). A, axon; tSC, terminal Schwann cell. Scale bar, 1 μm.

https://doi.org/10.7554/eLife.38883.014
Figure 4—figure supplement 3
EGFL6 is required for the patterning of lanceolate complexes at the first telogen.

(A–B) 3D reconstituted images and filament tracings of axonal endings (A) and terminal Schwann cells (B) of zigzag hair follicles in wild-type and Egfl6 knockout mice at P19 first telogen. βIII-tubulin staining visualizes all LTMR axonal endings, including circumferential nerve endings. TrkB is a marker for Aδ-LTMRs. In zigzag hair follicles, TrkB- LTMRs are C-LTMRs. In the mutant, overlapping points of axonal endings (open arrowheads) were increased. This was partly due to the increase of horizontally extending branches of TrkB+ axonal endings (closed arrowheads) in Egfl6 knockout. These horizontally extending branches were also observed in wild-type lanceolate complexes with low frequency in the first telogen. Disorganized shape of terminal Schwann cells was occasionally observed in the mutant, but there is no significant difference in the number of terminal Schwann cell protrusion overlaps (see quantification below). Scale bars, 5 μm. (C) Overlapping points of axonal endings and terminal Schwann cell processes were counted. Data are mean ± SEM. Two-tailed unpaired t-test. Fifteen hair follicles from three wild-type mice and 15 hair follicles from three Egfl6 knockout mice were used for axon quantification. Thirty terminal Schwann cells from three wild-type mice and 48 terminal Schwann cells from three Egfl6 knockout mice were used for terminal Schwann cell quantification.

https://doi.org/10.7554/eLife.38883.015
Figure 4—figure supplement 4
Histological examination of skin tissue morphology in wild-type and Egfl6 knockout mice.

(A) Schematic representation of mouse hair follicle morphogenesis and the following regeneration cycles. During the first anagen phase (P25–P35), old and new hair bulge structures form. (B) H&E-stained dorsal skin of wild-type and Egfl6 knockout mice. Scale bars, 100 μm.

https://doi.org/10.7554/eLife.38883.016
Figure 4—figure supplement 5
Skin–nerve preparation and recordings of responses of Aδ-LTMRs.

(A) Mouse skin–nerve preparation ex vivo, which is oriented with the dermis side up in the test chamber and affixed with pins. A ramp-and-hold touch stimulus protocol is shown. A probe tip was moved alternately in rostral and caudal directions with displacement in a progressively increasing manner (4–1280 μm) at a speed of 300 μm/s. The holding time was set for 2 s between the rostral and caudal movement of the tip. (B) Representative responses in the wild-type (upper panel) and Egfl6 knockout skin (lower panel). Note the first spike of the wild-type in response to touch stimulus with caudal displacement of 32 μm (i.e. 32C). No firings were observed in response to cold (from 32°C to 8°C in 40 s) or heat (from 32°C to 50°C in 30 s) stimulations. In the knockout, smaller responses to touch stimuli can be observed with the higher threshold displacement of 512 μm. Spike shapes are shown in insets squared at the left side. All of the spikes generated during a series of stimuli are superimposed (264 spikes in wild-type, and 155 spikes in knockout). The distribution of receptive fields is indicated by an arrow. (C) Individual response patterns in the wild-type (n = 23, upper panel) and the knockout (n = 24, lower panel).

https://doi.org/10.7554/eLife.38883.017
Figure 5 with 2 supplements
The old bulge provides stable epidermal–neuronal interfaces.

(A) Structural changes of the upper-bulge during the hair follicle regeneration cycle. Cross-sectional views of the upper-bulge of zigzag hair follicles are shown. Closed arrowheads indicate a large gap of lanceolate complexes. (B) Perimeter length of the upper-bulge and (C) the upper-bulge of new and old bulges. (D) Heat map of the relative signal intensity levels of EGFL6, nestin and βIII-tubulin along the upper-bulge perimeter. Geometry of the upper-bulge perimeter is shown above the heat map. (E) Morphological differences of EGFL6/terminal Schwann cell complexes in new and old bulges. (F) Sagittal and transverse sectional views of the upper-bulge in P35 anagen hair follicles with the club hair unplucked and plucked. Open and closed arrowheads indicate areas with and without lanceolate complexes, respectively. (G) Heat map of the relative signal intensity levels of EGFL6, nestin and βIII-tubulin along the upper-bulge perimeter in hair follicles with the club hair unplucked and plucked. (H) Schematic summary of the contribution of epidermal stem cells to sensory unit formation. (i) During development, epidermal stem cells for hair follicle–nerve interactions are induced and compartmentalized in the upper-bulge. (ii) Upper-bulge epidermal stem cells provide specialized ECM and neurogenetic environments for lanceolate complexes. (iii) epidermal stem cells maintain an old bulge at the caudal side of the hair follicle, providing stable hair follicle–nerve interfaces. Scale bars, 10 μm.

https://doi.org/10.7554/eLife.38883.021
Figure 5—source data 1

Raw numerical data for Figure 5 and associated figure supplements.

https://doi.org/10.7554/eLife.38883.024
Figure 5—figure supplement 1
The old bulge formation provides stable epidermal-neuronal interfaces.

(A) A cross-sectional view of 7-week-old telogen upper-bulge stained for Ret-eGFP, TrkB and DAPI. Closed arrowheads indicate a gap of lanceolate endings. (B) The width of terminal Schwann cells in new and old bulges in the first anagen (P35) and second telogen (P49) follicles were quantified. n = 60–92 terminal Schwann cells from three mice. Individual measurement data are shown as circles. Mean ± SEM are shown as bars, n = 3 mice. Statistical comparisons were performed using two-tailed unpaired t-test. (C) Procedure of club hair plucking experiments. (D) Transverse sectional views of upper-bulge with club-hair unplucked and plucked P32 early anagen hair follicles stained for βIII-tubulin, nestin, EGFL6 and DAPI. Just after plucking, little structural damage to the old bulge epidermis and lanceolate complexes were observed. (E) Perimeter length of the upper-bulge of hair follicles 3 days after club hair plucking. n = 14 hair follicles from unplucked skin regions and nine hair follicles from plucked skin regions, respectively. (F) 3D reconstituted immunostaining images of upper-bulge region of 7-week-old telogen Awl/auchene hair follicles of wild-type and epidermis-specific conditional nephronectin (Npnt) knockout mice (Keratin5-Cre/Npnt fl/fl). Upon epidermal deletion of Npnt gene, arrector pili muscles (APM) moved above the bulge (Fujiwara et al., 2011), where lanceolate complexes were located. Arrowheads indicate the nuclei of terminal Schwann cells. In the mutant, some hair follicles showed disrupted patterning of longitudinal sensory nerve endings and terminal Schwann cells processes. This mutant image shows significantly fewer longitudinal lanceolate endings and terminal Schwann cell processes (see also 3D cropped lanceolate complex images). (G) The perimeter and number of lanceolate complexes in randomly selected non-guard hair follicles of wild-type and Npnt conditional knockout mice were measured. No statistically significant difference was observed. Data are mean ± SD, n = 23 hair follicles from wild-type and mutant mice, respectively. (H) The number of terminal Schwann cells was plotted against the perimeter of lanceolate complexes. In the wild-type, the number of terminal Schwann cells correlated well with the perimeter of lanceolate complexes, while in the Npnt knockout mice, distribution of the values of ‘number of tSC/perimeter of LCs’ was scattered and their correlation was lost (see R2 and p-value), indicating the anatomical changes of lanceolate complexes in Npnt mutants. tSCs, terminal Schwann cells. LCs, lanceolate complexes. n = 23 hair follicles from wild-type and mutant mice, respectively. Scale bars, 10 μm.

https://doi.org/10.7554/eLife.38883.022
Figure 5—figure supplement 2
Expression of EGFL family genes in bulge epidermal stem cells of Egfl6 knockout mice.

CD34+epidermal stem cells, which contain mid-bulge epidermal stem cells and a part of Gli1+ upper-bulge epidermal stem cells, were isolated from 8-week-old wild-type and Egfl6 knockout mice. The expression of EGFL family genes were examined by qPCR. Data are mean ± SD, n = 3 mice for each genotype. The expression of 7 family members, including Egfl6, were detected in wild-type. But no significant difference in the expression of these genes was observed in the mutant (except for mutated Egfl6). The following genes were under detectable levels in both genotypes; Egfl3 (Megf6), Egfl8, Egfl9 (Dlk2), Megf10.

https://doi.org/10.7554/eLife.38883.023

Tables

Table 1
General characteristics of Aδ-LTMRs.
https://doi.org/10.7554/eLife.38883.019
OutcomesWT
(n = 23 nerves)
Egfl6 KO
(n = 24 nerves)
P value
Activation threshold (V)3.0 (2.0–4.0)3.0 (2.0–6.0)p=0.778
Conduction velocity (m/s)6.6 (5.1–7.7)7.7 (5.0–8.6)p=0.115
Spontaneous activity (imp/s)0 (0–0)0 (0–0)p>0.999
Receptive field size (mm2)6.5 (4.7–13.2)4.8 (2.8–7.3)p=0.059
Table 1–source data 1

Raw numerical data for Table 1.

https://doi.org/10.7554/eLife.38883.020
Key resources table
Reagent type
(species) or
resource
DesignationSource or referenceIdentifiersAdditional
information
Genetic reagent (M. musculus)Egfl6 KOMMRRC032277-UCD
Genetic reagent (M. musculus)Egfl6-H2b-Egfp BAC transgenicthis paper
Genetic reagent (M. musculus)Ret-eGFP knock-inPMID: 17065462Gift from H. Enomoto; Jain et al., 2006
Genetic reagent (M. musculus)Egfl6 KO: Ret-eGFP knock-inthis paper
Genetic reagent (M. musculus)Lgr6-GFP-ires-CreERT2Jackson Laboratories16934
Genetic reagent (M. musculus)Gli1-eGFPMMRRCSTOCK:Tg(Gli1-EGFP)DM197Gsat/Mmucd
Genetic reagent (M. musculus)Cdh3-eGFPMMRRCSTOCK:Tg(Cdh3-EGFP)BK102Gsat/Mmnc
Cell line (H. sapiens)Primary keratinocytesWatt LabNormal foreskin
Cell line (H. sapiens)HEK293RIKEN Bioresource CenterRCB1637
Cell line (H. sapiens)T98GJCRB Cell BankJCRB9041
Cell line (H. sapiens)KG-1-CJCRB Cell BankJCRB0236
Cell line (H. sapiens)SF-TYJCRB Cell BankJCRB0075
Cell line (H. sapiens)NTI-4JCRB Cell BankJCRB0220
Cell line (H. sapiens)HT-1080JCRB Cell BankJCRB9113
Cell line (H. sapiens)K562JCRB Cell BankJCRB0019
Cell line (H. sapiens)K562-a8PMID: 11470831Gift from L. Reichardt; Chavis and Westbrook, 2001
Cell line (H. sapiens)293FThermo FisherR79007
AntibodyRabbit anti-mouse EGFL6this paperCUK-1203–022Rabbit polyclonal; against aa 257–550; WB (0.2–2 μg/ml), IHC (1 μg/ml)
AntibodyRabbit anti-mouse nephronectinthis paperCUK-1192–006Rabbit polyclonal; against recombinant full-length mouse nephronectin-His protein; WB (0.4–2 μg/ml), IHC (2 μg/ml)
AntibodyMouse anti-keratin 15Santa Cruz
Biotechnology
LHK15 (sc-47697)IHC (1:100)
AntibodyMouse anti-bIII-tubulinAbcam2G10 (ab78078)IHC (1:250)
AntibodyChicken anti-nestinAves LabsNES0407IHC (1:250)
AntibodyRat anti-nestinMilliporerat-401 (MAB353)IHC (1:250)
AntibodyRat anti-mouse CD31BioLegendMEC13.3IHC (1:250)
AntibodyChicken anti-GFPAbcamab13970IHC (1:2000)
AntibodyRabbit anti-GFPMBL598IHC (1:1000)
AntibodyRat anti-GFPNakaraiGF090RIHC (1:75)
AntibodyMouse anti-laminin γ1MilliporeMAB1914IHC (1:500)
AntibodyRat anti-integrin αvAbcamRMV-7IHC (1:500)
AntibodyHamster anti-mouse integrin αvBDH9.2H8IHC (1:250)
AntibodyGoat anti-human
integrin αv
R and D SystemsAF1219IHC (1:100)
AntibodyGoat anti-mouse integrin α3R and D SystemsAF2787IHC (1:100)
AntibodyHamster anti-mouse integrin β1BioLegendHMb1-1IHC (1:100)
AntibodyGoat anti mouse integrin α8R and D SystemsAF4076IHC (2.5 μg/ml)
AntibodyGoat anti-TrkBR and D SystemsAF1494IHC (4 μg/ml)
AntibodyRat anti-CD45-PE-Cy7eBioscience30-F11FACS (1:100)
AntibodyRat anti-TER-119-PE-Cy7eBioscienceTER119FACS (1:100)
AntibodyRat anti-CD31-PE-Cy7eBioscience390FACS (1:100)
AntibodyRat anti-Sca-1-PerCP-Cy5.5eBioscienceD7FACS (1:100)
AntibodyRat anti-CD34-
eFluor660
eBioscienceRAM34FACS (1:100)
AntibodyRat anti-CD49f-PEeBioscienceGoH3FACS (1:100)
AntibodyMouse anti-integrin α2DSHBP1E6Cell adhesion inhibition (10 μg/ml)
AntibodyMouse anti-integrin α3DSHBP1B5Cell adhesion inhibition (10 μg/ml)
AntibodyMouse anti-integrin α5DSHBP1D6Cell adhesion inhibition (10 μg/ml)
AntibodyRat anti-integrin α6BioLegendGoH3 (313614)IHC (1:500), Cell adhesion inhibition (10 μg/ml)
AntibodyMouse anti-integrin αvATCCL230Cell adhesion inhibition (10 μg/ml)
AntibodyMouse anti-integrin β1DSHBP5D2Cell adhesion inhibition (10 μg/ml)
Recombinant DNA reagentBAC clone containing mouse Egfl6 genomic sequenceCHORI BACPAC Resources CenterRP23-124O13
Sequence-based reagentqRT-PCR primersThis paperSee Table 2
Peptide,
recombinant protein
EGFPeprotech100 15
Peptide,
recombinant protein
InsulinSigmaI5500
Peptide,
recombinant protein
FLAG-tagged mouse full-length EGFL6this paper
Peptide, recombinant proteinFLAG-tagged mouse full-length EGFL6 (RGE mutant)this paper
Peptide,
recombinant protein
FLAG-tagged mouse full-length nephronectinPMID: 21335239Fujiwara et al., 2011
Peptide,
recombinant protein
Human plasma fibronectinWako063–05591
Peptide, recombinant proteinLaminin-511-E8Nippi892011
Commercial
assay or kit
TruSeq Stranded mRNA Sample Prep KitIlluminaRS-122–2101
Commercial assay or kitHiSeq SR Rapid Cluster Kit v2IlluminaGD-402–4002
Commercial
assay or kit
HiSeq Rapid SBS Kit v2IlluminaFC-402–4022
Chemical
compound, drug
0.25% trypsin solutionNakalai35555–54
Chemical
compound, drug
Collagenase type IGibco17100–017
Chemical
compound, drug
HydrocortisoneSigmaH4001
Chemical
compound, drug
Cholera toxinSigmaC8052
Software,
algorithm
HiSeq Control Software v2.2.58Illuminahttp://www.illumina.com/systems/hiseq_2500_1500/software/hiseq-built-in-software.html
Software,
algorithm
RTA v1.18.64Illuminahttp://support.illumina.com/sequencing/sequencing_software/real-time_analysis_rta.html
Software,
algorithm
bcl2fastq v1.8.4Illuminahttp://jp.support
.illumina.com/downloads/bcl2fastq_conversion_software_184.html
Software, algorithmFastQC v0.11.3Babraham Bioinformaticshttp://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Software, algorithmFASTX Toolkit v0.0.14Hannon Labhttp://hannonlab.cshl.edu/fastx_toolkit/download.html
Software,
algorithm
Trim_galore v0.3.3Babraham Bioinformaticshttp://www
.bioinformatics.babraham.ac.uk/projects/trim_galore/
Software,
algorithm
TopHat v2.0.14Johns Hopkins Universityhttps://ccb.jhu.
edu/software/tophat/index.shtml
Software,
algorithm
Cufflinks package v2.2.1Trapnell Labhttp://cole-trapnell-lab.github.io/cufflinks/
Software, algorithmGSEA software 2.2.2Broad Institutehttp://software.
broadinstitute.org/gsea/index.jsp
Software,
algorithm
Bioconductor R with heatmap.2 gplots packageGregory R. Warneshttps://www.
rdocumentation.org/packages/gplots/versions/3.0.1/topics/heatmap.2
Software,
algorithm
Imaris 7.2.1Bitplanehttp://www.bitplane.com/imaris/imaris
Software,
algorithm
Volocity 6.3Perkin Elmerhttp://cellularimaging.perkinelmer.com/downloads/
Software,
algorithm
FilamentTracerBitplanehttp://www.bitplane.com/imaris/filamenttracer
Software, algorithmDAPSYS data acquisition systemDAPSYShttp://www.dapsys.net/
OtherPiezo-controlled micromanipulator
Nanomoter
Kleindiek NanotechnikMM3A
OtherFeedback-controlled Peltier deviceIntercross, Co. Ltd.intercross-2000N
OtherRNA-seq Fastq filesthis paperBioProject: PRJNA342736https://www.ncbi.n
lm.nih.gov/bioproject/
Table 2
Primer sequences for qRT-PCR.
https://doi.org/10.7554/eLife.38883.025
Target genesPrimer sequences
Gapdh (Forward)TGCCAGCCTCGTCCCGTAG
Gapdh (Reverse)CGGCCTTGACTGTGCCGTTG
Lrig1 (Forward)TGTGTGTCTGAGAGACCCGAGC
Lrig1 (Reverse)CAGAGCCACTGTGTGCTGTTGT
Lgr6 (Forward)GGCTCCGAATCCTGGAGCTGT
Lgr6 (Reverse)CTCAGGGTGGATGGCACGGA
Gli1 (Forward)ATCTCCGGGCGGTTCCTACG
Gli1 (Reverse)TGACTTCAGCTGGCAGGTTGC
Bdnf (Forward)GCGGCGCCCATGAAAGAAGT
Bdnf (Reverse)GGCCGAACCTTCTGGTCCTCA
Cd34 (Forward)TGGCGCTGGGTAGCTCTCTG
Cd34 (Reverse)TAGTCTCTGAGATGGCTGGTGTGG
Cdh3 (Forward)TGGGGAAAGTAGCCTTGGCTGG
Cdh3 (Reverse)CAGCCTCTGAGGGAAGGGACC
Egfl2 (Forward)CCTGCCTCTGTCTGGATGGC
Egfl2 (Reverse)GAAGCTGCGTGTGGTCACCT
Egfl3 (Forward)GGCTCGCACTGTGTTCAGGT
Egfl3 (Reverse)GGCACGTTTTGCCATCACCC
Egfl4 (Forward)AGCTCTGCTCGGAGACACCA
Egfl4 (Reverse)ACCAACTGCTGCCACTGCAT
Egfl5 (Forward)CCTCCCCCAGAGCATATGTGTA
Egfl5 (Reverse)AGCCGGTGACACCCACTTTG
Egfl6 (Forward)AATACCCATCCGTGCAGCCC
Egfl6 (Reverse)TCATGGTGCGCTTGTGAGCC
Egfl7 (Forward)ACTTGCGACGGACACAGAGC
Egfl7 (Reverse)GCGGATGCAACTCCCTCCAT
Egfl8 (Forward)TGAAGAGAAGAAGCCCTCAGAGTGA
Egfl8 (Reverse)CGCACACAAGGTCAGGTAGGG
Egfl9 (Forward)CCTGCCAGAGCGGATGACTG
Egfl9 (Reverse)CTTTCCTGCCCAGCCACTGT
Egflam (Forward)CGGCTCTGCGAAAATCAGGC
Egflam (Reverse)AACCGGGACGTTGTGTGACC
Megf10 (Forward)GCCACAACGGAGCCTTTTGC
Megf10 (Reverse)CCGCAGGGCACTTCTGTTCA
Npnt (Forward)TCGCGTCCTCGCTCTACCTG
Npnt (Reverse)ACACAGCTTTGAGCTGGCACC
Table 3
RNA-seq read counts and mapping statistics.
https://doi.org/10.7554/eLife.38883.026
Raw
Read Count
Trimmed
Read Count
rDNA
Read Count
Multi-Mapped
Read Count
Uniquely mapped
Read Count
Mouse_Basal_
Cells_Rep1
11,757,49411,278,061148,700170,07710,456,332
Mouse_Basal_
Cells_Rep2
11,245,04510,668,75273,729134,77710,051,376
Mouse_Basal_
Cells_Rep3
11,313,23910,747,103108,596146,60210,089,518
Mouse_Bulge_
StemCells_Rep1
11,735,03411,181,37764,614183,55710,520,864
Mouse_Bulge_
StemCells_Rep2
11,917,04911,515,85154,154175,17610,889,932
Mouse_Bulge_
StemCells_Rep3
13,417,10012,895,11388,655218,49512,090,872
Mouse_Cdh3+_
Cells_Rep1
10,875,59310,409,34268,193177,4079,574,901
Mouse_Cdh3+_
Cells_Rep2
11,565,61610,993,09365,001185,98110,079,620
Mouse_Cdh3+_
Cells_Rep3
11,405,26510,746,76876,143206,3849,790,096
Mouse_Cdh3+_
Cells_Rep4
11,759,88111,186,54385,902191,15410,274,371
Mouse_Gli1+_
Cells_Rep1
12,063,48811,478,53757,630178,64610,751,521
Mouse_Gli1+_
Cells_Rep2
19,762,23418,804,713178,685303,84817,446,776
Mouse_Gli1+_
Cells_Rep3
19,543,11718,568,695122,017287,21417,378,904
Mouse_Lgr6+_
Cells_Rep1
20,044,45519,058,807121,507307,80417,798,594
Mouse_Lgr6+_
Cells_Rep2
19,756,35418,736,071197,458298,65217,386,391
Mouse_Lgr6+_
Cells_Rep3
19,639,29918,680,969217,502298,14617,210,635

Data availability

Fastq files of RNA-seq data have been submitted to NCBI SRA, and these data can be accessed through the BioProject ID: PRJNA342736. All data generated or analysed during this study are included in the source data files.

The following data sets were generated
  1. 1
    NCBI BioProject
    1. Fujiwara Hironobu
    (2018)
    ID PRJNA342736. Transcriptome of hair follicle epidermal stem cells.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)