Anillin regulates epithelial cell mechanics by structuring the medial-apical actomyosin network
- University of Michigan, United States
- University of Pittsburgh, United States
Figures
Figure 1 with 2 supplements
Anillin increases junctional vinculin recruitment but reduces recoil of junction vertices after laser ablation.
(A) Confocal images of live epithelial cells in gastrula-stage Xenopus laevis embryos expressing a probe for the plasma membrane (2x membrane localization signal of Src family tyrosine kinase Lyn …
-
Figure 1—source data 1
Source data for Figure 1B,D,E, Figure 1—figure supplement 1B,C,E and Figure 1—figure supplement 2C.
(Figure 1B) vinculin intensity at junctions with anillin perturbations. (Figure 1D) Junction recoil after laser ablation with anillin perturbations. (Figure 1E) Initial junction length before laser ablation. (Figure 1—figure supplement 1B,C) Junctional vinculin and α-catenin intensity with anillin perturbations. (Figure 1—figure supplement 1D) Example junction recoil after laser ablation with anillin perturbations. (Figure 1—figure supplement 1E) Junction recoil after laser ablation with anillin perturbations monitored for 45 s. (Figure 1—figure supplement 2C) Percentage of cells that separate perpendicularly after junctional laser ablation.
- https://doi.org/10.7554/eLife.39065.005
Figure 1—figure supplement 1
Anillin increases junctional vinculin recruitment but reduces recoil of junction vertices after laser ablation.
(A) Confocal images of live epithelial cells in gastrula-stage Xenopus laevis embryos expressing a probe for the plasma membrane (2x membrane localization signal of Src family tyrosine kinase Lyn …
Figure 1—figure supplement 2
Anillin increases perpendicular junction separation after junctional laser ablation.
(A) Confocal images of E-cadherin tagged with 3xGFP (Ecad-3xGFP) signal in a control embryo or an embryo overexpressing anillin tagged with 3xmCherry. Anillin overexpressing example is an …
Figure 2
Anillin structures medial-apical F-actin and myosin II.
(A) Confocal images of fixed epithelial cells from gastrula-stage control, anillin knockdown (KD), or anillin overexpression (OE) Xenopus laevis embryos stained for anillin (α-anillin) and F-actin …
-
Figure 2—source data 1
Source data for Figure 2E,F.
- https://doi.org/10.7554/eLife.39065.009
Figure 3 with 1 supplement
Anillin increases tensile forces and strain energy stored across the medial-apical surface of epithelial cells.
(A) Confocal images of live epithelial cells in a gastrula-stage Xenopus laevis embryo expressing Vinculin-mNeon along with probes for F-actin (Lifeact-RFP) and the plasma membrane (2x membrane …
-
Figure 3—source data 1
Source data for Figure 3B,D,E,G and Figure 3—figure supplement 1A,B,C.
(Figure 3B) Junctional vinculin intensity with perpendicular or parallel bundles of F-actin when anillin is overexpressed. (Figure 3D) Junction recoil perpendicular to the cut site after medial-apical laser ablation with anillin perturbations. (Figure 3E) Junction recoil parallel to the cut site after medial-apical laser ablation with anillin perturbations. (Figure 3G) Local and tissue strain intensity after medial-apical ablation with anillin perturbations. (Figure 3—figure supplement 1A) Initial junction-to-junction distance perpendicular to the medial-apical cut site. (Figure 3—figure supplement 1B) Initial junction-to-junction distance parallel to the medial-apical cut site. (Figure 3—figure supplement 1C) Ratio of initial junction-to-junction distance perpendicular/parallel to cut site.
- https://doi.org/10.7554/eLife.39065.013
Figure 3—figure supplement 1
Cell sizes and shapes were similar across medial-apical laser ablation experiments.
(A) Quantification of the initial junction-to-junction distance measured by a line drawn perpendicular to the cut site. Error bars, S.E.M. Statistics, unpaired t-test. (B) Quantification of the …
Figure 4 with 1 supplement
Anillin establishes a contractile medial-apical actomyosin network.
(A) Diagram of whole embryo extracellular ATP addition experiments. 40 nl of 50 mM ATP (blue) was micropipetted onto one side of the animal hemisphere of gastrula-stage embryos. A video was captured …
-
Figure 4—source data 1
Source data for Figure 4C,E,F and Figure 4—figure supplement 1B.
(Figure 4C) Embryo contraction after ATP addition with anillin perturbations. (Figure 4E) Medial-apical F-actin intensity over time, after ATP addition, with anillin perturbations. (Figure 4F) Change in medial-apical F-actin intensity after ATP addition, with anillin perturbations. (Figure 4—figure supplement 1B) F-actin intensity after ATP addition over time, measured near the junction or at the medial-apical center of the cells.
- https://doi.org/10.7554/eLife.39065.017
Figure 4—figure supplement 1
In apically constricting cells, F-actin and anillin accumulation emanates from junctions and spreads medial-apically.
(A) Confocal images of live epithelial cells from gastrula-stage Xenopus laevis embryos expressing a probe for F-actin (Lifeact-GFP). Exogenous ATP is added at time 0 to induce contraction. Notice …
Figure 5
Anillin organizes medial-apical actomyosin and regulates the orientation of tensile forces applied on junctions.
(A) Diagram of the apical surface of epithelial cells showing junctional and medial-apical F-actin and anillin in control embryos or when levels of anillin are perturbed. When anillin is knocked …
Figure 6
Anillin’s F-actin- and Rho-binding domains are necessary for structuring the medial-apical F-actin network.
(A) Domain diagram of full length anillin and N-terminal domain deletions. Full length (FL), Rho binding domain (RBD), pleckstrin homology (PH). (B) Confocal images of live epithelial cells from …
-
Figure 6—source data 1
Source data for Figure 6C,D,G,H.
(Figure 6C) Medial-apical anillin intensity (N-terminal mutants). (Figure 6D Blinded classification of medial-apical F-actin organization in cells with anillin perturbations (N-terminal mutants). (Figure 6G) Medial-apical anillin intensity (C-terminal mutants). (Figure 6H) Blinded classification of medial-apical F-actin organization in cells with anillin perturbations (C-terminal mutants).
- https://doi.org/10.7554/eLife.39065.022
Figure 7 with 1 supplement
Anillin regulates epithelial cell mechanics by stabilizing medial-apical F-actin.
(A) Single plane confocal images of live epithelial cells from gastrula-stage Xenopus laevis embryos expressing actin tagged with mNeon (Actin-mNeon) in control, anillin overexpressing (OE), or …
-
Figure 7—source data 1
Source data for Figure 7B,C,F and Figure 7—figure supplement 1A,B,C.
(Figure 7B) Fluorescence recovery after photobleaching (FRAP) of medial-apical actin in control, full length anillin overexpression, or Anillin ∆act overexpression. (Figure 7C) Curve fit data from 7B, which was used to calculate average mobile fraction and statistics of medial-apical actin FRAP. (Figure 7F) Junction recoil after laser ablation with and without jasplakinolide treatment. (Figure 7—figure supplement 1A) Medial-apical actin FRAP when anillin was knocked down. (Figure 7—figure supplement 1B) Junction recoil after laser ablation with anillin knockdown and anillin knockdown treated with jasplakinolide. (Figure 7—figure supplement 1C) Percentage of cells that separate perpendicularly after junction laser ablation.
- https://doi.org/10.7554/eLife.39065.025
Figure 7—figure supplement 1
Stabilizing F-actin rescues anillin knockdown junction recoil defect after laser ablation.
(A) Medial-apical FRAP data for Actin-mNeon highly expressed in anillin knockdown (KD) gastrula-stage Xenopus laevis embryos. Data fitted with a two phase association curve. n = number of cells. (B) …
Figure 8 with 1 supplement
Anillin promotes tissue stiffness.
(A) Cartoons of a stage 15 Xenopus laevis embryo and dorsal isolate (based on Nieuwkoop and Faber). Transverse view shows the neural ectoderm (NE), presomitic mesoderm (PSM), endoderm (En), and …
-
Figure 8—source data 1
(Figure 8E) Dorsal isolate elastic modulus with anillin knockdown.
- https://doi.org/10.7554/eLife.39065.030
Figure 8—figure supplement 1
Anillin maintains apical F-actin in dorsal epithelium.
Additional examples of transverse sections of dorsal isolates explanted from Xenopus laevis embryos injected with anillin morpholino. Anillin morpholino was co-injected with Alexa Fluor …
Figure 9
Anillin regulates apical tensile forces, stabilizes F-actin, and stiffens tissues.
(A) Schematic of our results showing that increased anillin expression slows junction recoil. (B) Diagram of how anillin slows junction recoil by reorienting tensile forces across the apical surface …
Author response image 1
Ratio of junctional Vinculin to α-catenin when Anillin is perturbed.
(Left) Ratio of Vinculin to α-catenin. Measurements were taken by tracing a bicellular junction from vertex to vertex and normalizing Vinculin and α-catenin intensity to membrane intensity. Error …
Author response image 2
Previous Figure 6G: Confocal images of an embryo expressing E-cad-3xGFP and treated with 20 µm jasplakinolide before and after laser ablation.
Blue boxes show the zoomed area for the ablation montage. Green dashed lines indicate the position of the vertices relative to the edge of the image, orange dashed line indicates the perpendicular …
Videos
Video 1
Increased anillin expression reduces vertex separation following junctional laser ablation.
Cell views of E-cadherin-3xGFP in control, anillin knockdown, or anillin overexpressing Xenopus laevis embryos before and after junctional laser ablation. Ablation was performed at time 0 s. For the …
Video 2
Example of recoil perpendicular to the junction following junctional laser ablation when anillin is overexpressed.
Cell views of a Xenopus laevis embryo with anillin overexpressed before and after junctional laser ablation. Probes are E-cadherin-3xGFP and Anillin-3xmCherry. Note that there is minimal recoil in …
Video 3
Examples of medial-apical F-actin bundles caused by anillin overexpression.
Cell views of a mosaic Xenopus laevis embryo where all cells are expressing Lifeact-GFP to label F-actin, and some cells are overexpressing Anillin-3xmCherry. Notice the cortical waves of F-actin in …
Video 4
Anillin increases apical expansion after medial-apical laser ablation.
Cell views of the F-actin probe Lifeact-RFP in control, anillin knockdown, or anillin overexpressing Xenopus laevis embryos before and after medial-apical laser ablation. Ablation was performed at …
Video 5
Anillin promotes whole embryo contraction after addition of exogenous ATP.
Whole Xenopus laevis embryo views where ATP is added to the bottom center of embryos while live imaging. The thick part of the microinjection needle that dispenses ATP can be seen at the top right …
Video 6
Anillin promotes accumulation of medial-apical F-actin after addition of exogenous ATP.
Cell views of Lifeact-GFP to label F-actin in control, anillin knockdown, or anillin overexpressing Xenopus laevis embryos where ATP was added to the imaging chamber while live imaging. ATP was …
Video 7
Stabilizing F-actin with jasplakinolide produces medial-apical actin bundles similar to when anillin is overexpressed.
Cell views of Lifeact-RFP used to label F-actin in a Xenopus laevis embryo treated with Jasplakinolide. Jasplakinolide was added at time 0 s.
Video 8
Stabilizing F-actin with jasplakinolide reduces vertex separation following junctional laser ablation similar to when anillin is overexpressed.
Cell views of the F-actin probe Lifeact-RFP in control Xenopus laevis embryo (treated with vehicle, EtOH) or embryo treated with Jasplakinolide before and after junctional laser ablation. Ablation …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Xenopus laevis (Female), Oocyte positive, Pigmented) | Xenopus laevis | Nasco | Cat #: LM00531 | |
| Strain, strain background (Xenopus laevis (Female), Oocyte positive, Albino) | Xenopus laevis | Nasco | Cat #: LM00531(A) | |
| Strain, strain background (Xenopus laevis (Male), Mature 7.5–9 cm, Pigmented) | Xenopus laevis | Nasco | Cat #: LM00715 | |
| Genetic reagent (Anillin morpholino oligonucleotide) | Anillin MO | Gene Tools; (Reyes et al., 2014); https://doi.org/10.1016/j.cub.2014.04.021 | An antisense MO (Gene Tools) was generated to target the 5´UTR of Xenopus laevis anillin with the sequence 5’ – TGGCTAGTAACTCGATCCTCAGACT – 3’. | |
| Antibody (anti-Anillin antibody) | α-Anillin | gift from Aaron Straight, Stanford University (Straight et al., 2005) https://doi.org/10.1091/mbc.e04-08-0758 | 1:500 dilution in Tris-buffered saline (50 mM Tris and150 mM NaCl [pH 7.4]) containing 10% fetal bovine serum (10082–139; Invitrogen), 5% DMSO and0.1% NP-40 overnight at 4ºC | |
| Antibody (goat anti-rabbit-Alexa Fluor 488) | Life Technologies | Cat #: A11008; Lot: 1583138 | 1:200 dilution in Tris-buffered saline (50 mM Tris and 150 mM NaCl [pH 7.4]) containing 10% fetal bovine serum(10082–139; Invitrogen), 5% DMSO and 0.1% NP-40 overnight at 4C | |
| Recombinant DNA reagent (pCS2+/Anillin) | Anillin | (Reyes et al., 2014); https://doi.org/10.1016/j.cub.2014.04.021 | ||
| Recombinant DNA reagent (pCS2+/Anillin-3xGFP) | Anillin-3xGFP | (Reyes et al., 2014); https://doi.org/10.1016/j.cub.2014.04.021 | ||
| Recombinant DNA reagent (pCS2+/Anillin-3xmCherry) | Anillin-3xmChe | (Reyes et al., 2014); https://doi.org/10.1016/j.cub.2014.04.021 | ||
| Recombinant DNA reagent (pCS2+/Actin-mNeon) | Actin-mNeon | this paper | Xenopus laevis actin was cloned from a cDNA library generated from stage 35 tadpoles (Higashi et al., 2016) https://doi.org/10.1016/j.cub.2016.05.036.actin into pCS2+ with the following primers: S: aaaaGAATTCaatggaagacgatattgccgcactg AS: ttttTCTAGAttagaagcatttacggtggacaattgagg | |
| Recombinant DNA reagent (pCS2+/Shroom3) | Shroom3 | gift from Sergei Sokol, Icahn School of Medicine at Mount Sinai (Chu et al., 2013); https://doi.org/10.1371/journal.pone.0081854 | ||
| Recombinant DNA reagent (pCS2+/Lifeact-RFP) | Lifeact-RFP | (Higashi et al., 2016); https://doi.org/10.1016/j.cub.2016.05.036 | ||
| Recombinant DNA reagent (pCS2+/Lifeact-GFP) | Lifeact-GFP | (Higashi et al., 2016); https://doi.org/10.1016/j.cub.2016.05.036 | ||
| Recombinant DNA reagent (pCS2+/BFP-membrane) | BFP-membrane | (Higashi et al., 2016); https://doi.org/10.1016/j.cub.2016.05.036 | ||
| Recombinant DNA reagent (pCS2+/E-cadherin-3xGFP) | E-cadherin-3xGFP; E-cad-3xGFP | (Higashi et al., 2016); https://doi.org/10.1016/j.cub.2016.05.036 | ||
| Recombinant DNA reagent (pCS2+/mCherry-α-catenin) | mChe-α-catenin | (Higashi et al., 2016); https://doi.org/10.1016/j.cub.2016.05.036 | ||
| Recombinant DNA reagent (TOPO-SF9-YFP) | gift from E.M. Munro, University of Chicago (Hashimoto et al., 2015); https://doi.org/10.1016/j.devcel.2014.12.017 | |||
| Recombinant DNA reagent (pCS2+/SF9-mNeon) | SF9-mNeon | this paper | SF9 was subcloned from TOPO into pCS2 + with the following primers: S: AAAAGGATCCACCATGGCCGAGGTGCAGC AS: TTTTATCGATTACCTAGGACGGTCAGCTTGG | |
| Recombinant DNA reagent (pCS2+/Vinculin-mNeon) | Vinculin-mNeon | this paper | Xenopus laevis vinculin was subcloned using BamHI and XbaI restriction enzymes from pCS2+/Vinculin-3xGFP from (Higashi et al., 2016); https://doi.org/10.1016/j.cub.2016.05.036 | |
| Commercial assay or kit (mMESSAGE mMACHINE SP6 Transcription Kit) | mMESSAGE mMACHINE SP6 Transcription Kit | Thermo Fisher Scientific | AM1340 | |
| Chemical compound, drug (Jasplakinolide) | Jasplakinolide; Jas | Cayman Chemical | Cat #: 11705, CAS: 102396-24-7 | |
| Chemical compound, drug (phalloidin Alexa Fluor 568) | phalloidin | Life Technologies | Cat #: A12380, Lot: 1154065 | 1:100 dilution in Tris-buffered saline (50 mM Tris and150 mM NaCl [pH 7.4]) containing 10% fetal bovine serum (10082–139; Invitrogen),5% DMSO and 0.1% NP-40 overnight at 4C |
| Chemical compound, drug (BODIPY FL phallacidin) | BODIPY FL phallacidin | Thermo Fisher Scientific | Cat #: B607 | |
| Chemical compound, drug (ATP) | ATP | Sigma | Cat #: A2383-5G; Lot: SLBD2725V | |
| Software, algorithm (Graphpad Prism 6.01) | GraphPad Software, La Jolla California USA, www.graphpad.com | |||
| Software, algorithm (Fiji (ImageJ)) | (Schindelin et al., 2012) https://doi.org/10.1038/nmeth.2019 | |||
| Software, algorithm (Custom plugin for ImageJ that uses bUnwarp J plugin) | Strain mapping | (Feroze et al., 2015) https://doi.org/10.1016/j.ydbio.2014.11.011 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.39065.032
