Spliceosome factors target timeless (tim) mRNA to control clock protein accumulation and circadian behavior in Drosophila
- Howard Hughes Medical Institute, Perelman School of Medicine at the University of Pennsylvania, United States
- Perelman School of Medicine at the University of Pennsylvania, United States
Figures
Figure 1
Pre-mRNA splicing factor four is a new regulator of the circadian clock.
(A) Representative activity records of free-running fly behavior upon downregulation of prp4 in tim+ neurons. Dicer2 (Dcr2) was co-expressed with the RNAi transgenes to increase the knockdown …
Figure 2 with 2 supplements
PRP4 is required for robust TIM and PER cycling.
(A, B) Cycling of PER and TIM is disrupted in s-LNvs of prp4 knockdown flies. Adult brains were dissected at time points indicated and immunostained with PER or TIM (green), PDF (magenta) and LaminC …
Figure 2—figure supplement 1
prp4 downregulation delays night-time accumulation of PER in nuclei of s-LNvs.
The ratio of nuclear to total PER levels indicates reduced nuclear accumulation of PER at night upon prp4 knockdown with 2 RNAi lines, KK (B) and GD (C), relative to control (A). Corrected Total …
Figure 2—figure supplement 2
prp4 is efficiently knocked down with the GD RNAi line.
Pan-neuronal knockdown of prp4 decreases mRNA levels of prp4 as calculated with Student’s t test, p** ≤ 0.01. Dicer2 (Dcr2) was co-expressed with the prp4 RNAi transgene to increase its knockdown …
Figure 3
PRP8 regulates TIM levels and the strength of rest:activity rhythms.
(A) TIM levels are decreased in s-LNvs of prp8 knockdown flies. Adult brains were dissected at ZT14 and ZT20 on the 4th day in LD cycle and immunostained with TIM (green), PDF (magenta) and LaminC …
Figure 4 with 2 supplements
PRP4 regulates tim splicing.
(A) Only five genes were identified as differentially spliced upon prp4 downregulation with both CASH and Cufflinks/differential psi (percent spliced in) pipelines. For each gene, the corresponding …
Figure 4—figure supplement 1
Pan-neuronal knockdown of prp4 increases tim expression.
per and Clk expression is unchanged while tim expression is increased at night (ZT16-ZT0) in the heads of flies with pan-neuronal prp4 downregulation (elavGal4; Dcr2 > prp4RNAi(GD)) as compared to …
Figure 4—figure supplement 2
Analysis of the splicing of tim-tiny, tim-cold and per introns.
(A) Schematic for qPCR-based analysis of tim-tiny splicing. Arrows indicate forward and reverse primers. Exons are depicted as boxes and introns are shown as lines. (B) On the left, normalization of …
Figure 5
Intron retention in tim decreases TIM levels and affects circadian behavior.
(A) Schematic depiction of three tim cDNA constructs used to assess the effect of tim-tiny retention (red block) on TIM levels. (B) Retention of tim-tiny intron decreases full-length TIM and leads …
Figure 6
tim splicing is regulated by the clock and by temperature.
Flies were entrained for at least 3 days in 12 hr:12 hr light:dark (LD) conditions and collected in LD (A) or on the first day of transfer to constant darkness (B) at indicated ZT or CT time points, …
Figure 7
Alternative splicing of the tim-tiny intron promotes oscillations of TIM levels.
The model depicts how retention of the tim-tiny intron, which is increased upon downregulation of prp4, regulates TIM cycling. Both the circadian clock (A) and temperature cycles (B) regulate …
Tables
Table 1
Free-running locomotor behavior of flies expressing RNAi against tri-snRNP components
https://doi.org/10.7554/eLife.39821.006| Genotype | N | rhythmicity* (%) | Period (hours ± SEM) | Power (FFT ± SEM) |
|---|---|---|---|---|
| TUG; Dcr2/+ | 35 | 100% | 23.80 (0.06) | 0.11 (0.01) |
| pdfGal4, Dcr2/+ | 19 | 100% | 24.06 (0.06) | 0.10 (0.01) |
| elavGal4; Dcr2/+ | 30 | 97% | 23.59 (0.33) | 0.06 (0.03) |
| +/prp4RNAi(GD) | 16 | 100% | 23.62 (0.06) | 0.09 (0.01) |
| +/prp4RNAi(KK) | 16 | 100% | 23.32 (0.05) | 0.13 (0.01) |
| +/prp3RNAi(GD) | 10 | 100% | 23.73 (0.06) | 0.10 (0.01) |
| +/prp3RNAi(KK) | 15 | 100% | 23.45 (0.06) | 0.12 (0.01) |
| +/prp8RNAi(GD) | 15 | 100% | 23.64 (0.07) | 0.11 (0.01) |
| +/prp31RNAi(KK) | 13 | 100% | 23.35 (0.06) | 0.12 (0.04) |
| +/brr2RNAi(KK) | 16 | 100% | 23.47 (0.06) | 0.11 (0.01) |
| TUG; Dcr2 > prp4RNAi(GD) | 34 | 71%† | 26.55 (0.29)‡ | 0.09 (0.01) |
| TUG; Dcr2 > prp4RNAi(KK) | 40 | 45%† | 29.47 (0.48)‡ | 0.09 (0.01) |
| TUG; Dcr2 > prp3RNAi(GD) | 11 | 100% | 27.45 (0.49)‡ | 0.08 (0.02) |
| TUG; Dcr2 > prp3RNAi(KK) | 33 | 0%† | - | - |
| TUG; Dcr2 > prp8RNAi(GD) | 30 | 23%† | 28.00 (1.02)‡ | 0.02 (0.01)‡ |
| TUG;Dcr2 > prp31RNAi(KK) | 17 | 88% | 25.33 (0.19)‡ | 0.06 (0.01)¶ |
| TUG;Dcr2 > brr2RNAi(KK) | 24 | 0%† | - | - |
| pdfGal4, Dcr2 > prp4RNAi(GD) | 30 | 90% | 25.85 (0.32)‡ | 0.06 (0.01)|| |
| pdfGal4, Dcr2 > prp4RNAi(KK) | 38 | 97% | 24.81 (0.32)‡ | 0.09 (0.02) |
| elavGal4; Dcr2 > prp4RNAi(GD) | 27 | 52%† | 24.54 (0.14)§ | 0.03 (0.02)# |
-
* Flies with FFT value >0.01 are considered to be rhythmic.
†p < 0.001 compared to both of the heterozygous controls, by χ2 analysis.
-
‡p < 0.001 compared to both of the heterozygous controls, by Student’s t test.
§p < 0.001 compared to RNAi control but not significant (p > 0.05) compared to elavGal4; Dcr2/+ control, by
-
Student’s t test.
¶p < 0.01 compared to TUG; Dcr2/+ control but not significant (p > 0.05) compared to RNAi control, by Student’s t test.
-
||p < 0.01 compared to pdfGal4; Dcr2/+ control and p < 0.05 compared to RNAi control, by Student’s t test.
#p < 0.05 compared to RNAi control but not significant (p > 0.05) compared to elavGal4; Dcr2/+ control, by Student’s t test.
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila melanogaster) | prp4 | NA | FLYB:FBgn0027587 | |
| Gene (Drosophila melanogaster) | timeless (tim) | NA | FLYB:FBgn0014396 | |
| Gene (Drosophila melanogaster) | period (per) | NA | FLYB:FBgn0003068 | |
| Gene (Drosophila melanogaster) | prp8 | NA | FLYB:FBgn0033688 | |
| Gene (Drosophila melanogaster) | brr2 | NA | FLYB:FBgn0263599 | also known as l(3)72Ab |
| Gene (Drosophila melanogaster) | prp3 | NA | FLYB:FBgn0036915 | |
| Gene (Drosophila melanogaster) | prp31 | NA | FLYB:FBgn0036487 | |
| Strain, strain background (Drosophila melanogaster) | iso31 | from laboratory stocks | NA | |
| Genetic reagent (Drosophila melanogaster) | per01 | Bloomington Drosophila Stock Center (BDSC) | FLYB:FBal0013649 | |
| Genetic reagent (Drosophila melanogaster) | tim0 | BDSC | FLYB:FBal0035778 | |
| Genetic reagent (Drosophila melanogaster) | TUG (Tim-UAS-Gal4) | BDSC | FLYB:FBtp0011839 | |
| Genetic reagent (Drosophila melanogaster) | pdfGal4; pdfG4 | BDSC | FLYB:FBtp0011844 | |
| Genetic reagent (Drosophila melanogaster) | elavGal4; elavG4 | BDSC | BDSC:25750 | |
| Genetic reagent (Drosophila melanogaster) | GMRGal4; GMR | BDSC | FLYB:FBti0002994 | |
| Genetic reagent (Drosophila melanogaster) | prp4RNAi(GD) | Vienna Drosophila Resource Center (VDRC) | VDRC:27808 | |
| Genetic reagent (Drosophila melanogaster) | prp4RNAi(KK) | VDRC | VDRC:107042 | |
| Genetic reagent (Drosophila melanogaster) | prp8RNAi(GD) | VDRC | VDRC:18565 | |
| Genetic reagent (Drosophila melanogaster) | prp3RNAi(GD) | VDRC | VDRC:25547 | |
| Genetic reagent (Drosophila melanogaster) | prp3RNAi(KK) | VDRC | VDRC:103628 | |
| Genetic reagent (Drosophila melanogaster) | prp31RNAi(KK) | VDRC | VDRC:103721 | |
| Genetic reagent (Drosophila melanogaster) | brr2RNAi(KK) | VDRC | VDRC:110666 | |
| Genetic reagent (Drosophila melanogaster) | prp82e1 | BDSC | FLYB: FBal0190235; BDSC:25905 | |
| Genetic reagent (Drosophila melanogaster) | prp82e2 | BDSC | FLYB:FBal0190015; BDSC:25912 | |
| Genetic reagent (Drosophila melanogaster) | brr2e03171 | BDSC | FLYB:FBti0041681; BDSC:18127 | |
| Genetic reagent (Drosophila melanogaster) | UAS-Dicer2; Dcr2 | BDSC | FLYB:FBtp0036672 | |
| Genetic reagent (Drosophila melanogaster) | UAS-tim-spliced; tim-spliced | this paper | NA | generated by the site-specific PhiC31 Integration System (Rainbow Transgenics) using the attP on the 3rd chromosome; pUAST-tim-spliced plasmid was used for injection |
| Genetic reagent (Drosophila melanogaster) | UAS-tim-retained; tim-retained | this paper | NA | generated by the site-specific PhiC31 Integration System (Rainbow Transgenics) using the attP on the 3rd chromosome; pUAST-tim- retained plasmid was used for injection |
| Genetic reagent (Drosophila melanogaster) | UAS-tim-retained+ssM; tim-retained+ ssM | this paper | NA | generated by the site-specific PhiC31 Integration System (Rainbow Transgenics) using the attP on the 3rd chromosome; pUAST-tim- retained+ssM plasmid was used for injection |
| Cell line (Drosophila melanogaster) | S2 | ATCC (Manassas, VA) | FLYB:FBtc0000181; RRID:CVCL:Z992 | |
| Antibody | guinea pig anti- PER (UP1140) | Garbe et al., 2013 | NA | 1:1000 |
| Antibody | rat anti- TIM (UPR42) | Jang et al., 2015 | NA | 1:1000 |
| Antibody | rabbit anti-PDF (HH74) | Garbe et al., 2013 | NA | 1:500 |
| Antibody | mouse anti-LaminC | Developmental Studies Hybridoma Bank (DSHB) | LC28.26 | 1:500 |
| Antibody | mouse anti-HSP70 | Sigma | Cat# H5147 | 1:5000 |
| Recombinant DNA reagent | pIZ/V5-His plasmid | ThermoFischer | Cat# V800001 | backbone |
| Recombinant DNA reagent | pBluescript-tim | lab collection | NA | tim sequence contained tim-tiny; used for subcloning |
| Recombinant DNA reagent | tim-spliced; pIZ-tim-spliced | this paper | NA | tim cDNA was subcloned into pIZ-V5 plasmids |
| Recombinant DNA reagent | tim-retained; pIZ-tim-retained | this paper | NA | tim-tiny intron was subcloned into pIZ-tim- spliced vector from pBluescript-tim plasmid |
| Recombinant DNA reagent | tim-retained+ ssM; pIZ-tim-retained+ssM | this paper | NA | generated by mutagenesis of the 5’ splice donor site of tim-tiny intron from pIZ-tim-retained plasmid |
| Recombinant DNA reagent | tim-spliced; pUAST-tim-spliced | this paper | NA | tim cDNA was subcloned from pIZ-tim- spliced into pUAST -attB vector |
| Recombinant DNA reagent | tim-retained; pUAST-tim-retained | this paper | NA | tim cDNA was subcloned from pIZ-tim-retained into pUAST-attB vector |
| Recombinant DNA reagent | tim-retained + ssM; pUAST-tim-retained+ssM | this paper | NA | tim cDNA was subcloned from pIZ-tim- retained+ssM into pUAST-attB vector |
| Sequence- based reagent | tim PP11542 (‘mRNA’) _F | ATGGACTGGTTACTAGCAACTCC | ||
| Sequence- based reagent | tim PP11542 (‘mRNA’) _R | GGTCCTCATAGGTGAGCTTGT | ||
| Sequence- based reagent | per_F | CGTCAATCC ATGGTCCCG | ||
| Sequence- based reagent | per_R | CCTGAAAGACGCGATGGTG | ||
| Sequence- based reagent | clk_F | GGATGCCAATGCCTACGAGT | ||
| Sequence- based reagent | clk_R | ACCTACGAAAGTAGCCCACG | ||
| Sequence- based reagent | prp4_F | CACAAGCAGCATCTTTGTATGG | ||
| Sequence- based reagent | prp4_R | TGTGGAGTCCCACATTCTTG | ||
| Sequence- based reagent | tim-tiny_retained_F | AAACGTGAGTTAAAGTCAACC | ||
| Sequence- based reagent | tim-tiny_retained_R | GAGAGGCACACAGCATATC | ||
| Sequence- based reagent | tim-tiny_spliced_F | CCGCTGGACAAACTCAACCTC | ||
| Sequence- based reagent | tim-tiny_spliced_R | TCGGTATCGCCGAGATCCACG | ||
| Sequence- based reagent | tim-cold_retained_F | GGCTCATGATCATTGCAGCAGC | ||
| Sequence- based reagent | tim-cold_retained_R | ATAGTGGGGCACCCGGATCTC | ||
| Sequence- based reagent | tim-cold_spliced_F | TTAAACAGCGACAATGTCTCTTTGG | ||
| Sequence- based reagent | tim-cold_spliced_R | GAATTGGATCCTCAGTGATAGTGGG | ||
| Sequence- based reagent | tim_non_spanning ('exon')_F | GAAGAACAACGATATTGTGGGAAAG | ||
| Sequence- based reagent | tim_non_spanning ('exon')_R | AGTGGGAGTTGTCAGCAAAG | ||
| Sequence- based reagent | per_retained_F | GAGGACCAGACACAGCACGG | ||
| Sequence- based reagent | per_retained_R | CGGAGGCAATTGCTCACTCGT | ||
| Sequence- based reagent | per_spliced_F | GAGGACCAGACACAGCACGG | ||
| Sequence- based reagent | per_spliced_R | TCGCGTTGATTCGAAGAATCGTT | ||
| Sequence- based reagent | rp49_F | GACGCTTCAAGGGACAGTATCTG | ||
| Sequence- based reagent | rp49_R | AAACGCGGTTCTGCATGAG | ||
| Sequence- based reagent | tim_tinySSdonorT > A_F | CTGGACAAACGAGAGTTAAAGTCAACC | ||
| Sequence- based reagent | tim_tinySSdonorT > A_R | CGGTCCCAGCTTTTTGGC | ||
| Commercial assay or kit | RNeasy Plus Mini Kit | Qiagen | Cat# 74134 | |
| Commercial assay or kit | Superscript II Reverse Transcriptase | ThermoFischer | Cat# 18064014 | |
| Commercial assay or kit | TRIzol Reagent | ThermoFischer | Cat# 15596026 | |
| Commercial assay or kit | Q5 Site-Directed Mutagenesis Kit | NEB | Cat# E0554S | |
| Commercial assay or kit | Effectene Transfection Reagent | Qiagen | Cat# 301425 | |
| Software, algorithm | Graphpad Prism v7 | Graphpad Software | https://www.graphpad.com/ | |
| Software, algorithm | JTK_CYCLE v3 | Hughes et al., 2010 | NA | |
| Software, algorithm | ImageJ | NIH | https://imagej.nih.gov/ij/ | |
| Software, algorithm | ClockLab Software | Actimetrics (Wilmette, IL) | https://actimetrics.com/products/clocklab |
Additional files
-
Supplementary file 1
DAVID pathway enrichment analysis of all differentially expressed genes upon prp4 knockdown
- https://doi.org/10.7554/eLife.39821.014
-
Supplementary file 2
List of differentially expressed genes upon prp4 knockdown
- https://doi.org/10.7554/eLife.39821.015
-
Supplementary file 3
Differentially spliced events upon prp4 knockdown identified with CASH
- https://doi.org/10.7554/eLife.39821.016
-
Supplementary file 4
Differentially spliced isoforms upon prp4 knockdown identified with Cufflinks-2.2 pipeline
- https://doi.org/10.7554/eLife.39821.017
-
Supplementary file 5
Calculation of the ratio of tim-tiny retaining isoforms to all other isoforms using Cufflinks-2.2 output
- https://doi.org/10.7554/eLife.39821.018
-
Transparent reporting form
- https://doi.org/10.7554/eLife.39821.019
