Mi-2/NuRD complex protects stem cell progeny from mitogenic Notch signaling
- University of Cambridge, United Knigdom
Figures
Figure 1 with 3 supplements
Delayed onset of hyperplasia in NB lineages expressing constitutively active Notch.
(A) Expression of stem-cell markers in wild type (grhNBGal4 >LacZ, E(spl)mγ-GFP) ventral nerve cords (VNC) and in VNCs where NSC lineages were exposed to constitutive Notch activity (Nact; (grhNBGal4 >NΔecd; E(spl)mγ-GFP). Gal80ts was used to control the onset of expression to provide 8, 24 or 48 hr of Gal4. E(spl)mγ-GFP (green or white) and Dpn (blue or white) two Notch-responsive genes expressed in NSCs become upregulated in longer exposure times. High levels of NΔecd (anti-NICD, red) are present at even the earliest time-point. Red arrowheads indicate normal lineages, yellow arrowheads indicate hyperplastic lineages, yellow arrows indicate E(spl)mγ-GFP+ve, Dpn-ve progeny. Scale bars: 25 μm. (B) Schematic representation of NB lineages at different times of Nact exposure; NBs, large green cells with grey nucleus, GMCs yellow and neurons grey. Ectopic NB-like cells are depicted as intermediate sized green cells. (C) Percent of lineages that were hyperplastic following 8 hr, 24 hr and 48 hr of Nact expression. Box represents IQR, black line indicates median and whiskers indicate ±1.5 × IQR. N = 15, three experiments. (D) Number of cells per hyperplastic lineage that are E(spl)mγ-GFP+ve Dpn-ve (green) or E(spl)mγ-GFP+ve Dpn+ve (blue) in 8 or 24 hr Nact expression. Box represents IQR, black line indicates median and whiskers indicate ±1.5 × IQR. N = 120, three experiments.
Figure 1—figure supplement 1
Ε(spl)mγ and Dpn are among the earliest NB markers expressed by progeny of NB lineages exposed to constitutively active Notch.
(A) Control NB lineages (grhNBGal4 Gal80ts > LacZ; E(spl)mγ-GFP) or NBs exposed to constitutively active Notch (grhNBGal4 Gal80ts > Nact; E(spl)mγ-GFP) for 8 hr or 24 hr in relatively young animals (72ALH). Note that Ε(spl)mγ-GFP (green) and Dpn (red) are among the earliest markers expressed by NB-like cells, Grh (blue) appears shortly after (B) Control NB lineages or NB lineages expressing Nact. Note that mγGFP (green) and soon afterwards Dpn (red) are among the earliest markers expressed by NB-like cells, whereas Mira (blue) is expressed many hours later in NB-like cells. See lineages in yellow squares or progeny pointed by yellow arrows or red arrowheads.
Figure 1—figure supplement 2
Stem cells with constitutively active Notch divide asymmetrically.
(A) Expression of Dpn, Mira (blue) and Pon (red) in Control NB lineages (grhNBGal4 Gal80ts > LacZ; Ase-mcherryPonLD) or NB lineages exposed to Nact (grhNBGal4 Gal80ts > Nact; Ase-mcherryPonLD) for 24 hr. Note that Mira (blue) becomes localised asymmetrically into the progeny of mitotic NBs (see NBs with magenta asterisks) in lineages with excessive Notch signaling as in control NBs. (B) Live imaging of NB lineages in larval brain expressing >NΔecd (grhNBGal4 Gal80ts at the permissive temperature for 24 hr), with an example of dividing NB. After mitosis, re-emerging NB is larger and maintains Ε(spl)mγ-GFP expression, whereas progeny GMC is smaller and rapidly loses Ε(spl)mγ-GFP (green). Histone-RFP (white) is used to monitor nuclei. Purple circles indicate dividing NB and its emerging progeny. Time is depicted below each panel, scale bar 15 μm. (C) Graph summarizing nuclear volume of tracked NB before and after division and of newly born GMCs. Note that the large size of the NB is maintained, whereas newly born GMC is smaller.
Figure 1—figure supplement 3
The onset of hyperplasia in NB lineages expressing constitutively active Notch is delayed irrespectively of the age of the animal.
(A) Expression of Dpn (white) in NB lineages exposed to Nact (grhNBGal4 Gal80ts > NΔecd; E(spl)mγ-GFP) in two distinct time windows of larval life (72ALH vs 96ALH). Gal80ts was used to control the onset of expression to provide Gal4 driven Nact expression for either 24 or 48 hr. Scale bars: 50 μm. Note that the extent of hyperplasia was very similar between younger and older stages, for a given period of exposure. (B) Box and whiskers diagram, percent of hyperplastic lineages following 24 hr and 48 hr of Nact expression in young (72ALH) vs older (96ALH) stages. Box represents IQR, black line indicates median and whiskers indicate ±1.5 × IQR. N = 15, three experiments (D) Number of cells per hyperplastic lineage that are Dpn+ve following 24 or 48 hr Nact expression in young vs older stages. Box represents IQR, black line indicates median and whiskers indicate ±1.5 × IQR. N = 80, two experiments.
Figure 2 with 2 supplements
Live-imaging of Ε(spl)mγ-GFP expression in cultured NB lineages.
(A, B) Time points from time lapse movie of (A) wild type (>LacZ) and (B) Nact expressing NB lineage, Histone-RFP (red, H2Av-RFP) marks all nuclei, corresponding Ε(spl)mγ-GFP levels in grey scale below. Ε(spl)mγ-GFP is rapidly extinguished in NB progeny in wild-type and in Nact expressing lineages but appears in some progeny after a delay. Time is indicated below each panels and cartoons summarise the cell populations in each lineage. NBs are show in darker shades of green, GMCs in yellow, newly born GMCs in pale green and neurons in grey. NB-like cells are shown in green. Coloured asterisks indicate cells coming from the same ancestor. White arrows indicate cells arising from a mitotic division. Numbers correspond to different cells indexed in the following diagrams. Scale bar 25 μm. (C, D) Bar chart diagram showing the progression over time of each cell in a wild-type NB lineage (C) or of selected NB progeny over time from one Nact expressing lineage. The diameter of the bar represents cell size and the colour represents expression levels of Ε(spl)mγ-GFP according to the scale (Blue, low to yellow, high). Dashed lines indicate mitotic events and the emerging daughter cells. (E, F) Diagrams depicting changes in the intensity of E(spl)mγ-GFP in NBs and their progeny over time from control (E) and Nact-expressing (F) NB lineages. Note the decay in E(spl)mγ-GFP levels in the newly born GMCs in both control and Nact lineages and the re-expression of E(spl)mγ-GFP in an older Nact progeny P2.
Figure 2—video 1
Time lapse movie of control (>LacZ) NB lineage with a duration of 10 hr.
Histone-RFP (red, H2Av-RFP) on the left marks all nuclei. E(spl)mγ-GFP levels are depicted in greyscale on the right. Time (in min) is indicated on the top left. Scale bar 25 μm. E(spl)mγ-GFP is extinguished in NB progeny.
Figure 2—video 2
A 14 hr time-lapse movie of Nact expressing NB lineage.
Histone-RFP (red, H2Av-RFP) on the left marks all nuclei. E(spl)mγ-GFP levels are depicted in greyscale on the right. Time (in min) is indicated on the top left. Scale bar 25 μm. Note that although E(spl)mγ-GFP is extinguished from all NB newly born progeny, it re-appears later in some progeny.
Figure 3 with 2 supplements
Mi-2 depletion exacerbates Notch-induced tumorigenesis.
(A) Depletion of Mi-2 increases the number of hyperplastic Dpn+ve cells (white) caused by Nact expression in type I lineages. Expression of Dpn in wild type (>LacZ;>w Ri, first column), Mi-2 depleted only (>LacZ;>Mi-2-Ri; BL33415, 2nd column), Nact expressing (>NΔecd;>w Ri; 3rd column) and Nact with Mi-2 depleted (>NΔecd;>Mi-2-Ri, 4th column). (B–C) Loss of MTA-like (B) or Caf1-p55 (C) increases the number of hyperplastic Dpn+ve cells (white) caused by Nact expression. Expression of Dpn (white) in Nact expressing lineages (1st column: >NΔecd; >w-Ri) and in Nact with MTA-like or Caf1p55 depleted (2nd column: >NΔecd; >MTA-like-Ri; or >NΔecd; >Caf1 p55-Ri). (D) Number of Dpn+ve cells per VNC induced by expression of Nact was significantly increased by depletion of Mi-2, whereas depletion of Mi-2 alone had little effect. (E–F) Number of Dpn+ve cells per VNC induced by Nact was significantly increased upon knock down of MTA-like (E) or Caf1-p55 (F). Scatter dot plots where narrow black lines represent IQR, wider black line indicates median and whiskers indicate ±1.5 × IQR. (*p<0.05, **0.001 < P < 0.05, ***p<0.001, ****p<0.0001, t-test). N = 25–28 for each genotype tested; light and darker shades indicate data points from the three independent experiments. (G) Schematic depiction of NuRD Complex, with subunits tested here in dark orange.
Figure 3—figure supplement 1
Mi-2 depletion in NBs, GMCs or newly born progeny exacerbates Notch-induced tumorigenesis but Mi-2 depletion in older neurons does not.
(A) Mi-2 knockdown leads to severe depletion of Mi-2 protein levels. Mi-2 protein (red) levels in VNCs of the indicated genotypes: Nact alone (grhNBGal4Gal80ts >NΔecd; >w-Ri), Mi-2 knockdown in Nact (>NΔecd; >Mi-2-Ri) or Mi-2 knockdown alone (>LacZ; >Mi-2-Ri). Dpn (green) and Mira (blue) mark NBs. (B) Depletion of Mi-2 in NBs using insc-Gal4 leads to an increase of the number of hyperplastic Dpn+ve cells in Nact conditions. Expression of Dpn (green or white) is shown in VNCs with Nact alone (>NΔecd; >w-Ri) and with knock down of Mi-2 in combination with Nact (>NΔecd; >Mi-2-Ri). Ase (red) marks NBs and GMCs, whereas Mira (blue) marks NBs (C) Depletion of Mi-2 in GMCs and newly born NSC progeny using casGMR71C09-Gal4 leads to an increase in the number of hyperplastic Dpn+ve cells in Nact conditions. Dpn (white) in wild type (>LacZ; >w-Ri), Nact expressing (>NΔecd; >w-Ri) knock down of Mi-2 only (>LacZ; >Mi-2-Ri Bloomington line #33415), and knock down of Mi-2 in Nact expressing (>NΔecd; >Mi-2-Ri) lineages. Ase (red) marks NBs and GMCs, whereas Mira (blue) marks NBs. (D) Neither Nact nor Mi-2 depletion nor combination of Nact with Mi-2 depletion in mature neurons via nsyb-Gal4 lead to increase in Dpn+ve cells. Dpn (white) in knock-down of Mi-2 only (>LacZ; >Mi-2-Ri; Bloomington line #33415), Nact expressing (>NΔecd; >w-Ri) and knock down of Mi-2 in Nact expressing (>NΔecd; >Mi-2-Ri) lineages. Ase (red) marks NBs and GMCs, whereas Mira (blue) marks NBs. (E). Quantification of the number of Dpn+ve cells per VNC under the conditions indicated. When Mi-2 was depleted in GMCs using casGMR71C09-Gal4 in Nact conditions compared to Nact alone the number of Dpn+ve cells per VNC was significantly increased. VNCs from WT or Mi-2 knockdown backgrounds exhibit normal number of Dpn+ve cells. Box represents IQR, black line indicates median and whiskers indicate ±1.5 × IQR. (*p<0.05, ****p<0.001, t-test) (F) Quantification of the number of Dpn+ve cells per VNC under the conditions indicated, where Mi-2 was depleted in NBs using insc-Gal4 in Nact conditions compared to Nact alone. Box represents IQR, black line indicates median and whiskers indicate ±1.5 × IQR. (*p<0.05, ****p<0.001, t-test). (G) The number of Dpn+ve cells per VNC did not change where Mi-2 was depleted in neurons using nsyb-Gal4 in Nact conditions compared to Nact alone or Mi-2-depletion alone and was indistinguishable from wild-type (circa 150–160 Dpn+ve cells). Box plots, where Box represents IQR, black line indicates median and whiskers indicate ±1.5 × IQR. (*p<0.05, **0.001 < P < 0.05, ***p<0.001, ****p<0.0001, t-test).
Figure 3—figure supplement 2
Mi-2 depletion enhances the activation of Notch regulated genes.
(A–B) Depletion of Mi-2 in NB lineages that receive excessive Notch signalling results in an increase in the expression of the Notch regulated enhancers from pathetic (A; path[NRE]-GFP, green) (A) or CycE (B; CycE[NRE]-GFP, green) as indicated. Expression of Dpn (red) and Notch reporters (green) in wild type (control), Nact expressing (>Nact; >w-Ri) and Nact with Mi-2 depleted (>Nact; >Mi-2-Ri). Hyperplastic lineages with low/no (arrows) or high (arrowheads) levels of Notch reporter expression are indicated. (C) Grainy head (Grh) and Miranda (Mira) are upregulated when Mi-2 is depleted in NB lineages expressing Nact; Dpn+ve (green), Grh+ve (red) and Mira+ve (blue) in the indicated genotypes.
Figure 4 with 4 supplements
Expression of Ε(spl)mγ-GFP in GMCs following Mi-2 depletion in Nact expressing lineages.
(A, B) Time points from two different time lapse movies of Nact Mi-2-RNAi NB lineages (dissociated from larval brains with grhNBGal4 Gal80ts at the permissive temperature for 24 hr). Ε(spl)mγ-GFP remains at high levels in emerging GMCs. Upper panels, bright-field images of NB and its progeny combined with Histone-RFP (red, H2Av-RFP) to monitor cell cycle stages; lower panels, expression of Ε(spl)mγ-GFP (greyscale). Time is depicted below each panel along with cartoons of the lineages where NBs are in darker shades of green, GMCs with low expression of Ε(spl)mγ-GFP in light green. Numbers correspond to different cells indexed in C, D. Scale bar 25 μm. (C, D) Bar chart depicting progression of each cell in a Nact Mi-2 RNAi NB lineage, bar thickness indicates cell-size and the colour represents Ε(spl)mγ-GFP levels according to the scale (blue low levels, yellow high levels). Dashed lines mark mitotic events linking to the emerging daughter cells. (E) Bar diagram depicted the percent of lineages with newly born GMCs that retain expression of Ε(spl)mγ-GFP in WT, Nact expressing and Nact expressing with compromised Mi-2. (F) Levels of Ε(spl)mγ-GFP during one division cycle in NBs from WT,>Nact and>Nact, Mi-2 RNAi. Ε(spl)mγ-GFP levels are high in interphase, immediately after mitosis in early G1 and before mitosis in late G2. However, in >Nact, Mi-2 knockdown, the second phase of high Ε(spl)mγ-GFP is lost. (G) Plot of Ε(spl)mγ-GFP levels in newly born GMCs in WT,>Nact and>Nact; Mi-2 RNAi. Note that Ε(spl)mγ-GFP levels decay in newly born GMCS in WT and >Nact but are maintained in >Nact; Mi-2 RNAi lineages.
Figure 4—figure supplement 1
Expression of Ε(spl)mγ-GFP in GMCs upon Mi-2 depletion in NB lineages.
(A) Time points from a time lapse movie of LacZ; Mi-2-Ri NB lineages (dissociated from larval brains with grhNBGal4 Gal80ts at the permissive temperature for 24 hr). Ε(spl)mγ-GFP is switched off in emerging GMCs as in WT lineages. Upper panels, bright field images of NB and its progeny combined with Histone-RFP (red, H2Av-RFP) to monitor cell cycle stages; lower panels, expression of Ε(spl)mγ-GFP (black). Time is depicted below each panel along with cartoons of the lineages where NBs are in darker shades of green, emerging GMCs with low expression of Ε(spl)mγ-GFP in light green and GMCs with no expression of E(spl)mγ-GFP in yellow. Asterisks indicate progeny from same ancestor cell. Numbers correspond to different cells indexed in B. Scale bar 25 μm. (B) Bar chart depicting progression of each cell in a Mi-2-Ri NB lineage, bar thickness indicates cell-size and the colour represents Ε(spl)mγ-GFP levels according to the scale (blue low levels, yellow high levels). Dashed lines mark mitotic events linking to the emerging daughter cells. (C) Plot of Ε(spl)mγ-GFP levels in NBs, newly born GMCs and progeny in >LacZ; Mi-2-Ri. Note that Ε(spl)mγ-GFP levels decay in newly born GMCS in >LacZ; Mi-2-Ri lineages.
Figure 4—video 1
Time-lapse movie of Mi-2-RNAi NB lineage with a duration of 10 hr.
Bright field series of images of NB and its progeny with histone-RFP (red, H2Av-RFP) to mark all nuclei are shown on the left. E(spl)mγ-GFP levels are depicted in greyscale on the right. Time is indicated in min on the top left corner. Scale bar 25 μm. Note that E(spl)mγ-GFP is rapidly extinguished from emerging NB progeny similar to wild-type lineages.
Figure 4—video 2
Time lapse movie of Nact Mi-2-RNAi NB lineage with a duration of 10 hr.
On the left, bright-field images of NB and its progeny with histone-RFP (red, H2Av-RFP) marks all nuclei. On the right, E(spl)mγ-GFP levels are depicted in greyscale. Top left, time is indicated in min. Scale bar 25 μm. Note that E(spl)mγ-GFP is not extinguished from emerging NB progeny.
Figure 4—video 3
Time lapse movie of a larger Nact Mi-2-RNAi NB lineage with a duration of 10 hr.
Bright-field images of NB and its progeny combined with histone-RFP (red, H2Av-RFP) to mark all nuclei are depicted on the left. E(spl)mγ-GFP levels are depicted in greyscale on the right. Time is indicated in min on the top left. Scale bar 25 μm. Note again that E(spl)mγ-GFP remains high both in emerging and older NB progeny.
Figure 5 with 1 supplement
Loss of Mi-2 leads to de-repression of E(spl)-C genes.
(A) Genomic region spanning Ε(spl)-C locus with graphs depicting Mi-2 bound regions in S2 cells (purple) (Kreher et al., 2017) and Kc cells (magenta) (modEncode; Ho et al., 2014), Su(H)-bound regions in Kc cells (cyan) (Skalska et al., 2015) and chromatin signatures from Kc cells (Skalska et al., 2015). Gene models are depicted in black. (B) Levels of Mi-2 protein are reduced upon knockdown of Mi-2 via RNAi in Kc cells for 3 days compared to knockdown of GFP or Hairless via RNAi. Anti-tubulin is a control for loading. (C, D) Fold change in RNA levels in Kc cells upon knockdown of Mi-2 (C) or Hairless (D) compared to control conditions (con: GFP RNAi) and to cells with Notch activation (Nact). Note that E(spl)mβ and E(spl)m3 are both significantly de-repressed in Notch-off state and show even higher increase in expression in Notch-on state. (E) Fold change in RNA levels in Kc cells upon combined knockdown of Mi-2 and Hairless compared to control conditions and single knockdown of Mi-2 or Hairless. Note additive effects on E(spl)mβ and E(spl)m3 de-repression in combined knock-down conditions. (F) Mi-2 does not directly interact with Hairless. Immunoprecipitations with anti-GFP from Kc cells expressing Hairless-GFP or MCP-GFP as control, Su(H) is co-purified with Hairless but not Mi-2. (G) Enrichment of Su(H) is indicated at E(spl)-C or regions in Kc cells as revealed by ChIP in control (grey) or Mi-2 knockdown (for 3 days, green) conditions in Notch off (light shading) and Notch active (EGTA treatment 30 min; dark shading). Su(H) recruitment in Notch active and in control conditions is not altered by knockdown of Mi-2. (H) Enrichment of Mi-2 at indicated positions in E(spl)-C or other regions in Kc cells as revealed by ChIP. (P values: *0.01 < P < 0.05, ** 0.001 < P < 0.01, ***p<0,001, Multiple t-tests).
Figure 5—figure supplement 1
Effects of Mi-2 depletion on histone modifications at the E(spl)-C locus.
(A) Fold change in RNA levels in Kc cells upon knockdown of Mi-2 or Hairless compared to control conditions (con: GFP RNAi). Mi-2 or Hairless knock down was performed for 3 days prior to the experiment. Note that Mi-2 and H are both downregulated indicating that the knockdown strategy was successful and E(spl)mδ, E(spl)mγ, E(spl)mα and E(spl)m7 are all significantly de-repressed in Notch-off state. (B) Fold change in RNA levels in Kc cells upon knockdown of Mi-2 compared to control conditions (con: GFP RNAi) and to cells with Notch activation (Nact). Note that other Notch regulated genes such as CG12290, CG17119, Notch and regular (rgl) are de-repressed in Notch-off state and have enhanced expression in Notch-on state (C) Fold change in RNA levels in Kc cells upon combined knockdown of Mi-2 and Hairless compared to control conditions and single knockdown of Mi-2 or Hairless. Note that Mi-2 and H are downregulated in both single and double conditions indicating that the knockdown strategy was successful. (D) Enrichment of Histone H3 is indicated at E(spl)-C or regions in Kc cells as revealed by ChIP in control (grey) or Mi-2 knockdown (for 3 days, green) conditions in Notch-off (light shading) and Notch-on (EGTA treatment 30 min; dark shading). H3 distribution in Notch active and in control conditions is not altered by knockdown of Mi-2. (E) Enrichment for various histone modifications such as H3K27acetylation, H3K27trimethylation and H3K56acetylation is indicated at E(spl)-C locus in Kc cells as revealed by ChIP in control (grey) or Mi-2 knockdown (for 3 days, green) conditions in Notch-off (light shading) and Notch-on (EGTA treatment 30 min; dark shading). No change in the levels of these modifications was detected following knockdown of Mi-2. (p values: *0.01 < p < 0.05, ** 0.001 < p < 0.01, ***p<0.001, Multiple T tests).
Figure 6 with 2 supplements
Cooperation between Zfh1 and Mi-2 in NB lineages.
(A) Zfh1 depletion enhances the number of Dpn+ve cells (green or white channels) caused by Nact over-expression, Ase marks NBs and GMCs, Pros marks progeny. (B) Scatter dot plot, the number of Dpn+ve cells per VNC in >Nact;>zfh1 Ri (N = 24, three experiments) was significantly increased compared to >Nact;>wRi larvae (N = 34, three experiments). (C) Overexpression of Zfh (>zfh1 PB; w–Ri) results in decreased number of Dpn+ve cells per VNC (N = 31, three experiments) compared to wild type (>LacZ;>w Ri; N = 17, three experiments) or Mi-2 knockdown alone (>LacZ;>Mi-2-Ri; N = 25, three experiments). Concomitant loss of Mi-2 (>zfh1 PB;>Mi-2Ri; N = 33, three experiments) rescues Zfh1-induced loss of NBs. Ase and Pros as in (A). (D) Scatter dot plot with number of Dpn+ve cells in each condition quantified. (E) zfh1-GFP expression in type I NB lineages. Zfh1 is expressed in newly born neurons and at low levels in GMCs (yellow arrowheads). Ase marks neuroblasts and GMCs whereas Pros marks older neuronal progeny in NB lineages.
Figure 6—figure supplement 1
Prospero does not cooperate with Mi-2 in NB lineages.
(A) Depletion of Pros enhances the number of Dpn+ve cells (green or white channels) caused by Nact over-expression, Ase marks NBs and GMCs, Pros marks progeny. (B) Scatter dot plot, the number of Dpn+ve cells per VNC in >Nact;>Pros Ri (N = 24, three experiments) was significantly increased compared to >Nact;>w Ri larvae (N = 27, three experiments). (C) Overexpression of Pros (>YFP Pros; w–Ri) results in decreased number of Dpn+ve cells per VNC (N = 15, four experiments) compared to wild type (>LacZ;>w Ri; N = 17, four experiments) or Mi-2 knockdown alone (>LacZ;>Mi-2-Ri; N = 16, four experiments). Concomitant loss of Mi-2 (>YFP Pros;>Mi-2-Ri; N = 14, four experiments) does not rescue Pros-induced NB loss, instead it further decreases the number of Dpn+ve cells. Ase marks NBs and GMCs, Mira marks NBs. (D) Quantification of Dpn+ve cells in each condition, where shading of symbols indicates different experimental replicates for each genotype, with mean and SEM indicated by black lines.
Figure 6—figure supplement 2
Zfh1 resists Notch-induced tumorigenesis.
(A) Ectopic expression of Zfh1 reduces the number of Dpn+ve cells (green or white channels) caused by Nact overexpression. This effect is partially rescued by the loss of Mi-2. Ase marks NBs and GMCs, Pros marks progeny. (B) Quantification of Dpn+ve cells per VNC in each condition, where shading of symbols indicates different experimental replicates for each genotype, mean and SEM indicated by black lines. > Nact;>zfh1 PB,>w Ri (N = 26, three experiments) was significantly decreased compared to >Nact;>LacZ,>w Ri larvae (N = 11, three experiments), whereas it remained unaltered in >Nact;>zfh1 PB,>Mi-2-Ri (N = 20, three experiments). (C) Mi-2-YFP and zfh1-GFP expression in type II NB lineages. Mi-2 is expressed in high levels in the Type II NB and lower levels in INPs, whereas Zfh1 is expressed only in some neurons. Yellow outlines of Type II lineages. Dpn (red) and Mira (blue) mark neuroblasts and INPs.
Figure 7
Model summarizing the role of Mi-2 in decommissioning Notch-responsive enhancers in NB progeny.
The presence of Zfh1 and Mi-2 favours the decommissioning of enhancers from E(spl) and other Notch target genes in GMCs (yellow) to ensure their expression is switched off. Notch is on in NBs (green) and off in GMCs (yellow cells) due to asymmetrical segregation of Numb (ref). GMCs divide to produce two post-mitotic neuronal cells (grey). In NB lineages with constitutive Notch activity (Nact), the presence of Mi-2 at enhancers, recruited by Zfh1 (and potentially by other factors too), is sufficient to attenuate Nact, so that E(spl) and other target genes are switched off in GMCs. In a few NB progeny the effects of Mi-2 are overcome with time, and E(spl) genes are up-regulated as they revert to NB-like cells. Depletion of Mi-2 in NB lineages expressing Nact severely compromises enhancer decommissioning so that E(spl) and other Notch target genes are upregulated in many of the GMCs. The majority of the NB progeny acquire an NB-like fate. SUPPLEMENTARY MATERIAL: Legends for videos.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (D. melanogaster) | Notch | NA | ID_FLYBASE:FBgn0004647 | |
| Gene (D. melanogaster) | Mi-2 | NA | ID_FLYBASE:FBgn0262519 | |
| Gene (D. melanogaster) | E(spl)mγ | NA | ID_FLYBASE:FBgn0002735 | |
| Gene (D. melanogaster) | dpn | NA | ID_FLYBASE:FBgn0010109 | |
| Gene (D. melanogaster) | zfh1 | NA | ID_FLYBASE:FBgn0004606 | |
| Genetic reagent (D. melanogaster) | grh-Gal4 | PMID: 9651493 | Prokop et al., 1998 | |
| Genetic reagent (D. melanogaster) | UAS-NΔecd | PMID: 8413612,8343959 | Fortini et al., 1993; Rebay et al., 1993 | |
| Genetic reagent (D. melanogaster) | UAS-Mi-2-RNAi | Bloomington Stock Center | ID_BDSC:33419 | Genotype: y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00301}attP2 |
| Genetic reagent (D. melanogaster) | UAS-MTA1-like RNAi | Bloomington Stock Center | ID_BDSC:33745 | Genotype: y[1] sc[*] v[1]; P{y[+t7.7]v[+t1.8]=TRiP. HMS01084}attP2 |
| Genetic reagent (D. melanogaster) | UAS-Caf1p-55 RNAi | Bloomington Stock Center | ID_BDSC:34069 | Genotype: y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00051}attP2 |
| Genetic reagent (D. melanogaster) | UAS-zfh1-RNAi | Bloomington Stock Center | ID_BDSC:29347 | Genotype: y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02509}attP2/TM3, Sb[1] |
| Genetic reagent (D. melanogaster) | UAS-Pros RNAi | Bloomington Stock Center | ID_BDSC: 26745 | Genotype: y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02308}attP2/TM3, Sb[1] |
| Genetic reagent (D. melanogaster) | UAS-zfh1-RB | Bloomington Stock Center | ID_BDSC: 6879 | made by Antonio Postigo (Siles et al., 2013); genotype: w[1118]; P{w[+mC]=UAS-zfh1.P}2B |
| Genetic reagent (D. melanogaster) | H2Av-RFP | Bloomington Stock Center | ID_BDSC:23651 | w*; P {His2Av-mRFP1}II.2 |
| Genetic reagent (D. melanogaster) | zfh1-GFP | PMID: 30002131 | Albert et al., 2018 | |
| Cell line (D. melanogaster) | Kc 167 cells | Drosophila Genomics Resource Center | ID_DGRC: 1 | |
| Antibody | guinea pig polyclonal anti-Deadpan | Christos Delidakis, Heraklion, Greece | (Immuno fluorescence dilution 1:2000) | |
| Antibody | rabbit polyclonal anti-Mi-2 | Alexander Brehm, Marburg, Germany | (Immunofluorescence dilution 1:10,000) Kreher et al., 2017; PMID: 28378812 | |
| Antibody | rabbit polyclonal anti-Asense | Y.N.Yan, San Fransisco, USA | (Immunofluorescence dilution 1:2000) Brand et al., 1993; PMID 8565817 | |
| Antibody | mouse monoclonal anti-Pros | Drosophila Hybridoma Studies Bank | ID_DHSB: MR1A | (Immuno fluorescence dilution 1:50) |
| Antibody | mouse monoclonal anti-Mira | Fumio Matsuzaki, Kobe, Japan | (Immuno fluorescence dilution 1:100) Ohshiro et al., 2000; PMID 11117747 | |
| Antibody | goat polyclonal anti-Su(H) | Santa Cruz Biotechnology | ID_SC: sc15813 | (12 μl per ChIP with 15 × 106 cells) |
| Antibody | rabbit polyclonal anti-H3K56ac | Active Motif | ID_Active Motif: 39281 | (3 μl per ChIP with 15 × 106 cells) |
| Antibody | rabbit polyclonal anti-H3K27me3 | Millipore | ID_Millipore: 07–449 | (1 μl per ChIP with 15 × 106 cells) |
| Antibody | rabbit polyclonal anti-H3K27ac | Abcam | ID_ABCAM: ab4729 | (10 μl per ChIP with 15 × 106 cells) |
| Antibody | rabbit polyclonal anti-H3 | Abcam | ID_ABCAM: ab1791 | (1 μl per ChIP with 15 × 106 cells) |
| Sequence- based reagent | This paper | oligonucleotides for mRNA levels and ChIP qPCR assays; Tables 1 and 2 | ||
| Commercial assay or kit | MEGAscript T7 Transcription Kit | ThermoFischer Scientific | ID_TFS: AMB 13345 | |
| Commercial assay or kit | Ambion,DNA-free kit | ThermoFischer Scientific | ID_TFS: AM1906 | |
| Commercial assay or kit | M-MLV reverse transcriptase | Promega Corporation | ID_Promega: M531A | |
| Commercial assay or kit | LightCycler 480 SYBR Green I Master PCR Kit | Roche | ID_Roche: 4707516001 | |
| Chemical compound, drug | Collagenase | Sigma | ID_Sigma: C0130 |
Table 1
PCR primers for RNA analysis:
https://doi.org/10.7554/eLife.41637.022| Primer name (for RNA) | Primer sequence |
|---|---|
| mβ coding sequence for | AGAAGTGAGCAGCAGCCATC |
| mβ coding sequence rev | GCTGGACTTGAAACCGCACC |
| m3 coding sequence for | CGTCTGCAGCTCAATTAGTC |
| m3 coding sequence rev | AGCCCACCCACCTCAACCAG |
| mδ coding sequence for | AGGATCTCATCGTGGACACC |
| mδ coding sequence rev | CAGACTTCTTCGCCATGATG |
| mα coding sequence for | TCCCAATGCTCGCCTTTAGA |
| mα coding sequence rev | TGATCTCCAAGCGGAGTATG |
| mγ coding sequence for | TCAGATCCAGCCAGCAGAAA |
| mγ coding sequence rev | CTGGAGATTGGCGAAATGGG |
| m7 coding sequence for | GCACTGCACACACACACTTC |
| m7 coding sequence rev | AACAATATACGTGGCCGGTT |
| Rpl32 sense | ATGCTAAGCTGTCGCACAAATG |
| Rpl32 antisense | GTTCGATCCGTAACCGATGT |
| Mi-2 coding sequence for | GAGCGGCCTACCTTAACCTC |
| Mi-2 coding sequence rev | TCAGATGCTGATGGGATTCA |
| Hairless coding sequence for | TACGAGCGAGGATGAGGAAC |
| Hairless coding sequence rev | TCCCAATGCTCGCCTTTAGA |
| CG17119 coding sequence for | TCGTTGAGCATCACAGGATTCA |
| CG17119 coding sequence rev | TCAACTGCGGCCTCTATTTCAT |
| CG12290 coding sequence for | AACTGATGCCCGTACAGGAG |
| CG12290 coding sequence rev | GCTGTCTGGCGGAGTAGTTC |
| Notch coding sequence for | CGGACTCGACTGTGAGAACA |
| Notch coding sequence rev | GGAACTGAGCCTGAATCTCG |
| Rgl coding sequence for | GAGGATTGGCACGAGGATAA |
| Rgl coding sequence rev | ACTGTTTGATGAGCCGTTCC |
Table 2
Primers for ChIP – qPCR:
https://doi.org/10.7554/eLife.41637.023| Primer name (for ChIP) | Primer sequence |
|---|---|
| mβ for | AGAGGTCTGTGCGACTTGG |
| mβ rev | GGATGGAAGGCATGTGCT |
| m3 for | ACACACACAAACACCCATCC |
| m3 rev | CGAGGCAGTAGCCTATGTGA |
| con for | CAATTCCACGAAGCACAGTC |
| conrev | GAGGAGCAGTCCATCGAGTT |
| CG17119_qPCR_5 | TACATGGGCTTTGTCGGTCG |
| CG17119_qPCR_3 | CACGGCCCTCGCCATATAAA |
| Br-5 for | CACAGAAGGAAGAAGCAGCA |
| Br-5 rev | CGGGACTGGCAAATTTCTT |
| Vri-2 for | TGTGGACGTGGAATTGGAT |
| Vri-2 rev | CAATGACACTTGGGCATGG |
| mδ for | AGCAGAAACCCACACCCATA |
| mδ rev | TTCCCTCGAGAAAAGAGAGC |
| mδ−3 for | AGACCAGAGACCCAGAGCAA |
| mδ−3 rev | GGCGCAATAAAGTTGAAAGC |
| mα−3 for | AAGCCAGTGGACTCTGCTCT |
| mα−3 rev | TGATCTCCAAGCGGAGTATG |
| m6 for | CGAACGTTGGGCTGATAGTT |
| m6 rev | AAAAGTCCAACCACCCAACA |
| m7 for | CAAGCATGCGCACACATATT |
| m7 rev | CATCGGGGTTGGCTTATTGT |
| Sav-cds-5 | GAGTAGGTGTTCCGACTGGTG |
| Sav-cds-3 | ATCAGCGGGCCAAGAAGAAAT |
| P53 cds for | TTATAGCAATGCACCGACGC |
| P53 cds rev | GACGAACGCCAGCTCAATAG |
| Him/Her for | CGAACCGAGTTGTGGGAAAT |
| Him/Her rev | CCCTTGGAGTGACAATTAGCTG |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.41637.025
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Mi-2/NuRD complex protects stem cell progeny from mitogenic Notch signaling
eLife 8:e41637.
https://doi.org/10.7554/eLife.41637
