A conserved major facilitator superfamily member orchestrates a subset of O-glycosylation to aid macrophage tissue invasion
- Institute of Science and Technology Austria, Austria
- University of Warwick, United Kingdom
- University of Copenhagen, Denmark
Figures
Figure 1 with 1 supplement
T antigen is enriched on Drosophila macrophages prior to and during their invasion of the extended germband.
(A) Schematic of T antigen modification of serine (S) and threonine (T) on proteins within the Golgi lumen, through successive addition of GalNAc (yellow) by GalNAcTs and Gal (blue) by C1GalTs. …
-
Figure 1—source data 1
Source data on the quantification of T antigen levels shown in Figure 1E and Figure 1I, the number of macrophages in the germband shown in Figure 1K–M, and the number on the yolk shown in Figure 1—figure supplement 1N–O,Q and on the vnc (Figure 1—figure supplement 1P).
- https://doi.org/10.7554/eLife.41801.005
Figure 1—figure supplement 1
Lectin screen reveals enriched staining for PNA and UEA-1 on macrophages.
(A–L) Confocal images of fixed late Stage 11/early Stage 12 wild type embryos (schematic above) stained with different lectins (visualized in green) indicated in green type in the lower left corner. …
Figure 2 with 1 supplement
An atypical MFS family member, CG8602, located in the Golgi and endosomes, is required for T antigen enrichment on invading macrophages.
(A,B) qPCR quantification (2-ΔCt) of RNA levels in mCherry+ macrophages FACS sorted from srpHemo-3xmCherry wild type embryos reveals no significant change in the expression of (A) the C1GalTA …
-
Figure 2—source data 1
Source data on the quantification of C1GalTA, Ugalt, and CG8602 expression in macrophages by qPCR (shown in Figure 2A–B,D–E,G) and the Pearson’s coefficient for CG8602 colocalization with different markers (Figure 2H).
- https://doi.org/10.7554/eLife.41801.008
Figure 2—figure supplement 1
CG8602 expression and localization.
(A) Schematic depicting the CG8602 gene and the insertion site of the EP3102 P element and the Δ33 excision mutant induced by P element mobilization which removes 914 bp of the ORF. (B–J) Confocal …
Figure 3 with 4 supplements
CG8602, which we name Minerva, is required in macrophages for their efficient invasion of the germband.
(A–C) Representative confocal images of early Stage 12 embryos from (A) control, (B) P{EP}CG8602EP3102 = minerva (mrva)3102 mutant, and (C) mrva3102 mutants with macrophage expression of the gene …
-
Figure 3—source data 1
Source data on the quantification of macrophages in the germband shown in Figure 3D–E,G and Figure 3—figure supplement 1A, on the yolk (Figure 3F) on the vnc (Figure 3H, Figure 3—figure supplement 1C) and in the whole embryo (Figure 3—figure supplement 1D–E).
Source data on the xyz position of macrophages from the tracks that form the basis of the analysis shown in Figure 3J–K,M and Figure 3—figure supplement 1F,G. Source data on the mismigration of germ cells, the levels of mrva expression in the ovary, and the migration of border cells (Figure 3—figure supplement 1I,J and L, respectively). Source data on the xyz position of macrophages in the movies of the mrva3102 mutant and the control underlying the analysis shown in Figure 3J-K,M and Figure 3—figure supplement 1F-G.
- https://doi.org/10.7554/eLife.41801.011
Figure 3—figure supplement 1
CG8602 (Minerva) affects macrophage migration into the germband but not along the vnc and does not alter border cell or germ cell migration.
(A) Quantification of the number of macrophages in the germband (dotted circle in schematic) in embryos from control, mrva23102, and mrva3102 srpHemo(macro)-mrva::HA showing Mrva is required in …
Figure 3—video 1
Representative movie of macrophage migration into the germband in the control.
Macrophages (red) are labeled with srpHemo-H2A::3xmCherry. The time interval between each acquisition is 40 s and the display rate is 15 frames/sec. Scale bar represents 30 μm.
Figure 3—video 2
Representative movie of macrophage migration into the germband in the mrva3102 mutant.
Macrophages (red) are labeled with srpHemo-H2A::3xmCherry. The time interval between each acquisition is 40 s and the display rate is 15 frames/sec. Scale bar represents 30 μm.
Figure 3—video 3
Representative movies of macrophage migration on the vnc in the control and mrva3102 mutant.
Macrophages (red) are labeled with srpHemo-H2A::3xmCherry. The time interval between each acquisition is 40 s and the display rate is 15 frames/sec. Scale bar represents 30 μm.
Figure 4 with 1 supplement
Glycoproteomic analysis reveals Minerva is required for higher levels of T-antigen on a subset of proteins.
(A) Representative Western blot of protein extracts from Stage 11/12 control and mrva3102 mutant embryos probed with T antigen antibody. Arrows indicate decreased/missing bands in the mutant …
Figure 4—figure supplement 1
Related to Supplementary file 1: Further information on the mass spectrometry results.
(A) Work flow for mass spectrometry analysis of T and Tn antigen modifications on proteins in Stage 11/12 control and mrva3102 mutant embryos. (B, C) Annotated ETD MS2 spectra of the VHQPSATPASK …
Figure 5 with 2 supplements
Qsox1 is required for macrophage dissemination and entry into the germband tissue.
(A) Representative confocal images of early Stage 12 embryos from control and P{SUPor-P}Qsox1KG04615 = qsox1KG04615. (B–C) Quantification in early Stage 12 embryos showing a significant reduction in …
-
Figure 5—source data 1
Source data on the quantification of macrophages in the germband shown in Figure 5B-C, on the yolk shown in Figure 5—figure supplement 1A,1D, on the vnc shown in Figure 5—figure supplement 1B,1E, and in the whole embryo shown in Figure 5—figure supplement 1C.
Source data on the xyz position of macrophages from the tracks that form the basis of the analysis shown in Figure 5E-G. Source data on the quantification of the Pearson's coefficient for Qsox1 colocalization with different markers shown in Figure 5H and the quantification of LanA intensity shown in Figure 5J and Figure 5—figure supplement 1L-N. Source data on the xyz position of macrophages in the movies of the qsox1KG04615 mutant underlying the analysis shown in Figure 5E-G and Figure 5—figure supplement 1F.
- https://doi.org/10.7554/eLife.41801.020
Figure 5—figure supplement 1
Qsox1 affects germband entry and Laminin A.
(A–B) Quantification of macrophages in fixed mid-Stage 12 embryos in control and qsox1KG04615 mutants reveals that in the mutant there are (A) increased numbers of macrophages on the yolk …
Figure 5—video 1
Representative movie of macrophage migration into the germband in the qsox1KG04615 mutant.
Macrophages (red) are labeled with srpHemo-H2A::3xmCherry. The time interval between each acquisition is 40 s and the display rate is 15 frames/sec. Scale bar represents 30 μm.
Figure 6 with 1 supplement
Minerva’s murine ortholog, MFSD1, can substitute for Minerva’s functions in migration and T-antigen glycosylation.
(A) Topology prediction of mouse MFSD1 (NP_080089.1) using the online tools TMPred (Hofman and Stoffel, 1993) and Protter (Omasits et al., 2014). 50% of amino acids are identical between the M. …
-
Figure 6—source data 1
Source data on the quantification of Pearson’s coefficient for MFSD1 colocalization with different markers (Figure 6C), the number of macrophages in the germband (Figure 6E) and the level of T antigen in macrophages (Figure 6F).
- https://doi.org/10.7554/eLife.41801.024
Figure 6—figure supplement 1
MFSD1-eGFP localization in colon, breast, lung and skin cancer cells.
(A) Alignment of Minerva and mmMFSD1 by BLAST. The first row shows the Minerva sequence in blue type, the second identical (one letter symbol) or similar (+) amino acids in black, and the third the …
Tables
Key resources table
| Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|
| mrva | NA | FlyBase:FBgn0035763 | |
| qsox1 | NA | FlyBase: FBgn0033814 | |
| C1GalTA | NA | FlyBase: FBgn0032078 | |
| srp-Gal4 | PMID: 15239955 | ||
| srp-3xmCherry | PMID: 29321168 | RRID:BDSC_78358 and 78359 | |
| srp-H2A::3xmCherry | PMID: 29321168 | RRID:BDSC_78360 and 78361 | |
| UAS-CG8602::FLAG::HA | PMID: 22036573 | ||
| mrva3102 | Bloomington Drosophila Stock Center (BDSC), RRID:SCR_006457 | RRID:BDSC_17262 | |
| Df(3L)BSC117 | BDSC, RRID:SCR_006457 | RRID:BDSC_8976 | |
| UAS-mCherry.NLS | BDSC, RRID:SCR_006457 | RRID:BDSC_38425 | |
| C1GalTA2.1 | BDSC, RRID:SCR_006457 | RRID:BDSC_28834 | |
| C1GalTA RNAi 1 | Vienna Drosophila Resource Centre (VDRC), RRID:SCR_013805 | VDRC: 2826 | |
| C1GalTA RNAi 2 | VDRC, RRID:SCR_013805 | VDRC: 110406 | |
| CG8602 RNAi | VDRC, RRID:SCR_013805 | VDRC: 101575 | |
| qsox1RNAi | VDRC, RRID:SCR_013805 | VDRC: 108288 | |
| qsox1 KG04615 | BDSC, RRID:SCR_006457 | RRID:BDSC_13824 | |
| MC-38 | Other | Gift from Borsig lab, Univ of Zurich (UZH) | |
| 4T1 | Other | ATCC Cat# CRL-2539, RRID:CVCL_0125 | Gift from Borsig lab, UZH |
| LLC1 | Other | ATCC Cat# CRL-1642, RRID:CVCL_4358 | Gift from Borsig lab, UZH |
| B16-BL6 | Other | NCI-DTP Cat# B16BL-6, RRID:CVCL_0157 | Gift from Borsig lab, UZH |
| S2R+ | Other | Gift from Frederico Mauri of the Knoblich lab at IMBA, Vienna | |
| srpHemo-CG8602::3xmCherry | this paper | CG8602 amplified from genome cloned into DSPL172 (PMID: 29321168) | |
| MT-CG8602::FLAG::HA | Drosophila Genomic Resource Center (DGRC), RRID:SCR_002845 | DGRC: FMO06045 | |
| MT-Qsox1::FLAG::HA | DGRC, RRID:SCR_002845 | DGRC: FMO06379 | |
| PTS1-GFP | Other | Gift from Dr. McNew | |
| MFSD1-eGFP | this paper | MFSD1 amplified from dendritic cell cDNA library, inserted into Doxycycline inducible expression vector pInducer20 | |
| Anti-GFP clone 2B6 | Other | Gift from Ogris lab, MFPL Vienna; (1:100) for WB | |
| Anti-GFP clone 5G4 | Other | Gift from Ogris lab, MFPL Vienna; (1:50) for immunochemistry | |
| Anti-T-antigen (mouse monoclonal) | PMID: 23584533 | (1:5 for immunochemistry; 1:10 for WB) | |
| Anti-profilin (mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB), RRID:SCR_013527 | DSHB Cat# chi 1J, RRID:AB_528439 | (1:50) |
| Anti-GAPDH (rabbit monoclonal) | Abcam, RRID:SCR_012931 | Abcam Cat# ab181603, RRID:AB_2687666 | (1:10000) for WB |
| Anti-GRASP65 (rabbit polyclonal) | Thermo Fisher Scientific, RRID:SCR_008452 | ThermoFischer Cat# PA3-910, RRID:AB_2113207 | (1:200) for immunochemistry |
| Anti-Rab5 (rabbit monoclonal) | Cell Signaling Technology (CST), RRID:SCR_004431, Clone C8B1 | CST Cat# 3547, RRID:AB_2300649 | (1:200) for immunochemistry |
| Anti-Rab7 (rabbit monoclonal) | CST, RRID:SCR_004431, Clone D95F2 | CST Cat# 9367, RRID:AB_1904103 | (1:200) for immunochemistry |
| Anti-LAMP1 (rabbit polyclonal) | Abcam, RRID:SCR_012931 | Abcam Cat# ab24170, RRID:AB_775978 | (1:200) for immunochemistry |
| Anti- Cnx99a (mouse monoclonal) | DSHB, RRID:SCR_013527 | DSHB Cat# Cnx99A 6-2-1, RRID:AB_2722011 | (1:5) |
| Anti- Hrs 27.4 (mouse monoclonal) | DSHB, RRID:SCR_013527 | DSHB Cat# Hrs 27–4, RRID:AB_2618261 | (1:5) |
| Anti- Golgin 84 (mouse monoclonal) | DSHB, RRID:SCR_013527 | DSHB Cat# Golgin8412–1, RRID:AB_2722113 | (1:5) |
| Anti Rab7 (mouse monoclonal) | DSHB, RRID:SCR_013527 | DSHB Cat# Rab7, RRID:AB_2722471 | (1:5) |
| Anti-GMAP (goat polyclonal) | DSHB, RRID:SCR_013527 | DSHB Cat# GMAP, RRID:AB_2618259 | (1:50) |
| Anti- Golgin 245 (goat polyclonal) | DSHB, RRID:SCR_013527 | DSHB Cat# Golgin245, RRID:AB_2618260 | (1:50) |
| Anti- HA (rat monoclonal) | Roche, RRID:SCR_001326 | Roche Cat# 3F10, RRID:AB_2314622 | (1:50) |
| Anti-LanA (rabbit polyclonal) | PMID:9257722 | gift from Stefan Baumgartner (1:500) | |
| Anti-Vasa (rat monoclonal) | DSHB, RRID:SCR_013527 | DSHB Cat# anti-vasa, RRID:AB_760351 | (1:25) |
| Alexa 488- or 557- or 633- secondaries | Thermo Fisher Scientific, RRID:SCR_008452 | (1:500 for 488 and 557; 1:100 for 633) | |
| Goat-anti-rabbit IgG (H + L)-HRP | BioRad | Bio-Rad Cat# 170–6515, RRID:AB_2617112 | (1:10000) |
| Goat-anti-mouse IgG (H/L):HRP | BioRad | Bio-Rad Cat# 170–6516, RRID:AB_11125547 | (1:10000) |
| LysoTracker Green DND-26 | Invitrogen, RRID:SCR_008410 | L7526 | 75 nM |
| Alexa Fluor 488 Phalloidin | Invitrogen, RRID:SCR_008410 | A12379 | (1:500) |
| Vectashield mounting medium | Vector Laboratories, RRID:SCR_000821 | VectorLabs: H-1000 | |
| Vectashield mounting medium with DAPI | Vector Laboratories, RRID:SCR_000821 | VectorLabs: H-1200 | |
| Halocarbon Oil 27 | Sigma-Aldrich, RRID:SCR_008988 | Sigma Aldrich: Cat# H8773 | |
| srpHemo-mrva | this paper | CG8602 amplified from genome cloned into srpHemo plasmid | |
| srpHemo-MFSD1 | this paper | mmMFSD1 amplified from dendritic cell cDNA library cloned into srpHemo plasmid | |
| Mrva fw | Fly Primer Bank | qPCR; 5'TGTGCTTCGTGGGAGGTTTC | |
| Mrva rv | Fly Primer Bank | qPCR; 5'GCAGGCAAAGATCAACTGACC | |
| C1GalTA fw | Fly Primer Bank | qPCR; 5'TGCCAACAGTCTGCTAGGAAG | |
| C1GalTA rv | Fly Primer Bank | qPCR: 5'CTGTGATGTGCATCGTTCACG | |
| Ugalt fw | Fly Primer Bank | qPCR; 5'GCAAGGATGCCCAGAAGTTTG | |
| Ugalt rv | Fly Primer Bank | qPCR; 5'GATATAGACCAGCGAGGGGAC | |
| RpL32 fw | Fly Primer Bank | qPCR; 5'AGCATACAGGCCCAAGATCG | |
| RpL32 rv | Fly Primer Bank | qPCR; 5'TGTTGTCGATACCCTTGGGC | |
| Lectin staining kit #2 | EY Laboratories | EYLabs:FLK-002 | |
| FIJI | http://fiji.sc/ RRID:SCR_002285) | ||
| Imaris | http://www.bitplane.com/imaris/imaris, RRID:SCR_007370 | ||
| Matlab | https://www.mathworks.com/products/matlab.html, RRID:SCR_001622 | ||
| FlowJo | https://www.flowjo.com/RRID:SCR_008520 | ||
| LaVision ImSpector | http://www.lavisionbiotec.com/, RRID:SCR_015249 | ||
| Proteome Discoverer 1.4 | https://www.thermofisher.com/order/ catalog/product/OPTON-30795, RRID:SCR_014477 | ||
| LightCycler 480 software | https://lifescience.roche.com/en_at/products/lightcycler14301-480 -software-version-15.html | ||
| GraphPad Prism | https://www.graphpad.com/scientific-software/prism/ RRID:SCR_002798 |
Additional files
-
Supplementary file 1
Mass spectrometric analysis of the T and Tn antigen containing O-glycoproteome from wild type and mrva3102 mutant Stage 11–12 Drosophila melanogaster embryos.
Each row lists an individually identified tryptically processed peptide. The 2nd–4th columns describe the analyzed peptide. The 5th, 6th, 7th and 12th are the names and accessions to Uniprot. The 8th indicates the position of the modified amino acid. The 9th indicates the number and 10th the type of glycosylation. The 11th lists the exact position and the 13th the exact description of glycosylation. The 14th is the ratio of the amount of the particular glycopeptide in the control samples (medium) over the amount in the mrva3102 (light). The 15th is the number of missed cleavages after the tryptic digest. The 16th is the measured intensity. The 17th column shows the mass to charge ratio.
- https://doi.org/10.7554/eLife.41801.025
-
Supplementary file 2
All candidate proteins from the O-glycoproteome with at least 3-fold changes in T and Tn antigen in the mrva3102 mutant.
Columns list the gene name, the predicted or known function of the gene, if other T or Tn glycosites on the protein are unchanged or changed in the opposite direction, any known human ortholog (identified by BLAST), references for links to cancer and cancer invasion for the mammalian orthologs, the precise site altered, the T and Tn antigen changes observed at a particular glycosylation site, the number of glycosites on the peptide, the peptide sequence and if the glycosylation site is conserved. The site is considered conserved if the human ortholog has a serine or threonine ±5 amino acids from the Drosophila glycosite. References: 1 (Göhrig et al., 2014); 2. (Fan et al., 2018); 3. (Webb et al., 1999); 4. (C.-C. Chiu et al., 2011); 5. (Huang et al., 2016); 6. (Matos et al., 2015); 7. (Cawthorn et al., 2012); 8. (Cao et al., 2015) 9. (Walls et al., 2017); 10.(Zhou et al., 2017); 11. (Linton et al., 2008); 12. (Bian et al., 2016) 13. (Zhang et al., 2016); 14. (Gonias et al., 2017); 15. (Katchman et al., 2013; Katchman et al., 2011); 16. (Stojadinovic et al., 2007); 17. (Zhou et al., 2016); 18. (Hu et al., 2018); 19. (Li et al., 2008); 20. (Senanayake et al., 2012); 21. (Sheu et al., 2014); 22. (Mao et al., 2018); 23.(Yokdang et al., 2016).
- https://doi.org/10.7554/eLife.41801.026
-
Supplementary file 3
T or Tn antigen modified receptors from the wild-type St 11–12 Drosophila melanogaster embryo O-glycoproteome.
Columns list the gene name for the receptor, its reported function, what kind of glycosylation we identified to be present on the receptors in the wild type sample, and what kind of glycosylation change we observed in the mrva3102 mutant.
- https://doi.org/10.7554/eLife.41801.027
-
Transparent reporting form
- https://doi.org/10.7554/eLife.41801.028
