1. Biochemistry and Chemical Biology
Download icon

Insights into AMS/PCAT transporters from biochemical and structural characterization of a double Glycine motif protease

  1. Silvia C Bobeica
  2. Shi-Hui Dong
  3. Liujie Huo
  4. Nuria Mazo
  5. Martin I McLaughlin
  6. Gonzalo Jiménez-Osés
  7. Satish K Nair  Is a corresponding author
  8. Wilfred A van der Donk  Is a corresponding author
  1. University of Illinois at Urbana-Champaign, United States
  2. University of llinois at Urbana-Champaign, United States
  3. Universidad de La Rioja, Spain
  4. CICbioGUNE, Spain
  5. Howard Hughes Medical Institute, University of Illinois at Urbana-Champaign, United States
Research Article
Cite this article as: eLife 2019;8:e42305 doi: 10.7554/eLife.42305
6 figures, 6 tables, 1 data set and 1 additional file

Figures

Sequence similarity network (SSN) of select full length AMS/PCAT proteins.

Alignment cutoff of at least 45% sequence identity was applied to separate the clusters. The nodes representing LahT homolog sequences are colored by their corresponding phylum. Nodes of several characterized LahT homologs are marked by red circles and are labeled. The SSN tool draws sequences from UniProt; To increase the coverage of the network, additional sequences not in UniProt were added manually (grey nodes).

https://doi.org/10.7554/eLife.42305.002
(A) Precursor peptides encoded in Lachnospiraceae C6A11 highlighting the conservation in the leader peptide with a sequence conservation logo (Crooks et al., 2004).

The double Gly motif is boxed.

https://doi.org/10.7554/eLife.42305.003
Figure 3 with 1 supplement
MALDI ToF MS analysis of proteolytic leader peptide removal of two LahA substrates catalyzed by LahT150.

(A–B) MALDI ToF MS analysis of full length N-terminally hexahistidine tagged LahA4 and LahA7. (C) MALDI ToF MS analysis of the core peptides of LahA4 and LahA7 after LahT150 cleavage. Core peptide masses are [M + H]+: LahA4 (calcd 2352.2; obsd 2352.0), LahA7 (calcd 2660.3; obsd 2659.8). (D) MALDI TOF MS analysis of the leader peptides of LahA4 and LahA7 after LahT150 cleavage. Leader peptide average masses are [M + H]+: LahA4-leader (calcd 10188.8, obsd 10187.5), LahA7-leader (calcd 9246.9, obsd 9248.7). For five additional LahA substrates, see Figure 3—figure supplement 1.

https://doi.org/10.7554/eLife.42305.004
Figure 3—figure supplement 1
LahT150 cleaves all LahA peptides.

MALDI ToF MS analysis of LahA peptides treated with LahT150. Core peptide ([M + H]+) masses: LahA1 (theor 2616.4; obs 2616.5). LahA2 (theor 2761.4; obs 2762.0). LahA3 (theor 2740.4; obs 2740.7). LahA5 (theor 2811.4; obs 2810.8). LahA6 (theor 2771.4; obs 2771.4). Leader peptide average [M + H]+ masses: LahA1-leader (theor 9973.6, obs 9973.3), LahA2-leader (theor 9827.6, obs 9830.1), LahA3-leader (theor 9756.5, obs 9751.2); LahA5-leader (theor 9964.8, obs 9969.1), LahA6-leader (theor 9458.6, obs 9462.9).

https://doi.org/10.7554/eLife.42305.005
Figure 4 with 4 supplements
(A) Illustration of the posttranslational modifications in lanthipeptides.

Serine and threonine residues are dehydrated by a lanthionine synthetase, resulting in dehydroalanine (Dha) and dehydrobutyrine (Dhb). The synthetase then catalyzes the Michael type addition of neighboring cysteine residues to the dehydrated residues. (B) Removal of the leader peptide of posttranslationally modified ProcA2.8 monitored by MALDI-TOF MS. Core peptide (two-fold dehydrated) [M + H]+: calcd 2050.8, obsd 2050.9. For four additional ProcA substrates, see Figure 4—figure supplement 1. (C) In vitro leader peptide removal of AzoA6 bearing an N-terminal maltose binding protein tag. Core peptide [M + H]+: calcd 3399.9, obsd 3400.4. For two additional AzoA substrates, see Figure 4—figure supplement 2. (D–F) MALDI TOF MS analysis of LahT150 catalyzed cleavage of the RiPP precursor peptides HalA2, LctA and SunA. Core peptide masses (left panels): HalA2 (calcd 3064.4; obsd 3064.6); LctA (calcd [M + H]+ 3011.3 and [M + H + O]+ 3027.3; obsd 3011.4 and 3027.4); SunA (calcd 3718.7; obsd 3718.6). Leader peptide ([M + H]+) masses (right panels): HalA2-leader peptide (calcd avg. 5969.5; obsd 5969.5); LctA-leader peptide (calcd avg. 4754.2; obsd 4754.6); SunA-leader peptide (calcd avg. 4311.7, obsd 4311.2). (G) Sequence conservation logo (Crooks et al., 2004) showing the frequency of each amino acid (height of the letter) at the C-terminus of the 49 leader peptides in Figure 4—figure supplement 2. (H) Structure of peptide aldehyde inhibitor based on the ProcA2.8 leader peptide.

https://doi.org/10.7554/eLife.42305.006
Figure 4—figure supplement 1
Tests of LahT150 substrate tolerance with posttranslationally modified peptides.

MALDI ToF MS analysis of a selection of ProcM-modified ProcA peptides treated with LahT150. Core peptide products (Pcns) and their ([M + H]+) masses are shown (for sequences see Figure 4—figure supplement 2): Pcn1.7 (theor 2167.1; obs 2166.8). Pcn2.1 (theor 2750.2; obs 2749.9). Pcn2.4 (theor 1808.9; obs 1809.3. Pcn2.8 (cald 2050.8; obs 2051.0). Pcn1.3 (theor 2214.0; obs 2214.5).

https://doi.org/10.7554/eLife.42305.007
Figure 4—figure supplement 2
Expanding LahT150 substrate tolerance to non-cognate peptides.

(A) MALDI ToF MS analysis of the LahT150-catalyzed cleavage of MBP-tagged-AzoA2 and MBP-tagged-AzoA7. Both peptides have a C-terminal Asp-Ala-His6 added to the native core peptide sequence to improve their ionization; without these tags, the core peptides ionize poorly. Core peptide [M + H]+ masses: AzoA2 (theor 4718.5, obs 4717.7), AzoA7 (theor 4895.6, obs 4894.8). (B) Sequence alignment for LahA, ProcA, XY33a, and AzoA peptides show strong conservation in the C-terminal 12 amino acids of the leader peptide and very divergent core peptides with no detectable homology. LctA, HalA2 and SunA have low homology to all other peptides but are cleaved by LahT150.

https://doi.org/10.7554/eLife.42305.008
Figure 4—figure supplement 3
Determination of a minimum sequence for LahT150 catalysis.

(A) Sequence alignment of XY33a, ProcA2.8 (11–82), (21-82 , 31-82) and the XY33a-trypsin generated truncant. (B–E) MALDI ToF MS analysis of the products of N-terminally truncated ProcA2.8 treated with LahT150. LahT150 cleaves all three truncated mutants. ProcA2.8 core peptide mass [M + H-2H2O]+: (theor 2050.8; obs 2051.1). (F) XY33a was treated with trypsin to generate the XY33a truncant shown in panel (B), then the trypsin was inactivated by boiling before treatment with LahT150. LahT150 processed the trypsin-generated XY33a truncant. Core peptide masses: ([M + H]+): XY33a-trypsin truncant (theor 3485.6; obs 3485.7); XY33a-core peptide (theor 2101.0; obs 2100.9). (G) MALDI ToF MS analysis of the synthetic peptide in Figure 4—figure supplement 3A without LahT150 (top panel) and with LahT150 (bottom panel). Synthetic peptide [M + H]+ (theor 1617.8, obs 1617.8), Cleaved synthetic peptide N-terminal fragment [M + H]+ (theor 1275.6, obs 1275.5 Da).

https://doi.org/10.7554/eLife.42305.009
Figure 4—figure supplement 4
Assessment of the importance of individual amino acids in the leader peptide for LahT150 catalysis.

LahT150 catalyzed cleavage reactions of XY33a wild-type and leader peptide mutants. XY33a-core peptide mass [M + H]+ theor 2100.0; obs 2100.9–2101.1 in all spectra.

https://doi.org/10.7554/eLife.42305.010
Structure of the LahT147-peptide aldehyde complex.

(A) Overall structure of the complex showing the orientation of the peptide aldehyde (colored in green and labeled as Inh). (B) Simulated annealing difference Fourier map (calculated without the coordinates for Cys27 and the peptide aldehyde and shown at 2.3 σ) superimposed on the coordinates of the complex. (C) Close-up view of the active site showing residues implicated in catalysis. (D) Hydropathy analysis of LahT147 (based on the Kyte and Doolittle scale [Kyte and Doolittle, 1982]) superimposed in a color scheme onto a surface rendering of the final structure. Note that Val−4, Leu−7, and Leu−12 of the leader are positioned in suitable hydrophobic pockets. The figure was generated using the Chimera software package (Pettersen et al., 2004).

https://doi.org/10.7554/eLife.42305.011
Structure-based superposition of LahT147 and PCAT1.

(A) Close-up view of the LahT147-inhibitor complex structure superimposed on the crystal structure of full-length PCAT1. Note that the leader sequence directs the core peptide ‘cargo’ into the transmembrane domain (TMD) and is flanked by the nucleotide-binding domain (NBD). (B) Overall structure of the PCAT1 dimer with one monomer colored grey and the other monomer blue and pink showing the relative orientations of the protease domain and the inhibitor. Binding of the peptide cargo is poised to stabilize the interdomain interactions in the full-length transporter.

https://doi.org/10.7554/eLife.42305.012

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or referenceIdentifiersAdditional information
Gene
(XY33a_V-4K_gene)
XY33a_V-4K_geneIDT. Representative
of other purchased
XY33a mutant genes (see Table 5)
XY33a_V-4K_gene5 ng/μL stock solution
(1 μL) used as
amplification template
Strain,
strain background
(Escherichia coli
BL21 (DE3)-T1R)
E. coli BL21 (DE3)-T1RSigma Aldrich B2935BL21 (DE3)-T1R
Strain, strain
background
(Lachnospiraceae
C6A11)
Lachnospiraceae C6A11Dr. William Kelly
(AgResearch,
New Zealand)
Lachnospiraceae C6A11
Strain, strain
background
(Escherichia coli
Rosetta 2 (DE3))
E. coli Rosetta 2 (DE3)Novagen Catalog no. 71400–3E. coli Rosetta 2 (DE3)
Strain, strain
background
(Azospirillum sp.
B510 (JCM
14679))
Azospirillum sp.
B510 (JCM 14679)
JCM
Riken
http://www.jcm.riken.jp/cgi-bin/jcm/jcm_number?JCM=14679
Azospirillum sp. B510 (JCM 14679)
Transformed
construct
(pETDuet LahT150)
pETDuet-LahT150this workpETDuet LahT15050 ng/μL stock solution (1 μL) used in E. coli BL21 transformation
Transformed
construct
(pRSFDuet XY33a)
pRSFDuet-XY33aPMID: 22574919pRSFDuet XY33a50 ng/μL stock
solution (1 μL) used
in E. coli BL21 transformation
Transformed
construct
(pRSFDuet XY33a A-3Y)
pRSFDuet XY33a A-3Ythis work.
Representative
XY33a mutant
pRSFDuet XY33a A-3Y50 ng/μL stock solution (1 μL) used
in E. coli BL21 transformation
Transformed
construct
(pRSFDuet LahA1)
pRSFDuet-LahA1this workpRSFDuet LahA150 ng/μL stock
solution (1 μL) used
in E. coli BL21
transformation
Transformed
construct
(pRSFDuet LahA2)
pRSFDuet-LahA2this workpRSFDuet LahA250 ng/μL stock
solution (1 μL) used in E. coli BL21 transformation
Transformed
construct
(pRSFDuet LahA3)
pRSFDuet-LahA3this workpRSFDuet LahA350 ng/μL stock solution (1 μL) used in
E. coli BL21 transformation
Transformed
construct
(pRSFDuet LahA4)
pRSFDuet-LahA4this workpRSFDuet LahA450 ng/μL stock solution (1 μL) used
in E. coli BL21 transformation
Transformed
construct
(pRSFDuet LahA5)
pRSFDuet-LahA5this workpRSFDuet LahA550 ng/μL stock
solution (1 μL) used
in E. coli BL21
transformation
Transformed construct (pRSFDuet LahA6)pRSFDuet-LahA6this workpRSFDuet LahA650 ng/μL stock
solution (1 μL) used in E. coli BL21
transformation
Transformed construct (pRSFDuet LahA7)pRSFDuet-LahA7this workpRSFDuet LahA750 ng/μL stock solution (1 μL)
used in E. coli BL21
transformation
Transformed construct
(pET28-MBP-AzoA2)
pET28-MBP-AzoA2this workpET28-MBP-AzoA2150 ng/μL stock solution (1 μL) used
in E. coli Rosetta 2
(DE3) transformation
Transformed construct (pET28-MBP-AzoA3)pET28-MBP-AzoA3this workpET28-MBP-AzoA3150 ng/μL stock solution (1 μL) used
in E. coli Rosetta 2
(DE3) transformation
Transformed
construct (pET28-MBP-AzoA6)
pET28-MBP-AzoA6this workpET28-MBP-AzoA6150 ng/μL stock
solution (1 μL) used
in E. coli Rosetta 2
(DE3) transformation
Transformed construct (pET28-MBP-AzoA7)pET28-MBP-AzoA7this workpET28-MBP-AzoA7150 ng/μL stock
solution (1 μL) used
in E. coli Rosetta 2
(DE3) transformation
Transformed
construct
(pRSFDuet ProcA 2.8
(MCSI) - ProcM (MCSII))
pRSFDuet ProcA2.8
(MCSI) - ProcM (MCSII)
PMID: 22574919pRSFDuet ProcA
2.8 (MCSI) - ProcM (MCSII)
50 ng/μL stock
solution (1 μL)
used in E. coli BL21
transformation
Transformed
construct
(pRSFDuet ProcA 1.7
(MCSI) - ProcM (MCSII))
pRSFDuet ProcA1.7
(MCSI) - ProcM (MCSII
PMID: 22574919pRSFDuet ProcA 1.7
(MCSI) - ProcM (MCSII
50 ng/μL stock
solution (1 μL) used
in E. coli BL21
transformation
Transformed
construct
(pRSFDuet ProcA 2.1
(MCSI) - ProcM (MCSII))
pRSFDuet ProcA2.1
(MCSI) - ProcM (MCSII
this workpRSFDuet ProcA 2.1
(MCSI) - ProcM (MCSII
50 ng/ μL stock
solution (1 μL) used
in E. coli BL21
transformation
Transformed
construct
(pRSFDuet
ProcA 2.4 (MCSI) -
ProcM (MCSII))
pRSFDuet ProcA2.4
(MCSI) - ProcM (MCSII)
this workpRSFDuet ProcA 2.4
(MCSI) - ProcM (MCSII)
50 ng/ μL stock
solution (1 μL) used
in E. coli BL21
transformation
Transformed
construct (pRSFDuet
ProcA 1.3 (MCSI) - ProcM (MCSII))
pRSFDuet ProcA1.3
(MCSI) - ProcM (MCSII)
this workpRSFDuet ProcA 1.3
(MCSI) - ProcM (MCSII)
50 ng/ μL stock
solution (1 μL) used
in E. coli BL21
transformation
Sequence-
based reagent
Benzonase
Endonuclease
EMD Millipore
Catalog no. 1.01656.001
Benzonase
Sequence-
based reagent
EcoRI-HFNew England
Biolabs R3101S
EcoRI
Sequence-
based reagent
BamHI-HFNew England
Biolabs R3136S
BamHI
Sequence-
based reagent
NotI-HFNew England
Biolabs R3189S
Not1
Sequence-
based reagent
HindIII-HFNew England
Biolabs R3104S
HindIII
Recombinant
protein
XY33aPMID: 29507389XY33arecombinant
substrate peptide
tested with LahT150
Recombinant
protein
XY33a A-3Ythis work;
representative
XY33a mutant
XY33a A-3Yrecombinant
substrate peptide
mutant tested
with LahT150
Recombinant
protein
LahA1this workLahA1recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
LahA2this workLahA2recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
LahA3this workLahA3recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
LahA4this workLahA4recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
LahA5this workLahA5recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
LahA6this workLahA6recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
LahA7this workLahA7recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
AzoA2this workMBP-AzoA2recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
AzoA3this workMBP-AzoA3recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
AzoA6this workMBP-AzoA6recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
AzoA7this workMBP-AzoA7recombinant
substrate peptide
tested
with LahT150
Recombinant
protein
LahT150this workLahT150protease domain
of LahT
Recombinant
protein
Pcn 2.8PMID: 22574919Pcn 2.8recombinant
posttranslationally
modified ProcA2.8 substrate
peptide tested with
LahT150
Recombinant
protein
Pcn 1.7PMID: 22574919Pcn 1.7recombinant
posttranslationally
modified ProcA1.7 substrate
peptide tested
with LahT150
Recombinant
protein
Pcn 2.1this workPcn 2.1recombinant
posttranslationally
modified ProcA2.1 substrate
peptide tested with
LahT150
Recombinant
protein
Pcn 2.4this workPcn 2.4recombinant
posttranslationally
modified ProcA2.4 substrate
peptide tested with
LahT150
Recombinant proteinPcn 1.3this workPcn 1.3recombinant
posttranslationally
modified ProcA1.3 substrate
peptide tested with
LahT150
Minimum peptide substrateSynthetic peptideGenscriptSynthetic peptidesynthetic
minimal substrate
peptide tested
with LahT150
Commercial
kit
QIAprep Spin
Miniprep kit
Qiagen
catalog no. 27106
QIAprep Spin
Miniprep kit
Commercial
kit
QIAquick Gel
Extraction kit
Qiagen
catalog no. 28115
QIAquick Gel
Extraction kit
Commercial
kit
Gibson AssemblyNew England
Biolabs E2611S
Gibson Assembly
Chemical
compound
TCEP (Tris
(2-Carboxyethyl)
phosphine hydrochloride)
Goldbio
Catalog ID TCEP
TCEP
Chemical
compound
Terrific Broth
granulated
Fisher
Scientific BP97285
TB
Chemical
compound
GlycerolFisher
Scientific BP-229–4
Glycerol
Chemical
compound
DextroseFisher Scientific
BP350500
Glucose or dextrose
Chemical
compound
kanamycin
monosulfate,
USP grade
Goldbio Catalog
ID K-120
kanamycin
Software,
algorithm
Adobe Illustrator CS6AdobeAdobe Illustrator
Software,
algorithm
FlexAnalysis 3.4
(Bruker Daltonik
GmbH)
Bruker Daltonik
GmbH
FlexAnalysis 3.4
(Bruker Daltonik GmbH)
Mass spectrometry
data processing
OtherClontech His60 Ni
Superflow resin
Clontech Catalog
no. 636660
Clontech His60
Ni Superflow resin
Used for gravity
purification of
all recombinant
proteins except LahT150
OtherGE Healthcare
HisTrap HP
GE Healthcare 175247015 mL HiTrap Ni
Chelating column
Used for FPLC
purification of
recombinant LahT150
Table 1
Calculated and observed MALDI ToF [M + H]+ masses for the leader peptides in Figure 4—figure supplement 4. n.d., not detected.
https://doi.org/10.7554/eLife.42305.013
[M + H]+WTV-4KV-4TV-4DE-6AE-6KE-6D
Calcd8169.88227.08199.88229.88139.88168.98183.8
Obsd8169.38229.98201.4n.d.8137.88170.08183.1
L-7AL-7KL-7DE-8AE-8KE-8D
Calcd8127.78212.98199.88111.88168.98155.8
Obsd8126.2n.d.n.d.8111.08167.78157.5
D-9AD-10AD-9E,D-10EA-3YA-3FA-3KA-3E
Calcd8125.88125.88197.98261.98245.98226.98227.9
Obsd8125.48127.08196.78261.18246.58225.88226.8
L-12AL-12KL-12DL-12FL-12WL-12Y
Calcd8127.78184.88171.78203.88242.88184.8
Obsd8126.0n.d.n.d.n.d.8241.0n.d
Table 2
Data collection, phasing and refinement statistics.
https://doi.org/10.7554/eLife.42305.014
LahT-inhibitor 1 complexPCMBS
Data collection
Space groupC2C2
Unit cell (a,b,c,β)37.9, 119.4, 76.5, 93.837.3, 119.8, 83.5, 112.8
Resolution76.4–1.98 (1.985–1.98)59.9–2.04 (2.05–2.04)
Total reflections239,058124,854
Unique reflections47,18721,494
Rsym (%)*0.102 (0.727)0.090 (0.690)
I/σ(I)*9.3 (2.1)12.9 (2.5)
Completeness (%)*99.8 (99.8)99.9 (100)
Redundancy5.1 (5.1)5.9 (6.0)
Refinement
Resolution (Å)50.0–2.0
No. reflections43,389
Rwork / Rfree23.4/26.8
Number of atoms
Protein4479
Inh352
Water123
B-factors
Protein37.6
Inh34.5
Water35.9
R.m.s deviations
Bond lengths (Å)0.015
Bond angles (°)1.81
  1. *Highest resolution shell is shown in parenthesis.

    R-factor = Σ(|Fobs|-k|Fcalc|)/Σ |Fobs|and R-free is the R value for a test set of reflections consisting of a random 5% of the diffraction data not used in refinement.

Table 3
Primers used in the generation of LahA constructs.

Homology with vector backbone is displayed as lowercase letters.

https://doi.org/10.7554/eLife.42305.015
Primer NameSequence 5’−3’
LahA1_fpaccatcatcaccacagccaggatccgaattcgaACGAGAATTTAGAGAAGTTTTTTCAGA
LahA1_rpttctgttcgacttaagcattatgcggccgcAGATTGCTCCTGCAGCGAAATTGGTAAG
LahA2_fpaccatcatcaccacagccaggatccgaattcgaACGAGAATTTAAAGATGTTTTTGCAGA
LahA2_rpttctgttcgacttaagcattatgcggccgcTTAGATTGCTGTTGCAGCGAAAAGGGAAT
LahA3_fpaccatcatcaccacagccaggatccgaattcgaATGATAGTTTAAAAGAGTTTTTGAA
LahA3_rpttctgttcgacttaagcattatgcggccgcTTAGACGGCTCCGGCTGACGATGCCGCAA
LahA4_fpaccatcatcaccacagccaggatccgaattcgaACGAGAATTTAAAGATGTTTTTACAGA
LahA4_rpttctgttcgacttaagcattatgcggccgcTTAAACCGCAAGTAAACTCATCGTTACAGC
LahA5_fpaccatcatcaccacagccaggatccgaattcgaACGAGAATCTCAAGCTATTTTTACAA
LahA5_rpttctgttcgacttaagcattatgcggccgcTTACATTGCCGATAATGATAATGATAATGC
LahA6_fpaccatcatcaccacagccaggatccgaattcgaATGAAAGGATAAAAGATTTATTTACCG
LahA6_rpttctgttcgacttaagcattatgcggccgcTTACATAAGTGCCTTTCTTATTGCAGTAAG
LahA7_rpaccatcatcaccacagccaggatccgaattcgaACGAGAACTTGAAGAAATTCCTGGAGG
LahA7_fpttctgttcgacttaagcattatgcggccgcTTATGAAGCAATCCTTGACCAACTATTGA
Table 4
Primers used in the cloning of AzoA constructs.

Homology with vector backbone is displayed as lowercase letters.

https://doi.org/10.7554/eLife.42305.016
Primer nameSequence 5'−3'
AzoA2 fwdaaaGGATCCatgacaaccgaaacgcaaacc
AzoA2 revaaaGCGGCCGCctaccattttctgggaatggccaag
AzoA3 fwdcaatggacggtGGATCCGatgacagaccaaacccagtccacatcc
AzoA3 revcggaaacagccAAGCttactgttgtcgcaaacgcggtggtga
AzoA6 fwdaaaggacttcgGGATCCgatgacaaatgaaacgcagcccacc
AzoA6 revttatgggatcCAAGCTTctaccatttcctcgttccgagaatggc
AzoA7 fwdcaatggacccaGGATCCgatgacagaccaaacgcagtccgcc
AzoA7 revcatggacatcCAAGCTTctaccattttgcacacacccccctgat
MBP-AzoA G1aataaggagatataccatgGGCAGCAGCCATCATCATCATC
MBP-AzoA G2TGGCTGCTGCCcatggtatatctccttattaaagttaaacaaaattatttctacagggg
MBP-AzoA2 G3CTGTACTTCCAATCCatgacaaccgaaacgcaaaccgcc
MBP-AzoA2 G4cgtttcggttgtcatGGATTGGAAGTACAGGTTCTCAGATCCACGC
MBP-AzoA3 G3CTGTACTTCCAATCCatgacagaccaaacccagtccac
MBP-AzoA3 G4ggtttggtctgtcatGGATTGGAAGTACAGGTTCTCAGATCCACGC
MBP-AzoA6 G3CTGTACTTCCAATCCatgacaaatgaaacgcagccc
MBP-AzoA6 G4cgtttcatttgtcatGGATTGGAAGTACAGGTTCTCAGATCCACGC
MBP-AzoA7 G3CTGTACTTCCAATCCatgacagaccaaacgcagtccgcc
MBP-AzoA7 G4gcgtttggtctgtcatGGATTGGAAGTACAGGTTCTCAGATCCACGC
AzoA2CHis G1tctaGTGATGGTGATGGTGATGTGCATCccattttctgggaatggccaagc
AzoA2CHis G2GATGCACATCACCATCACCATCACtagaagcttgcggccgcataatgcttaagtcg
AzoA3CHis G1tctaGTGATGGTGATGGTGATGTGCATCctgttgtcgcaaacgcggtggtg
AzoA3CHis G2GATGCACATCACCATCACCATCACtagaagcttgcggccgcataatgcttaagtcg
AzoA7CHis G1tctaGTGATGGTGATGGTGATGTGCATCccattttgcacacacccccctgattccacc
AzoA7CHis G2GATGCACATCACCATCACCATCACtagaagcttgcggccgcataatgcttaagtcg
Table 5
Primers and synthetic genes used in the cloning of XY33a constructs.

Mutations are shown in bold font. Homology with vector backbone is displayed as lowercase letters.

https://doi.org/10.7554/eLife.42305.017
Primer or synthetic gene nameSequence (5’−3’)
XY33A_fpcatcaccatcatcaccacagccaggatccGTCTGAAGAGCAACTGAAGGC
XY33A_rpgtacaatacgattactttctgttcgacttaagcattatTTAGCAAATATCGAGGACGTG
RSF_fpGcaggcgtttttccatagg
RSF_rpCtggcttgagcgtcgatttttg
XY33a_D-9A_fpCGCCAAAATCTGTCTGAA GCA AGCTGGAAGGTGTGGC
XY33a_D-9A_rpGCCACACCTTCCAGCT TGC TTCAGACAGATTTTGGCG
XY33a_D-10A_fpCGCCAAAATCTGTCT GCA GAAAGCTGGAAGGTGTGGC
XY33a_D-10A_rpGCCACACCTTCCAGCTTTC TGC AGACAGATTTTGGCG
XY33a_D-10E,D-9E_fpCGCCAAAATCTGTCT GAA GAA AGCTGGAAGGTGTGGCTG
XY33a_D-10E,D-9E_rpCAGCCACACCTTCCAGCT TTC TTC AGACAGATTTTGGCG
XY33a_E-8A_fpCAAAATCTGTCTGATGAT GCA CTGGAAGGTGTGGCTGGG
XY33a_E-8A_rpCCCAGCCACACCTTCCAG TGC ATCATCAGACAGATTTTG
XY33a_E-8K_fpCAAAATCTGTCTGATGAT AAA CTGGAAGGTGTGGCTGGG
XY33a_E-8K_rpCCCAGCCACACCTTCCAG TTT ATCATCAGACAGATTTTG
XY33a_E-8D_fpCAAAATCTGTCTGATGAT GAT CTGGAAGGTGTGGCTGGG
XY33a_E-8D_rpCCCAGCCACACCTTCCAG ATC ATCATCAGACAGATTTTG
XY33a_L-7A_fpCTGTCTGATGATGAG GCA GAAGGTGTGGCTGGGG
XY33a_L-7A_rpCCCCAGCCACACCTTC TGC CTCATCATCAGACAG
XY33a_L-7K_fpCTGTCTGATGATGAG AAA GAAGGTGTGGCTGGGG
XY33a_L-7K_rpCCCCAGCCACACCTTC TTT CTCATCATCAGACAG
XY33a_L-7D_fpCTGTCTGATGATGAG GAT GAAGGTGTGGCTGGGG
XY33a_L-7D_rpCCCCAGCCACACCTTC ATC CTCATCATCAGACAG
XY33a_E-6A_fpGTCTGATGATGAGCTG GCA GGTGTGGCTGGGGGAG
XY33a_E-6A_rpCTCCCCCAGCCACACC TGC CAGCTCATCATCAGAC
XY33a_E-6K_fpGTCTGATGATGAGCTG AAA GGTGTGGCTGGGGGAG
XY33a_E-6K_rpCTCCCCCAGCCACACC TTT CAGCTCATCATCAGAC
XY33a_E-6D_fpGTCTGATGATGAGCTG GAT GGTGTGGCTGGGGGAG
XY33a_E-6D_rpCTCCCCCAGCCACACC ATC CAGCTCATCATCAGAC
XY33a_V-4K_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGTAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATCTGTCTGATGATGAGCTGGAAGGTAAAGCTGGGGGAGCGG
CCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_V-4T_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGTAGGCTTCTCGATTACCACAGAAGACCTAAACTC
TCATCGCCAAAATCTGTCTGATGATGAGCTGGAAGGTACCGCTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_V-4D_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAA
CAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGTAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATCTGTCTGATGATGAGCTGGAAGGTGATGCTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_A-3Y_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCAT
CGCCAAAATCTGTCTGATGATGAGCTGGAAGGTGTGTATGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACG
TCCTCGATATTTGCTAA
XY33a_A-3F_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATCTGTCTGATGATGAGCTGGAAGGTGTGTTTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_A-3E_geneTCTGAAGAGCAACTGAAGGCATTCCTCA
CCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATG
TTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTC
TCATCGCCAAAATCTGTCTGATGATGAGC
TGGAAGGTGTGGAAGGGGGAGCGGCCT
GTCATTTCCTTCTTTTCTCTATGCCTCC
ATCCCACGTCCTCGATATTTGCTAA
XY33a_A-3K_geneTCTGAAGAGCAACTGAAGGCATTCCTCA
CCAAAGTTCAAGCCGATACTTCACTACAG
GAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCT
CATCGCCAAAATCTGTCTGATGATGAGCTGGAAGGTGTGAAAGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCC
TCCATCCCACGTCCTCGATATTTGCTAA
XY33a_L-12A_geneTCTGAAGAGCAACTGAAGGCATTCCTC
ACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGC
TGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGAC
CTAAACTCTCATCGCCAAAATGCGTC
TGATGATGAGCTGGAAGGTGTGGCTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_L-12K_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATAAATCTGATGATGAGCTGGAAGGTGTGGCTGGGGGAGCGGCCTGTCATTTCC
TTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_L-12D_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATGATTCTGATGATGAGCTGGAAGGTGTGGCTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_L-12F_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATTTTTCTGATGATGAGCTGGAAGGTGTGGCTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_L-12W_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATGTTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATTGGTCTGATGATGAGCTGGAAGGTGTGGCTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA
XY33a_L-12Y_geneTCTGAAGAGCAACTGAAGGCATTCCTCACCAAAGTTCAAGCCGATACTTCACTACAGGAACAGTTAAAGATAGAAGGAGCTGATG
TTGTAGCCATTGCCAAAGCTGCAGGCTTCTCGATTACCACAGAAGACCTAAACTCTCATCGCCAAAATTATTCTGATGATGAGCTG
GAAGGTGTGGCTGGGGGAGCGGCCTGTCATTTCCTTCTTTTCTCTATGCCTCCATCCCACGTCCTCGATATTTGCTAA

Data availability

Diffraction data has been deposited at Protein Data Bank under 6MPZ.

The following data sets were generated
    1. Dong SH
    2. Nair SK
    (2019) Protein Data Bank
    ID 6MPZ. Crystal structure of a double glycine motif protease from AMS/PCAT transporter in complex with the leader peptide.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)