(A and B) Representative images (A) and line plots (B) of nocodazole-arrested Flp-in HeLa cells expressing YFP-B56 (B56α, B56β, B56γ1, B56γ3, B56δ and B56ε). For line plots, five kinetochore pairs …
Alignment of the BubR1 binding pocket (A) and the Sgo1-binding region (B) in B56 isoforms.
Immunoblot of whole cell lysates from nocodazole-arrested HeLa Flp-in cells treated with the indicated siRNA and probed for B56α, B56γ, B56δ, B56ε or tubulin (note B56β was undetectable). Asterix …
(A) Schematic representation of the strategy used for CRISPR/Cas9 YFP-tagging of B56 isoforms α and γ at the N-terminus. (B) Immunoblot of whole cell lysates from nocodazole-arrested HeLa cells with …
(A-D) Flp-in HeLa cells treated with siRNA against B56 pool and induced to re-express YFP-B56α or YFP-B56γ were analysed for SAC silencing and chromosomal alignment. Representative images (A) and …
(A) Immunoblot of whole cell lysates from nocodazole-arrested Flp-in HeLa cells treated with the indicated siRNA expressing endogenous YFP-B56α (enB56α) or exogenous YFP-B56α (ex B56α). Blot was …
(A-G) The effect of Sgo1 and/or Sgo2 knockdown on YFP-B56α localisation in Flp-in HeLa cells. Representative images (A, C, F) and quantifications (B, D, G) of relative kinetochore intensity of B56α …
(A-D) Flp-in HeLa cells expressing YFP-B56α or YFP-B56γ were transfected with CB-Sgo1 and analysed for B56 recruitment. Representative images (A and C) and quantifications (B and D) of relative …
B56γ kinetochore localisation in Flp-in HeLa cells after BubR1 knockdown (A, B, E) or mutation of the LxxIxE binding pocket (H187A: C), (D, F) in cells arrested in prometaphase with nocodazole. For …
(A-H) Flp-in HeLa cells expressing YFP-B56γ were treated with the indicated siRNA. Representative images (A, C, E and G) and quantifications of relative centromere/kinetochore intensity (B, D, F and …
Flp-in HeLa cells expressing YFP-B56γ or YFP-B56γΔSgo1 were untransfected or transfected with CB-Sgo1. Representative images (A, C) and quantification (B, D) of relative kinetochore intensity of the …
(A) Immunoblot of the indicated proteins, containing a LxxIxE motif (Hertz et al., 2016), following YFP immunoprecipitation from nocodazole-arrested Flp-in HeLa cells expressing YFP-B56α or …
B56 localisation in B56α-γ chimaeras spanning the entire B56 (Ch1-4: A–C), a region at the C-terminus (Ch4a-4d: D–F). (A, D) Schematic representation of the B56α-γ chimaeras created. Representative …
Schematic representation of the B56α-γ chimeras alongside representative images and line plot analysis of these chimeras in cells arrested in prometaphase with nocodazole. Each graph represents the …
(A) Immunoblot of the PP2A subunits following YFP immunoprecipitation from nocodazole-arrested Flp-in HeLa cells expressing YFP-B56α WT or YFP-B56α TKHG. (B) Flp-in HeLa cells treated with siRNA …
(A-D) Flp-in HeLa cells expressing either YFP-B56α WT or TKHG were transfected with the CB-Sgo2 and analysed for B56 recruitment (A, B) or gChr7 +dCas9 DARPIN to assess YFP-B56α:Sgo2 co-localisation …
(A) Schematic, representative images and line plot analysis of B56γ and B56γ EPVA localisation in nocodazole-arrested Flp-in HeLa cells. (B) Schematic, representative images and line plot analysis …
Immunoblot of LxxIxE containing proteins (GEF-H1, BubR1 and RepoMan) following YFP immunoprecipitation from nocodazole-arrested Flp-in HeLa cells expressing YFP-B56α or YFP-B56γ and subjected to …
Reagent type or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Cell line (H.sapiens) | HeLa Flp-in | Tighe et al. (2008) | ||
Recombinant DNA reagent | pcDNA5-YFP-B56 α, β, γ1, γ3, δ and ε. | This paper | B56 from pCEP-4xHA-B56 (Addgene 14532–14537) cloned into pcDNA5-LAP-BubR1WT (Nijenhuis et al., 2014), Not1-Apa1 sites. | |
Recombinant DNA reagent | pcDNA5-YFP-B56α−(TKHG) | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56α: E405T, P409K, V412H, A413G | |
Recombinant DNA reagent | pcDNA5-YFP-B56α-(γ4) | This paper | See Figure 5—figure supplement 1 | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ-H187A | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ-ΔSgo1 | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ: Y391F, L394S, M398Q. | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ-H187A-ΔSgo1 | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ-H187A: Y391F, L394S, M398Q. | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ-(α4) | This paper | See Figure 5—figure supplement 1 | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ-(α4.1) | This paper | See Figure 6—figure supplement 1 | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ-(α4.2) | This paper | See Figure 6—figure supplement 1 | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ-(α4.3) | This paper | See Figure 6—figure supplement 1 | |
Recombinant DNA reagent | pcDNA5-YFP-B56γ−(EPVA) | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ: T631E, K635P, H638V, G639A. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch1 | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch2 | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch3 | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch4 | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch4a | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch4b | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch4c | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-YFP-B56-Ch4d | This paper | See Figure 5. | |
Recombinant DNA reagent | pcDNA5-vsv-CENP- B-Sgo2-mCherry | This paper | PCR Sgo2 from pDONR-Sgo2 (gift T.J.Yen) into pcDNA5-vsv- CENP-B-Sgo1-mCherry | |
Recombinant DNA reagent | pcDNA5-vsv-CENP-B- Sgo1-mCherry | Meppelink et al. (2015) | ||
Recombinant DNA reagent | pHAGE-TO-dCas9- DARPIN-flag | This paper | Progenitor plasmid: pHAGE-TO- dCas9-3xmCherry (Addgene 64108). 3xmCherry replaced with synthesised DARPIN-Flag (Brauchle et al., 2014). | |
Sequence-based reagent | gRNA targeting a repetetive region on chromosome 7 | Chen et al. (2016) | GCTCTTATGGTGAGAGTGT | |
Sequence-based reagent | B56 Knockin gRNAs | This paper | B56a: gatgtcgtcgtcgtcgccgccgg. B56g: gtcaacatctagacttcagcggg | |
Sequence-based reagent | siRNAs | Foley et al. (2011) | B56α (PPP2R5A), 5’-UGAAUGAACUGGUUGAGUA-3’; B56β (PPP2R5B), 5’-GAACAAUGAGUAUAUCCUA-3’; B56γ (PPP2R5C), 5’-GGAAGAUGAACCAACGUUA-3’; B56δ (PPP2R5D), 5’-UGACUGAGCCGGUAAUUGU-3’; B56ε (PPP2R5E), 5’-GCACAGCUGGCAUAUUGUA-3’; | |
Sequence-based reagent | siRNAs | Kitajima et al. (2006) | Sgo2, 5’-GCACUACCACUUUGAAUAA-3’; | |
Sequence-based reagent | siRNAs | Dharmacon, J-015475–12 | Sgo1, 5’-GAUGACAGCUCCAGAAAUU-3’; | |
Sequence-based reagent | siRNAs | Nijenhuis et al. (2014) | BubR1, 5’-AGAUCCUGGCUAACUGUUC-3’ | |
Sequence-based reagent | siRNAs | Vleugel et al. (2013) | Knl1, 5’-GCAUGUAUCUCUUAAGGAA-3’; Bub1 5’-GAAUGUAAGCGUUCACGAA-3’; | |
Sequence-based reagent | siRNAs | Dharmacon (D-001830) | Control (GAPDH), 5’-GUCAACGGAUUUGGUCGUA-3’ | |
Antibody | Mouse monoclonal anti-GFP (clone 4E12/8) | Peter Parker, Francis Crick Institute | 1:1000 | |
Antibody | Chicken polyclonal anti-GFP | Abcam | Abcam: ab13970, RRID:AB_300798 | 1:5000 |
Antibody | Mouse monoclonal anti-Sgo1 (clone 3C11) | Abnova | Abnova: H001516480M01 | 1:1000 |
Antibody | Rabbit polyclonal anti-Sgo2 | Bethyl | Bethyl: A301-262A, RRID:AB_890650 | 1:1000 |
Antibody | Mouse monoclonal anti-BubR1 (clone 8G1) | EMD Millipore | EMD Millipore: 05–898, RRID:AB_417374 | 1:1000 |
Antibody | Mouse monoclonal anti-VSV (clone P5D4) | Sigma | Sigma: V5507, RRID:AB_261877 | 1:1000 |
Antibody | Rabbit polyclonal anti-Knl1 | Abcam | Abcam: ab70537, RRID:AB_1209410 | 1:1000 |
Antibody | Rabbit polyclonal anti-Bub1 | Bethyl | Bethy;l: A300-373A, RRID:AB_2065943 | 1:1000 |
Antibody | Mouse monoclonal anti-FLAG (clone M2) | Sigma | Sigma: F3165, RRID:AB_259529 | 1:10000 |
Antibody | Guinea Pig polyclonal anti-Cenp-C | MBL | MBL: PD030 | 1:5000 |
Antibody | Rabbit polyclonal anti-pMELT-Knl1 (phospho-T943 and - T1155) | Nijenhuis et al. (2014) | 1:1000 | |
Antibody | Rabbit polyclonal anti-GFP | Geert Kops, Hubrecht Institute | 1:5000 | |
Antibody | Mouse monoclonal anti-B56γ (clone A-11) | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-374379, RRID:AB_10988028 | 1:1000 |
Antibody | Mouse monoclonal anti-B56α (clone 23) | BD Biosciences | BD Biosciences: 610615, RRID:AB_397947 | 1:1000 |
Antibody | Mouse monoclonal anti-B56δ (clone H-11) | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-271363, RRID:AB_10611062 | 1:1000 |
Antibody | Rabbit polyclonal anti-B56ε | Aviva | Aviva: ARP56694-P50 | 1:1000 |
Antibody | Mouse monoclonal anti-PPP2CA (clone 1D6) | EMD Millipore | EMD Millipore: 05–421, RRID:AB_309726 | 1:5000 |
Antibody | Rabbit polyclonal anti-PPP2R1A (clone 81G5) | Cell Signaling Technology | Cell Signaling Technology: 2041, RRID:AB_2168121 | 1:1000 |
Antibody | Rabbit polyclonal anti-BubR1 | Bethyl | Bethyl: A300-386A, RRID:AB_386097 | 1:1000 |
Antibody | Rabbit polyclonal anti-Axin | Cell Signaling Technology | Cell Signaling Technology: C76H11, RRID:AB_2274550 | 1:1000 |
Antibody | Rabbit polyclonal anti-GEF-H1 | Abcam | Abcam: ab155785 | 1:1000 |
Antibody | Rabbit polyclonal anti-Kif4A | Bethyl | Bethyl: A301-074A, RRID:AB_2280904 | 1:1000 |
Antibody | Rabbit polyclonal anti-Repoman | Sigma | Sigma: HPA030049, RRID:AB_10600862 | 1:1000 |
Antibody | Rabbit polyclonal anti-Actin | Sigma | Sigma: A2066, RRID:AB_476693 | 1:5000 |
Antibody | Mouse monoclonal anti-α-Tubulin (clone B-5-1-2) | Sigma | Sigma: T5168, RRID:AB_477579 | 1:5000 |
Antibody | Alexa-fluor488 anti-mouse | ThermoFisher Scientific | Invitrogen: A11029, RRID:AB_138404 | 1:1000 |
Antibody | Alexa-fluor488 anti-rabbit | ThermoFisher Scientific | Invitrogen: A11034, RRID:AB_2576217 | 1:1000 |
Antibody | Alexa-fluor488 anti-chicken | ThermoFisher Scientific | Invitrogen: A11039, RRID:AB_142924 | 1:1000 |
Antibody | Alexa-fluor488 anti-guinea pig | ThermoFisher Scientific | Invitrogen: A11073, RRID:AB_142018 | 1:1000 |
Antibody | Alexa-fluor568 anti-mouse | ThermoFisher Scientific | Invitrogen: A11031, RRID:AB_144696 | 1:1000 |
Antibody | Alexa-fluor568 anti-rabbit | ThermoFisher Scientific | Invitrogen: A11036, RRID:AB_10563566 | 1:1000 |
Antibody | Alexa-fluor647 anti-guinea pig | ThermoFisher Scientific | Invitrogen: A21450, RRID:AB_141882 | 1:1000 |
Antibody | HRP-anti-mouse | Bio-Rad | Bio-Rad: 170–6516, RRID:AB_11125547 | 1:2000 |
Antibody | HRP-anti-rabbit | Bio-Rad | Bio-Rad: 170–6515, RRID:AB_11125142 | 1:5000 |
Chemical compound, drug | AZ-3146 | Selleckchem | Selleckchem: S2731 | |
Chemical compound, drug | Calyculin A | LC labs | LC labs: C-3987 | |
Chemical compound, drug | 4,6-diamidino-2- phenylindole (DAPI) | Sigma | Roche: 10236276001 | |
Chemical compound, drug | Dulbecco's Modified Eagle Medium (DMEM) | ThermoFisher Scientific | Gibco: 41966029 | |
Chemical compound, drug | Doxycycline hyclate | Sigma | Sigma: D9891 | |
Chemical compound, drug | Fetal Bovine Serum | ThermoFisher Scientific | Life Technologies: 10270106 | |
Chemical compound, drug | GFP-Trap magnetic beads | Chromotek | Chromotek: GTMA-20 | |
Chemical compound, drug | Hygromycin B | Santa Cruz Biotechnology | Santa Cruz Biotechnology: sc-29067 | |
Chemical compound, drug | Lipofectamine RNAiMax | ThermoFisher Scientific | Invitrogen: 13778150 | |
Chemical compound, drug | Nocodazole | EMD Millipore | EMD Millipore: 487928 | |
Chemical compound, drug | MG132 | Selleckcem | Selleckchem: S2619 | |
Chemical compound, drug | Opti-MEM reduced serum medium | ThermoFisher Scientific | Gibco: 31985–047 | |
Chemical compound, drug | penicillin/streptomycin | ThermoFisher Scientific | Gibco: 15070–063 | |
Chemical compound, drug | RO-3306 | Tocris | Tocris: 4181 | |
Chemical compound, drug | Thymidine | Sigma | Sigma: T1895 | |
Software, algorithm | Kinetochore quantification macro | Saurin et al. (2011) | Software, | |
Algorithm | Multicolor Line plot quantification macro | Kees Straatman (University of Leicester) with modification by Balaji Ramalingam (University of Dundee) | ||
Software, algorithm | Quantification of immunoblots | Image Studio Lite (LI-COR Biosciences) | ||
Software, algorithm | Microscopy image processing | Softworx software, GE Healthcare | ||
Software, algorithm | Microscopy image processing | ImageJ, National Institutes of Health |
The raw data and statistical values from all the individual experiments that are expressed in graphical format.
This files contains the raw data and statistical values from all the graphs displayed in Figures 1–6; Figure 1—figure supplements 2, 4 and 5; Figure 2—figure supplement 1; Figure 3—figure supplement 2; Figure 5—figure supplements 1 and 2; Figure 6—figure supplement 1.