1. Developmental Biology
Download icon

Arid3a regulates nephric tubule regeneration via evolutionarily conserved regeneration signal-response enhancers

  1. Nanoka Suzuki
  2. Kodai Hirano
  3. Hajime Ogino
  4. Haruki Ochi  Is a corresponding author
  1. Yamagata University, Faculty of Medicine, Japan
  2. Hiroshima University, Japan
Research Article
Cite this article as: eLife 2019;8:e43186 doi: 10.7554/eLife.43186
8 figures, 2 tables and 2 additional files

Figures

Figure 1 with 1 supplement
Live imaging of nephric tubules using transgenic X. laevis.

(A) A schematic image of X. laevis nephron. PT: proximal tubule; IT: intermediate tubule; DT: distal tubule; CT: connecting tubule. Magenta arrows: PT; green arrows: IT; orange arrows: DT. (B) Representative regeneration pattern of partially resected proximal tubules. Proximal tubules regenerate a coiled structure. (C) Regeneration pattern of completely resected proximal tubules. The remaining intermediate tubules extend, but no coiled structure is regenerated. (D) Regeneration pattern of completely resected intermediate tubules. No extension of tubules is observed. (E) Statistics of the regeneration pattern. The statistics of three independent experiments are summarized.

https://doi.org/10.7554/eLife.43186.002
Figure 1—figure supplement 1
Podocytes are not injured by the surgical removal of nephron tubules.

In situ hybridization of podocin, a podocyte marker, was performed using nephrectomized X. laevis. The image shows a cross section of X. laevis at 48 hr after nephrectomy. The arrow indicates the nephric tubules on the control side.

https://doi.org/10.7554/eLife.43186.003
Figure 2 with 1 supplement
lhx1 expression appears immediately after nephrectomy.

(A–F) Expression of lhx1 on the control side and nephrectomized side at 24, 48, and 96 hr after nephrectomy. N indicates the number of examined embryos. (D) lhx1 expression appears in regenerating nephric tubules within 24 hr (arrows). (E, F) This expression becomes stronger around 48 hr but disappears at 96 hr. (G–L) Expression of pax8. pax8 expression appears in regenerating nephric tubules and is still detected at 96 hr after nephrectomy. (M–R) Expression of pax2 is not observed at 24 hr after nephrectomy (P, arrow). (S) Quantification of expression signals for lhx1, pax8, and pax2. The significance of differences between the control side and the nephrectomized side at 48 hr is calculated by two-tailed paired t-test (lhx1: p=0.0414; pax8: p=0.0102; pax2: p=0.0453). Lines in boxes indicate the median.

https://doi.org/10.7554/eLife.43186.004
Figure 2—figure supplement 1
Expression of hnf1b, hnf4a, osr1, and osr2 in regenerating nephric tubules.

Expression of nephric genes at 24 hr and 48 hr after nephrectomy (24 hr: A, C, E, G, I, K, M, and O; 48 hr: B, D, F, H, J, L, N, and P). Control side (A, B, E, F, I, J, M, and N). Nephrectomized side (C, D, G, H, K, L, O, and P). The magenta arrows indicate the expression in regenerating nephric tubules. The green arrows indicate no expression in the regenerating tubules. N indicates the number of examined embryos.

https://doi.org/10.7554/eLife.43186.005
Figure 3 with 1 supplement
The RSRE for lhx1 is conserved between human and fish.

(A) A diagram of vertebrate lhx1 loci showing the position of CNSs. The magenta boxes indicate CNSs conserved between frog and fish, and the blue boxes indicate CNSs conserved between human and fish. The black boxes indicate the exons. (B) A diagram of the experimental design for mapping RSREs. GFP reporter constructs carrying lhx1-CNSs with the β-actin proximal promoter were subjected to transgenesis. All reporter-injected embryos underwent nephrectomy on the left side at stage 37. Nephrectomized embryos were incubated at 18°C for 48 hr and fixed at stages 42/43. Normally developed embryos were subjected to in situ hybridization in order to examine their GFP expression with maximum sensitivity. (C) A summary of RSRE screening. The green bar indicates % of GFP-positive tadpoles in regenerating nephric tubules. N indicates the number of scored tadpoles. The image shows a representative expression pattern of GFP in regenerating nephric tubules. The green arrow indicates the regenerating nephric tubule.

https://doi.org/10.7554/eLife.43186.006
Figure 3—figure supplement 1
lhx1-CNS17-βEGFP, lhx1-CNS29-βEGFP, lhx1-CNS35-βEGFP and pax2-CNS45-βEGFP were subjected to the transgenic reporter analysis.

Embryos were fixed at stage 26 of which endogenous lhx1 and pax2 expression already begins. An orange arrow indicates the pronephros. N indicates the number of examined embryos. All CNS-carrying reporters were tested at least three times.

https://doi.org/10.7554/eLife.43186.007
Figure 4 with 2 supplements
Arid3a is an input transcription factor for RSREs.

(A) A summary of transcription factor binding motifs on RSREs. (B) arid3a is expressed in nephric tubules. A lateral view of embryos at stage 31 and its transverse section. The upper panels show the in situ hybridization of arid3a.L. The blue arrows indicate the nephric tubules and the white arrows indicate the epidermis. The lower panels show immunostaining using anti-Arid3a using Xla.Tg(Xtr.pax8:EGFP) transgenic tadpole. White arrows: epidermis; orange arrows: proximal tubules; orange arrowheads: glomus and/or nephrocoelom. (C) Arid3a induces lhx1 expression. Xla.Tg(Xla.hsp70:Xtr.arid3a-2A-EGFP) transgenic X. laevis at stage 23 were treated at 34°C for 15 min, followed by 15 min at 14°C. These steps were repeated three times, and tadpoles were incubated at 18°C. lhx1 expression was observed 48 hr after the heat shock at stages 35–36. The signal intensity of in situ hybridization was measured and subjected to statistical analysis. The significance of differences between the control side and the nephrectomized side was calculated using two-tailed unpaired t-test (p=0.0131). The magenta arrows indicate lhx1 expression in proximal and intermediate tubules. N indicates the number of examined embryos. (D) Arid3a directly binds to CNS17, CNS20, and CNS35. Myc-tagged Xtr.arid3a mRNA-injected tadpoles were used for ChIP-qPCR. CNS32 and exon 5 were used as negative elements. The significance of differences between the control IgG and the anti-Myc for Arid3a was calculated using two-tailed unpaired Mann–Whitney t-test: CNS17, p=0.0286; CNS20, p=0.0022; CNS32, p=0.3143 (not significant); exon5, p=0.7000 (not significant); CNS35 (56-334), p=0.0079; CNS35 (314-580), p=0.0022. The error bars indicate SEM. (E) Arid3a activates CNS17 and CNS20. The luciferase reporter assay was performed using HEK293T cells. The significance of differences between the control vector and the CNS-containing reporter was calculated using two-tailed unpaired t-test (CNS17, p=0.0033; CNS20, p=0.0256). The error bars indicate SEM.

https://doi.org/10.7554/eLife.43186.008
Figure 4—figure supplement 1
Transcription binding motifs on CNS17, CNS20, and CNS35.

(A–C) Putative transcription binding motifs on CNS17, CNS20, and CNS35. The open-access database JASPAR ver. 5 was used to search for potential transcription factor binding sites on CNS17, CNS20, and CNS35. Then, candidate transcription factors were narrowed down according to their nephric expression using the Expression Atlas. CNSs were aligned using ClustalW mounting in the GENETUX software, and conserved sequences for the candidate transcription factor binding sites were analyzed by phylogenetic footprinting.

https://doi.org/10.7554/eLife.43186.009
Figure 4—figure supplement 2
Expression of arid3a.L, arid3a.S, spib.L, and spib.S in X. laevis.

(A) Expression of arid3a.L and Arid3a.S at stage 31. (B) Expression of spib.L and spib.S at stage 31.

https://doi.org/10.7554/eLife.43186.010
Figure 5 with 3 supplements
Arid3a promotes cell cycle progression.

(A) The number of phosphorylated histones H3 in the nephrectomized area was increased by the conditionally induced Arid3a. Heat-shocked Xla.Tg(Xla.hsp70:Xtr.arid3a-2A-mcherry, Xtr.pax8:EGFP) was nephrectomized at stage 37, incubated for 72 hr, and then fixed at stages 45/46. The white dotted lines indicate the pax8-expressing cells, and the magenta indicates the phosphorylated histone H3-positive cells. The left graph shows the statistical analysis; one-way analysis of variance (ANOVA) and Tukey’s post hoc test were used. ANOVA p=0.0001; *p = 0.5155 (not significant), **p = 0.001, ***p = 0.0019. The error bars indicate SEM. (B) Lhx1 promotes cell cycle progression in the regenerating area. Heat-shocked Xla.Tg(Xla.hsp70:Xtr.lhx1-2A-mcherry) was nephrectomized at stage 37 and then incubated for 72 hr. One-way ANOVA and Tukey’s post hoc test were used. ANOVA: p=0.0005, *p = 0.0015, and **p = 0.0011. (C) Arid3a with Kdm4a and Arid3b reduced the H3K9me3 levels on RSREs. ChIP analysis was performed using X. laevis. Significant differences were calculated by two-tailed unpaired t-test. The p-values from comparisons between the control and arid3a-, arid3b-, and kdm4a-injected embryos were as follows: *p = 0.0389, **p = 0.0313, and ***p = 0.0456. The error bars indicate SEM.

https://doi.org/10.7554/eLife.43186.011
Figure 5—figure supplement 1
Cell cycle progression in regenerating nephric tubules frequently occurs in the remaining proximal tubule and intermediate tubule.

(A) Cell cycle progression in regenerating nephric tubules. The significance of differences between the control side and the nephrectomized side at 3, 6, 24, and 72 hr is calculated using two-tailed paired t-test (*p = 0.0078, NS: not significant). (B) Immunostaining of phosphorylated histone H3; Xlat.Tg(Xtr.pax8:EGFP) transgenic X. laevis were nephrectomized and then incubated for 24 hr. The green arrows indicate phosphorylated histone H3-positive cells in the remaining proximal tubule and intermediate tubule. The orange arrows indicate the distal tubule.

https://doi.org/10.7554/eLife.43186.012
Figure 5—figure supplement 2
Heat shock induces the expression of mCherry.

Xla.Tg(Xla.hsp70:Xtr.arid3a-2A-mcherry, Xtr.pax8:EGFP) transgenic X. laevis at stage 23 were treated at 34°C for 15 min, followed by 15 min at 14°C. These steps were repeated three times, and tadpoles were incubated at 18°C. mCherry expression was observed at stages 36/37.

https://doi.org/10.7554/eLife.43186.013
Figure 5—figure supplement 3
Cell cycle progression in heat-shock-untreated and heat-shock-treated tadpoles.

Xla.Tg(Xla.hsp70:Xtr.arid3a-2A-mcherry) transgenic X. laevis at stage 23 were treated at 34°C for 15 min, followed by 15 min at 14°C. These steps were repeated three times, and tadpoles were incubated at 18°C. mCherry expression was observed at stages 36/37. The significance of differences between the non-heat-shocked tadpole and heat-shocked tadpole was calculated by two-tailed paired t-test (*p = 0.0003, **p = 0.0022, NS: not significant). The error bars indicate SEM.

https://doi.org/10.7554/eLife.43186.014
Figure 6 with 2 supplements
Arid3a is required for the regeneration of proximal tubules in X.laevis.

(A) Conditional knockdown of Arid3a using arid3a.L-photo-morpholinos (arid3a.L-Photo-MO). The upper panel shows the experimental design of conditional gene knockdown experiment using Photo-MO. arid3a.L-antisense-splicing-blocking MO (arid3a.L-MO) inactivated by Photo-MO is injected at the one-cell stage, subjected to UV exposure at stages 29–30, and then sacrificed for RT-PCR analyses. The lower panel shows the statistical analysis. The significance of differences between the UV-untreated and UV-treated embryos was calculated by two-tailed unpaired t-test (p=0.0217). The error bars indicate SEM. (B) Conditional knockdown of Arid3a during nephric regeneration causes the reduction of lhx1 expression. The upper panel shows the experimental design. arid3a.L-MO inactivated by Photo-MO is injected at the one-cell stage, followed by UV exposure at stages 29–30, nephrectomy at stages 36–37, and subsequently incubation for 48 hr. The lower panel shows the quantification of lhx1 expression signals. The analysis indicates that there was no significant difference between the control side and the nephrectomized side (two-tailed paired t-test, p=0.0748). N indicates the number of examined embryos. The lines in boxes indicate the median. (C) Arid3a is required for the regeneration of nephric tubules. The upper panel shows the experimental design. arid3a.L-MO inactivated by Photo-MO is injected at the one-cell stage, and UV exposure is performed at stages 29–30, followed by nephrectomy at stages 36–37 and subsequently incubation for 72 hr. The left panel shows a summary of the statistics of three independent experiments.

https://doi.org/10.7554/eLife.43186.015
Figure 6—figure supplement 1
Arid3a-photo-morpholino blocks the effect of Arid3a-antisense morpholino.

(A) Sequences of arid3a.L-antisense-MO (arid3a.L-MO) and arid3a.L-Photo-MO. The upper panel shows a schematic illustration of arid3a-antisense-MO. Sequences show the target region of arid3a.L-MO and its sense arid3a.L-Photo-MO. (B) arid3a.L-MO causes developmental defects in early-stage embryos. arid3a.L-MO with venus-NLS mRNA is injected at the one-cell stage. (C) The arid3a.L-MO blocks the splicing of the arid3a transcript. Total RNA was purified from control and arid3a.L-MO-injected embryos, and RT-PCR analysis was performed. Lanes 1–3: three independent experiments. (D) Embryos injected with arid3a.L-MO inactivated by arid3a.L-Photo-MO developed normally.

https://doi.org/10.7554/eLife.43186.016
Figure 6—figure supplement 2
Conditional knockdown of Arid3a during nephric regeneration causes the reduction of cell cycle progression.

The upper panel shows the experimental design. arid3a.L-antisense-MO inactivated by arid3a.L-Photo-MO is injected at the one-cell stage, and UV exposure is performed at stage 29, followed by nephrectomy at stages 37/38 and then incubation for 72 hr. The fixed nephrectomized X. laevis were subjected to immunostaining with phosphorylated histone H3. The lower panel shows the statistical analysis. The significance of differences between the UV-untreated and UV-treated embryos was calculated by two-tailed unpaired t-test (p=0.0278). The error bars indicate SEM.

https://doi.org/10.7554/eLife.43186.017
Figure 7 with 1 supplement
Model illustrating the Arid3a function in the regeneration of proximal nephric tubules.

(A) Arid3a binds to RSREs on lhx1 and changes the H3K9me3 levels. This chromatin modification allows the induction of lhx1 expression. (B) In the absence of Arid3a, proximal tubules fail to regenerate a complete nephron structure. (C) Excess amounts of Arid3a cause the outgrowth of nephric tubules from the distal nephric duct.

https://doi.org/10.7554/eLife.43186.018
Figure 7—figure supplement 1
Conditionally induced Arid3a causes the outgrowth of nephric tubules in regenerating nephrons.

The upper panel shows the experimental design. Xla.Tg(Xtr.arid3a-2A-mcherry) transgenic X. laevis prepared using Xla.Tg(Xtr.pax8:EGFP) were induced by heat shock at stage 23. Nephrectomy was performed at stage 37, and embryos were then incubated for 24 hr.

https://doi.org/10.7554/eLife.43186.019
Author response image 1
A) A diagram of the experimental design.

B) RT-PCR analysis was performed. Lanes 1: Marker, Lane2: UV untreated embryos, Lane3: UV treated embryos. UV treatment and RT-PCR were performed at three times independently. C) The significance of differences between the UVuntreated and UV-treated wiled type embryos was calculated by two-tailed unpaired t-test (p = 0.4857, not significant). The error bars indicate SEM.

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or referenceIdentifiersAdditional

information
Gene
(Xenopus tropicalis)
arid3aThis paperRefSeq: NM_001011106.1
Gene
(Xenopus tropicalis)
arid3bThis paperRefSeq: XM_002938881.4
Gene
(Xenopus tropicalis)
lhx1This paperRefSeq:
NM_001100228.1
Genetic reagent
(Xenopus laevis)
Xla.Tg(Xtr.pax8:EGFP)Ochi, H., et al.,
2012; doi: 10.1038/ncomms1851.
Cell line
(Homo sapiens)
293TRIKEN BRC
CELL BANK
RCB2202, RRID:SCR_003163
Transfected
construct
pGL4.23PromegaE8411
Transfected
construct
pGL-lhx1-CNS17-LucThis paperNew regent. The CNS17
fragments from
IS-lhx1-CNS17-β-GFP
vector introduced
into the
SacI and EcoRV sites
of pGL4.23 vector.
Transfected
construct
pGL-lhx1-CNS20-LucThis paperNew regent.
The CNS20 fragments
from IS-lhx1-CNS17-
β-GFP wereintroduced
into the SacI and EcoRV
sites of pGL4.23 vector.
Transfected
construct
pGL-lhx1-CNS35-LucThis paperNew regent.
The CNS35 fragments
from IS-lhx1-CNS17-
β-GFP vector were
introduced into the
SacI and EcoRV sites
of pGL4.23 vector.
AntibodyAnti-phospho
histone H3 (Ser10)
antibody
Milipore06–570(1:1000)
AntibodyAnti-Arid3a antibodyDSHBPCRP-ARID3A-1E9, RRID:AB_2618410(1:10)
AntibodyAlexa 488
-conjugated
goat anti-rabbit IgG
InvitrogenA11001(1:1000)
AntibodyAlexa 568-conjugated
goat anti-mouse IgG
Invitrogen,A11011(1:1000)
AntibodyAnti-H3K9
(tri-methyl K9)
antibody
Abcam,ab8898(1:750)
AntibodyMouse monoclonal
c-Myc (9E10) antibody
Santa Cruz
Biotechnology Inc.
sc-40, RRID:AB_291323(1:750)
Recombinant
DNA reagent
Xenopus laevis
hsp70 promoter
Wheeler, G. N., et al. 2000; doi.org/10.1016/S0960-9822 (00)00596–0
Recombinant DNA reagentIS-β-GFP reporterOgino, H., et al., 2008; doi: 10.1242/dev.009548
Recombinant DNA reagentpCS-myc-arid3aNew regent. The PCR product was introduced into the XhoI and XbaI sites of the pCS2 + MT plasmid.
Recombinant DNA reagentpCS-his-arid3bNew regent. The PCR product was introduced into the ClaI and XbaI site of the pCS vector.
Recombinant DNA reagenthsp70-myc-arid3a-2A-mcherryThis paperNew regent. The PCR amplified myc-arid3a and 2A-mcherry were introduced into the ClaI and XbaI sites of the IS-hsp70-cloning vector.
Recombinant DNA reagenthsp70-myc-arid3a-2A-EGFPThis paperNew regent. The PCR amplified myc-arid3a and 2A-EGFP were introduced into the ClaI and XbaI sites of the IS-hsp70-cloning vector.
Recombinant DNA reagenthsp70-lhx1-2A-EGFPThis paperNew regent. The PCR amplifiedlhx1 was introduced into the EcoRI sites of the pCS2 + MT plasmid. The PCR amplified myc-lhx1 and 2A-EGFP were introduced into the EcoRI and XbaI sites of the IS-hsp70-cloning vector.
Recombinant DNA reagent (Xenopus laevis)arid3a.LThis paperXelaev18006256mNew regent.
The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)arid3a.SThis paperXelaev18009788mNew regent. The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)spib. LThis paperXelaev18036193m.gNew regent. The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)spib.SThis paperXelaev18037903m.gNew regent. The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)hnf4aThis paperXelaev17043619m, Xelaev17043619mNew regent. The PCR product was introduced into the BamHI and HindIII sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)hnf1bThis paperXelaev18012186m.g, Xelaev18014991m.gNew regent. The PCR product was introduced into the BamHI and HindIII sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)osr1This paperXelaev14054577m.g, Xelaev14010174m.gNew regent.
The PCR product was introduced into the XhoI and BamHI sites of the pBluescript II SK plasmid.
Recombinant DNA reagent
(Xenopus laevis)
osr2This paperXelaev14045820m.g, Xelaev14031017m.gNew regent. The PCR product was introduced into the XhoI and BamHI sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)six2This paperXelaev16000858m, Xelaev16036496mNew regent.
The PCR product
was introduced
into the HindIII and XhoI sites of
the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)lhx1This paperXelaev16044871m.gNew regent. The PCR product was introduced into the SmaI and HindIII sites of the pBluescript II SK plasmid.
Recombinant DNA reagent (Xenopus laevis)pax2Heller and Brändli, 1997:
doi.org/10.1016/S0925-
4773(97)00158-5
Recombinant DNA reagent (Xenopus laevis)pax8Heller and Brändli, 1999:
doi.org/10.1002/(SICI)1520-
6408(1999)24:3/4 < 208::AID-
DVG4 > 3.0.CO;2 J
Recombinant DNA reagent (Mus musculus)kdm4aMammalian Gene Collection (MGC) Clones4207552BC028866
Sequence-based reagent (Xenopus tropicalis)PCR primers for CNSThis paper
Sequence-based reagent (Xenopus laevis)ChIP-qPCR primersThis paper
Sequence-based reagent
(Xenopus laevis)
Photo-Morpholino
oligonucleotide for arid3a,L
This paperGene Tools, LLCAGAGGGAAGCCAGCAGGTACTCACC
Sequence-based reagent (Xenopus laevis)Morpholino
oligonucleotide for arid3a,L
This paperGene Tools, LLCAGTACCTGpTGGCTTCCCT
Sequence-based reagent (Xenopus laevis)PT-PCR primers for arid3a.LThis paper
Sequence-based reagent (Homo sapiens)hg19 chr17-34994909–35360679hg19UCSC Genome Browser, RRID:SCR_005780
Sequence-based reagent (Mus musculus)mm10 chr11-83838963–85151744mm10UCSC Genome Browser, RRID:SCR_005780
Sequence-based reagent (Monodelphis domestica)monDom5 chr2-185210169–185976291monDom5UCSC Genome Browser, RRID:SCR_005780
Sequence-based reagent (Xenopus tropicalis)xenTro3 GL173152-472286-845619xenTro3Xenbase, RRID:SCR_003280
Sequence-based reagent (Danio rerio)danRer10-chr15_27468859–28180541danRer10UCSC Genome Browser, RRID:SCR_005780
Sequence-based
reagent (Danio rerio)
danRer10-
chr5_55422952–55633560
danRer10UCSC Genome Browser, RRID:SCR_005780
Software, algorithmGraphPad Prism 7.0GraphPad SoftwareRRID:SCR_002798
Software, algorithmAdobe PhotoshopAdobeRRID:SCR_014199
Software, algorithmMultiPipMakerSchwartz, S., et al., 2000: doi:
10.1101/gr.10.4.577
RRID:SCR_011806
Software, algorithmJASPAR ver. 5Mathelier, A., et al., 2014: doi: 10.1093/nar/gkt997.RRID:SCR_003030
Commercial assay or kitISOGENNIPPON GENECode No. 317–02503
Commercial assay or kitDual-Luciferase Reporter Assay SystemPromegaE1910
 Commercial assay or kitDynabeads Protein ADynabeads10001D
Chemical compound, drugjetPEI (transfection)Polyplus-transfection SA101–10N
Table 1
Primer sequences for the RT-PCR and quantitative RT-PCR.
https://doi.org/10.7554/eLife.43186.020
Xtr.arid3a_full-length-FATGAAGCTGCAAGCGGTG
Xtr.arid3a_full-length-RTCAGGGAGAAGGATTGTTAG
Xtr.arid3b_full-length-FCGATGCCGCCACCATGCACCATCACCACCATCATCACCACCATCACT
Xtr.arid3b_full-length-RCTAGAGTGATGGTGGTGATGATGGTGGTGATGGTGCATGGTGGCGGCAT
Xla.CNS17-qPCR-FCTGAGTGAGTTTCAAATAAAAGGATTAAG
Xla.CNS17-qPCR-RGCTATGTAGAGTGGAATAGAGTTAGAATGA
Xla.CNS20-qPCR-FAATACTCACACAGGGAAGACAGC
Xla.CNS20-qPCR-RAAGGCCAAAATTACTTTTCATTTATCTTA
Xla.CNS32-qPCR-FGGGAATTAACCCCCATGGGAA
Xla.CNS32-qPCR-FTTTGCCTCCCTCCTGATCTATAGG
Xla.exon5-qPCR-FCCAGGTTCCATGCACTCTATG
Xla.exon5-qPCR-RTTTCTGGTGGGTGTGACAAA
Xla.CNS35-qPCR-56–334 FAGTTTATAATCTCTGCCGTGCT
Xla.CNS35-qPCR-56–334 RTGTGCTGCTTGGAATTCAAG
Xla.CNS35-qPCR-314–580 FCTTGAATTCCAAGCAGCACAT
Xla.CNS35-qPCR-314–580 RCCTCAAGAACAATTCTCATTTAAATCCAC
Xla.arid3a-L-exon2-RT-PCR-FCCCAAGCAATCTAGTCAACAGACATTTCC
Xla.arid3a-L-exon4-RT-PCR-RGCTGCACTGGTGATTGAAGTTGGTAG
Xla.lhx1-FTCTACTGTAAAAACGACTTCTTCAGG
Xla.lhx1-RCCATTGACTGATAGAGAAGAAAAGG
Xla.six2.L-FCGAAGCCAAAGAGAGGTACG
Xla.six2.L-RTTGGGATCCTTCAACTCTGG
Xla.six2.S-FACCCGTTGTCCTCTTCAATG
Xla.six2.S-RTGACCTGCTGAATGCAAGT
Xla.osr1-FTCCTTCCTACAAGCCTTCAATGGAC
Xla.osr1-RCTGAACAGAACACAATCATGTACAAGGAATTC
Xla.osr2-FGGGAAGATGGGCAGCAAAGCT
Xla.osr2-RTAGAAGTCCTGTCTGGGGCTGTG
Xla.hnf1b-FTGGCTATGGATGCCTATAGTACTGGCC
Xla.hnf1b-RTGCTGATGCTGCTAGTATCTGTGACAAC
Xla.hnf4a-FCGGCTTTCTGTGAACTTCCACTGG
Xla.hnf4a-RCTACATAGCTTCCTGTTTGGTGATGGTC

Data availability

All data were generated and analysed during this study are included in the manuscript and supporting files.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)