1. Neuroscience
Download icon

Genetic dissection of the different roles of hypothalamic kisspeptin neurons in regulating female reproduction

Research Article
Cite this article as: eLife 2019;8:e43999 doi: 10.7554/eLife.43999
7 figures, 6 tables and 1 additional file

Figures

Figure 1 with 1 supplement
AVPV kisspeptin neurons from KERKO mice are less excitable compared to those from control mice and are not regulated by estradiol.

(a) Representative extracellular recordings for cells from control and KERKO mice from ovary-intact, OVX and OVX +E groups. (b) Individual values and mean ± SEM firing frequency of cells from control (white circles) and KERKO groups (black circles). (c) representative depolarizing (magenta,+20 pA, 500 ms) and hyperpolarizing (black, −20 pA, 500 ms) firing signatures for cells from control and KERKO mice in ovary-intact (left), OVX (middle) and OVX +E (right) groups; black arrows indicate rebound bursts and red arrows indicate depolarization-induced bursts (DIB). Initial membrane potential was 70 ± 2 mV. (d) and (e) percent of cells exhibiting DIB (d) or rebound (e) bursts; cells per group is shown within the bar. (f) Input-output curves for cells from control and KERKO mice; ovary-intact (left), OVX (middle) and OVX +E (right). *p<0.05.

https://doi.org/10.7554/eLife.43999.003
Figure 1—figure supplement 1
Recording parameters and uterine mass.

(a) Individual values and mean ± SEM input resistance (Rinput, a) and cell capacitance (Cm, b) for AVPV kisspeptin neurons in control and KERKO mice (left), in mice with AAV vector delivered to AVPV region (middle with Esr1 status confirmed by either immunofluorescence (IF) single-cell qPCR (PCR) post hoc), and in AVPV-AAV-Esr1 infected mice (combined detection methods) vs KERKO mice (right). (c) Individual values and mean ± SEM normalized uterine mass (uterine mass/body mass, mg/g) of control and KERKO mice (left), of mice with AAV delivered to AVPV region, OVX +E (middle), and of mice with AAV delivered to arcuate region, intact (right). *p<0.05. The lack of a significant drop in the ratio is likely attributable to the short duration post OVX (2 days).

https://doi.org/10.7554/eLife.43999.004
T-type calcium currents are reduced in AVPV kisspeptin neurons from KERKO compared to control mice.

(a) Voltage protocol (bottom right) and representative IT in control (left) and KERKO groups (right). (b) Mean ± SEM IT current density in control (white symbols) and KERKO groups (black symbols). (c) Voltage dependence of IT conductance activation and inactivation in cells from control and KERKO mice. *p<0.05.

https://doi.org/10.7554/eLife.43999.007
Figure 3 with 1 supplement
In vitro and in vivo validation of AVPV-AAV-Esr1 guides.

(a) Sequencing from C2C12 cells transiently transfected with lentiCRISPR v2 with sgRNAs targeting Esr1 (guide 1 [g1] top, guide 2 [g2] middle) or lacZ. N in yellow highlight indicates peak on peak mutations. (b) and (c) Schematic representation of (b) the Cre-inducible AAV vector delivering sgRNAs and (c) Kiss1-cre Cas9-loxp Stop-Gfp mice. (d) AVPV-AAV-lacZ, -Esr1 g1 or g2 were bilaterally delivered to the AVPV region (see Figure 3—figure supplement 1). Brain sections were processed to detect GFP (green), mCherry (red) and ERα (black), dual GFP/mCherry detection indicates infection of kisspeptin neuron (white arrows, left panel of each pair). AVPV-AAV-Esr1 infected AVPV kisspeptin neurons exhibit decreased ERα expression compared to AVPV-AAV-lacZ infected cells (right panel of each pair, white arrows indicate ERα-negative, magenta arrows indicate ERα-positive infected cells). (e) Representative reproductive cycles of mice that received AAV-lacZ, g1 or g2; E, estrus; D, diestrus; P, proestrus; day 0 is the day of stereotaxic surgery. (f) Mean ± SEM proestrous LH surge measured at 3, 4, and 5 pm EST in AVPV-AAV-lacZ and AVPV-AAV-Esr1 mice (mice receiving g1 or g2 combined). (g) Mean ± SEM estradiol-induced LH surge measured at 9 am and 5 pm EST from AAV-lacZ and AAV-Esr1 OVX + E mice (mice receiving g1 or g2 were combined).

https://doi.org/10.7554/eLife.43999.008
Figure 3—figure supplement 1
Bilateral delivery of AAV-lacZ, and AAV-Esr1 (g1 and g2) to AVPV of adult female mice.

Immunofluorescence was used to detect GFP (green), mCherry (red) and immunohistochemistry to detect ERα (black).

https://doi.org/10.7554/eLife.43999.009
Figure 4 with 1 supplement
Decreased excitability of AVPV kisspeptin neurons in AVPV-AAV-Esr1 knockdown mice.

(a–c) whole-cell recording and immunofluorescence (IF) post hoc identification of ERα in recorded cells in OVX + E AVPV-AAV-Esr1 infected mice. (a) visualization during recording; (b) representative depolarizing (+20 pA, magenta) and hyperpolarizing (−20 pA, black) firing signatures. (c) neurobiotin (blue) and ERα (red) staining after photobleaching of GFP and mCherry signals. From top to bottom: cells not infected by AVPV-AAV-Esr1 and immunopositive for ERα; cells infected by AVPV-AAV-Esr1 but still immunopositive for ERα; cells infected by AAV-Esr1 and not immunopositive for ERα; cells infected by AVPV-AAV-LacZ and immunopositive for ERα. (d) left, input-output curves of infected cells with undetectable ERα in AAV-Esr1 (third row in a-c, black circle), cells infected by AVPV-AAV-lacZ (bottom row in a-c, white circle, n = 14), and cells not infected by AAV (top row in a-c, orange circle); middle, input-output curves from a separate set of cells in which Esr1 status was confirmed by single-cell qPCR post hoc (AAV-Esr1 black circle; AAV-lacZ, white circle); right, input-output curve of AVPV-AAV-Esr1 knockdown (black circle) vs KERKO (yellow circle) cells. (e,f) percent of cells exhibiting DIB (e) or rebound bursts (f). Cells per group is shown within or on top of the bar. (g), representative action potentials at the rheobase from lacZ vs Esr1 infected cells. (h–j) individual values and mean ± SEM rate of rise (h) full width at half maximum (FWHM) (i) and afterhyperpolarization potential amplitude (AHP) (j). *p<0.05 vs all other groups; # p<0.05 vs uninfected.

https://doi.org/10.7554/eLife.43999.011
Figure 4—figure supplement 1
Single-cell qPCR for mRNA from AVPV kisspeptin neurons in mice with AAV vector delivered to AVPV region.

Bar graphs show percentage of cell positive for each gene. *p<0.05, Fisher’s exact test.

https://doi.org/10.7554/eLife.43999.012
Figure 5 with 1 supplement
Deletion of ER in arcuate kisspeptin neurons.

(a) Arc-AAV-lacZ and Arc-AAV-Esr1 (g1 or g2) were bilaterally delivered to arcuate region (see Figure 5—figure supplement 1). Brain sections were processed to detect GFP (green), mCherry (red) and ERα (black). Arc-AAV-Esr1 infected arcuate kisspeptin neurons exhibit decreased ERα expression compared to Arc-AAV-lacZ infected cells (bottom panel of each pair, white arrows indicate ERα-negative, magenta arrows indicate ERα-positive infected cells). (b) representative reproductive cycles of mice that received Arc-AAV-lacZ, -Esr1 g1 or g2; E, estrus; D, diestrus; P, proestrus. Day 0 indicates the day of stereotaxic surgery. (c) pulsatile LH release in Arc-AAV-lacZ, -Esr1 g1 or g2 mice, # indicate pulse detected by Cluster analysis (Veldhuis and Johnson, 1986). (d) Mean ± SEM days/week in proestrus before (from day −12 to day 14) and after infection (day 29 to day 56) in mice receiving Arc-AAV-lacZ, -Esr1 g1 or g2. (e) Individual values and mean ± SEM LH pulses/h. (f) Individual means and mean ± SEM mean LH over the entire pretreatment sampling period. (g) Mean ± SEM LH before (con) and 15 min after kisspeptin (kiss) injection (left) and before (con) and 15 min after GnRH injection (right). *p<0.05.

https://doi.org/10.7554/eLife.43999.014
Figure 5—figure supplement 1
Bilateral delivery of AAV-lacZ, and AAV-Esr1 (g1 and g2) to arcuate of adult female mice.

Immunofluorescence was used to detect GFP (green), mCherry (red) and immunohistochemistry to detect ERα (black).

https://doi.org/10.7554/eLife.43999.015
Esr1 knockdown in arcuate kisspeptin neurons alters cellular physiology.

(a) Representative extracellular recordings of firing rate. (b), (c) individual values and mean ± SEM firing rate (b) and percent of cells with firing rate >1 Hz (c); cells per group shown in bars. (d) representative whole-cell recordings of EPSCs. (e, f) individual values and mean ± SEM of EPSC frequency (e) and amplitude (f). *p<0.05.

https://doi.org/10.7554/eLife.43999.016
Schematic diagram of estradiol feedback regulation on ERα in AVPV and arcuate kisspeptin neurons in adulthood.

Knockdown of ERα in AVPV kisspeptin neurons blunted LH surge but did not alter reproductive cyclicity whereas knockdown of ERα in arcuate kisspeptin neurons disrupted the cyclicity.

https://doi.org/10.7554/eLife.43999.017

Tables

Table 1
Statistical parameters for two-way ANOVA.
https://doi.org/10.7554/eLife.43999.005
ParameterFigureFactor 1Factor 2Interaction
Firing frequencyFigure 1bsteroid
F (2, 57)=14.7 *
genotype
F (1, 57)=40.1 *

F (2, 57)=6.2 *
Input-output curveFigure 1f intact
OVX
OVX + E
current
F (4, 80)=242.7 *
F (4, 72)=138.6 *
F (4, 84)=182.2 *
genotype
F (1, 20)=8.2 *
F (1, 18)=0.8
F (1, 21)=6.6 *

F (4, 80)=0.6
F (4, 72)=0.7
F (4, 84)=1.5
IT current densityFigure 2bvoltage
F (8, 104)=39.74 *
genotype
F (1, 13)=11.1 *

F (8, 104)=9.4 *
IT normalized conductanceFigure 2c activation inactivationvoltage
F (8, 104)=494.7 *
F (8, 104)=195.8 *
genotype
F (1, 13)=3.2
F (1, 13)=4.5 *

F (8, 104)=1.5
F (8, 104)=3.1 *
LHFigure 3f
Figure 3g
AAV type
F (1, 12)=29.8 *
F (1, 13)=0.3
time
F (2, 24)=2.1
F (1, 13)=35.8 *

F (2, 24)=1.8
F (1, 13)=19.5 *
Input-output curveFigure 4d
IF post hoc
PCR post hoc
AAV-Esr1 vs KERKO
current
F (4, 136)=165.5 *
F (4, 68)=123 *
F (4, 100)=154.7 *
AAV type
F (2, 34)=7.2 *
F (1, 17)=12.5 *
F (1, 25)=2.1

F (8, 136)=0.7
F (4, 68)=4.3*
F (4, 100)=7.2
Days proestrus/weekFigure 5dtime
F (1, 12)=13.6 *
AAV type
F (2, 12)=5.8 *

F (2, 12)=10.0 *
LHFigure 5g kisspeptin
GnRH
injection
F (1, 12)=34.8 *
F (1, 12)=20.0 *
AAV type
F (1, 12)=4.7 #
F (1, 12)=7.0 *

F (1, 12)=17.1 *
F (1, 12)=7.5 *
steroidsgenotypeinteraction
Input resistanceFigure 1—figure supplement 1aF (2, 59)=2.6F (1, 59)=13.2 *F (2, 59)=2.0
Cell capacitanceFigure 1—figure supplement 1bF (2, 59)=5.2F (1, 59)=0.1 *F (2, 59)=0.4
Normalized uterine massFigure 1—figure supplement 1cF (2, 30)=19.9 *F (1, 30)=80.0 *F (2, 30)=2.4
  1. *p<0.05, # p=0.05

Table 2
Statistical parameters for two group comparisons.

For normally distributed data, two-tailed unpaired Student’s t-test; for non-normally distributed data, two-tailed Mann-Whitney U test.

https://doi.org/10.7554/eLife.43999.006
ParameterFigureT or U, df
V1/2 activation slope
V1/2 inactivation slope inactivation
in the text, control vs KERKO
IT kinetics
t = 1.7, 13
t = 0.01, 13
t = 2.5, 13
t = 1.6, 13
rate of rise IF rate of rise PCR
FWHM IF
FWHM PCR
AHP amplitude IF
AHP amplitude PCR
Figure 4h
Figure 4i
Figure 4j
t = 2.5, 27
t = 2.7, 17
U = 62 t = 3.1, 17
t = 4.4, 27
t = 2.7, 27
LH pulses/hFigure 5et = 1.7, 12
Mean LHFigure 5ft = 0.05, 12
Firing rateFigure 6bU = 45.5
EPSC frequencyFigure 6et = 4.0, 20
EPSC amplitudeFigure 6et = 2.7, 20
Input resistance lacZ vs Esr1 IF, lacZ vs Esr1 PCR,
KERKO vs Esr1
Figure 1—figure supplement 1at = 0.7, 27
t = 1.0, 17
t = 1.8, 35
Cell capacitance lacZ vs Esr1 IF, lacZ vs Esr1 PCR,
KERKO vs Esr1
Figure 1—figure supplement 1bt = 0.4, 27
t = 0.3, 17
t = 0.3, 35
Normalized uterine mass lacZ vs Esr1 AVPV lacZ vs Esr1 arcuateFigure 1—figure supplement 1ct = 0.5, 14
t = 2.9, 8
  1. *p<0.05, # p=0.05

Table 3
Specificity of the Esr1 sgRNAs and off-target predictions by Feng Zhang’s guide design tool software (http://crispr.mit.edu); Benchling analysis (https://benchling.com/academic) produced a subset of these results.
https://doi.org/10.7554/eLife.43999.010
sgRNA*Specificity score& mismatches (MMs) between
sgRNA and gene locus
Gene# Off-target scoreLocus
Esr1-g1904MMs [2:9:11:12]NM_013870Smtn0.2chr11:+3417882
4MMs [5:10:13:19]NM_009728Atp10a0.2chr7:−66040030
4MMs [4:9:15:20]NM_023805Slc38a30.1chr9:+107561207
4MMs [7:8:15:19]NM_001037764Rai10.1chr11:+60003351
4MMs [3:10:13:14]NM_053193Cpsf10.1chr15:−76426196
Esr1-g2734MMs [4:8:11:12]NM_001024560Snx320.4chr19:+5495979
4MMs [2:4:5:16]NM_001194923Cldn180.3chr9:+99617489
  1. *Values range from 1 to 100 index to assess the specificity of a guide, with 100 being the most specific guide.

    &4MMs [2:9:11:12] indicates nucleotides 2, 9, 11, 12 of the sgRNA do not match the ‘off target’ gene locus.

  2. #Off-target score values range from 0 to 100, with 100 being the value for the target Esr1 gene.

Table 4
Primer probes used for single-cell qPCR.
https://doi.org/10.7554/eLife.43999.013
IDT prime time
qPCR probe
assay
TranscriptForward 5'−3'Reverse 5'−3'Probe 5'−3'Amplicon

(bp)
Accession

no.
Location
Mm.PT.58.42702897Cacna1gCTCAACTGTATCACCATCGCTAAAGACTGCCGTGAAGATGTCGCCCCAAAATTGACCCCCAC101NM_0097834446–4546
Mm.PT.58.15908160Cacna1hGACACTGTGGTTCAAGCTCTTTATCCTCGC
TGCATTCTAGC
ACCTTGGTCTTCTTTTCATGCTCCTGT122NM_0214155565–5686
Mm.PT.58.9567566Cacna1iCATCACCTTCATCATCTGCCTCCTCCAGCACAAAGACAGTACCAGCCTACATCCCTAGAGACAGC125NM_0010443084914–5038
Mm.PT.58.41764708Esr1GCTCCTTCTCATTCTTTCCCATCCAGGAGCAGGTCATAGAGCCATGCCTTTGTTACTCATGTGCCG108NM_0079561768–1865
Mm.PT.58.16981577Esr2CCTCCTGATGCTTCTTTCTCATTCGAAGCGTGTGAGCATTCTCCATGCCCTTGTTACTGATGTGCC133NM_2077071829–1961
Mm.PT.58.30501833Hcn1GCGTTATCACCAAGTCCAGTACAGTAGGTATCAGCTCGGACACTCCGAAGTAAGAGCCATCTGTCAGC115NM_0104081913–2027
Mm.PT.58.7963736Hcn2CTTCACCAAGATCCTCAGTCTGGGTCGTAGGTCATGTGGAAATGCGGCTATCACGGCTCATCC98NM_008226935–1032
Mm.PT.58.7999585Hcn3GCCTCACTGATGGATCCTACTTCAAGCACCGCATTGAAGTACCTATTGTCGCCTCTACTCGCTCA130NM_0082271546–1675
Mm.PT.58.43863085Hcn4GCTGATGGCTCCTATTTTGGATCATTGAAGTTGTCCACGCTAAGTATCCGCTCTGACGCTGGC116NM_0010811922614–2729
Mm.PT.45.16269514Kiss1CTGCTTCTCCTCTGTGTCGTTCCCAGGCATTAACGAGTTC.CGGACTGCTGGCCTGTGGAT105NM_17826066–170
Mm.PT.47.10254276PgrCGCCATACCTTAACTACCTGAGCCATAGTGACAGCCAGATGCAGATTCAGAAGCCAGCCAGAGCC124NM_0088292230–2353
Mm.PT.51.17048009.gSyn1CTTGAGCAGATT GCCATGTCACCTCAATAATGTGATCCCTTCCACGTGTCTACCCACAACTTGTACCTG131NM_0136801159–1289
Mm.PT.58.33106186ThCCCTACCAAGATCAAACCTACCCTGGATACGAGAGGCATAGTTCTGAAGCTCTCTGACACGAAGTACACCG96NM_0093771298–1393
Key resources table
Reagent type
(species) or
resource
DesignationSource or referenceIdentifiersAdditional information
Mus musculus,
C57BL/6J
Kiss1-ires-CrePMID 26862996Dr. Martin Myers,
University of Michigan
Mus musculus,
C57BL/6J
Esr1 loxpPMID 17785410Dr. Martin Myers,
University of Michigan
Mus musculus,
C57BL/6J
Kiss1-creDr. Carol Elias/Jackson
Labs
JAX 023426
Mus musculus,
C57BL/6J
Cas9-stop loxpJackson LabsJax 024858;
RRID:IMSR_JAX:024858
Mus musculus,
C57BL/6J
Rosa26-EYFPJackson LabsJax 006148;
RRID:IMSR_JAX:006148
Mus musculus
myoblast, C3H
C2C12 myoblastATTCCat # CRL 1772Dr. Daniel Michele,
University of Michigan
Antibodyrabbit anti-ERαMillipore#06-935dil. 1:10000
Antibodyrat anti-mCherryInvitrogenM11217dil. 1:5000
Antibodychicken anti-GFPAbcamab13970dil. 1:2000
Recombinant
DNA reagent
AAV8-hsyn-dio-sg
RNA_lacZ-mCherry
this paperCustom OrderUNC-viral core
Recombinant
DNA reagent
AAV8-hsyn-dio-sg
RNAEsr1_g1-mCherry
this paperCustom OrderUNC-viral core
Recombinant
DNA reagent
AAV8-hsyn-dio-sg
RNAEsr1_g2-mCherry
this paperCustom OrderUNC-viral core
Recombinant
DNA reagent
plasmid
LentiV2-sgRNA-Esr1_g1
this paperbuilt on lentiCRISPRv2;
Addgene Cat #52961
Recombinant
DNA reagent
plasmid
LentiV2-sgRNA-Esr1_g2
this paperbuilt on lentiCRISPRv2;
Addgene Cat #52961
Recombinant
DNA reagent
plasmid
LentiV2-sgRNA-lacZ
this paperbuilt on lentiCRISPRv2;
Addgene Cat #52961
Commercial
assay or kit
ABC amplificationVector LaboratoriesCat # PK-6100
Chemical
compound, drug
CNQXSigma-AldrichCat # 1045
Chemical
compound, drug
APVTocrisCat # 0106
Chemical
compound, drug
picrotoxinSigma-AldrichCat # P1675
Chemical
compound, drug
TTXTocrisCat # 1069
Chemical
compound, drug
10% Neutral
Buffered Formalin
Fisher ScientificCat # 22899402
Chemical
compound, drug
Hydrogen PeroxideSigmaCat # 216763
Chemical
compound, drug
LHRHBachemCat # H4005
Chemical
compound, drug
kisspeptinPhoenixCat # 048-56
Chemical
compound, drug
NeurobiotinVector LabsCat # SP-1120
Software,
algorithm
Igor ProWavemetricshttps://github.com/defazio2/LWeLifeRepo
Table 5
Number of cells (n) and number of mice (N) in each experiment.

For AAV-injected mice, only animals with bilateral hits are included.

https://doi.org/10.7554/eLife.43999.018
Figure 1a, bControlKERKO
Intact n = 12, N = 7Intact n = 11, N = 6
OVX n = 10, N = 5OVX n = 11, N = 4
OVX + E n = 10, N = 6OVX + E n = 9, N = 5
Figure 1c–f,
Figure 1—figure supplement 1a left, 1b left
ControlKERKO
Intact n = 11, N = 4Intact n = 11, N = 5
OVX n = 11, N = 5OVX n = 9, N = 4
OVX + E n = 11, N = 7OVX + E n = 12, N = 5
Figure 2ControlKERKO
n = 8, N = 4n = 7, N = 4
Figure 3d,eAVPV-AAV-lacZAVPV-AAV-Esr1g1AVPV-AAV-Esr1g2
N = 3N = 3N = 4
Figure 3fAVPV-AAV- lacZAVPV-AAV-Esr1
N = 6N = 8 (g1 N = 4, g2 N = 4)
Figure 3gAVPV-AAV- lacZAVPV-AAV-Esr1
N = 6N = 9 (g1 N = 5, g2 N = 4)
Figure 4d–j and
Figure 1—figure supplement 1a middle, 1b middle
IF post hocPCR post hoc
Esr1 n = 15, N = 5Esr1 n = 10, N = 4
lacZ n = 14, N = 4lacZ n = 9, N = 3
uninfected n = 8, N = 4uninfected n = 4, N = 2
Figure 5a–dArc-AAV-lacZArc-AAV-Esr1g1Arc-AAV-Esr1g2
N = 6N = 4N = 4
Figure 5e–gArc-AAV-lacZArc-AAV-Esr1
N = 6N = 8 (g1 N = 4, g2 N = 4)
Figure 6a–cArc-AAV-lacZArc-AAV-Esr1
n = 11, N = 5n = 13, N = 5
Figure 6d–fArc-AAV-lacZArc-AAV- Esr1
n = 10, N = 5n = 12, N = 5
Figure 1—figure supplement 1a left, 1b rightKERKOAVPV-AAV-Esr1
n = 12, N = 5n = 25, N = 9
Figure 1—figure supplement 1c leftControlKERKO
Intact N = 6Intact n = 11, N = 7
OVX N = 6OVX n = 11, N = 6
OVX + E N = 5OVX + E n = 9, N = 7
Figure 1—figure supplement 1c middleAVPV-AAV-lacZAVPV-AAV-Esr1
N = 7N = 9
Figure 1—figure supplement 1c middleArc-AAV-lacZArc-AAV-Esr1
N = 5N = 5
Figure 4—figure supplement 1AVPV-AAV-lacZAVPV-AAV-Esr1
n = 16, N = 5n = 23, N = 5 (g1 N = 3, g2 N = 2)

Data availability

No new dataset is generated or used in the current study.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)