1. Biochemistry and Chemical Biology
  2. Structural Biology and Molecular Biophysics
Download icon

The Cas4-Cas1-Cas2 complex mediates precise prespacer processing during CRISPR adaptation

  1. Hayun Lee
  2. Yukti Dhingra
  3. Dipali G Sashital  Is a corresponding author
  1. Iowa State University, United States
Research Article
Cite this article as: eLife 2019;8:e44248 doi: 10.7554/eLife.44248
6 figures, 2 tables, 12 data sets and 1 additional file

Figures

Figure 1 with 2 supplements
Complex formation of B. halodurans Cas1-Cas2 or Cas4-Cas1-Cas2 in the presence of CRISPR hairpin target.

(A) Overview of the cas genes and CRISPR locus found in the Bacillus halodurans type I-C system. Spacers are shown as rectangles, repeats are shown as diamonds, each cas gene is shown as an arrow and gene products involved in adaptation or interference are indicated. The CRISPR hairpin target used for this study contains a 10 bp leader (L, green), the full 32 bp repeat (R, black), and a 5 bp spacer (S, purple). (B) Size-exclusion chromatography (SEC) of various combinations of Cas1, Cas2, Cas4 and target DNA. (C) Coomassie-blue stained SDS-PAGE gel of proteins present in the earliest eluting peak fractions of SEC following complex formation. (D) SYBR Gold stained 10% PAGE gel of DNA present in the earliest eluting peak fractions of SEC following complex formation. (E) Representative 2D class average of the Cas1-Cas2 complex. (F) Representative 2D class average of the Cas4-Cas1-Cas2 complex. Extra density corresponding to Cas4 is indicated by arrows.

https://doi.org/10.7554/eLife.44248.003
Figure 1—figure supplement 1
Analysis of Cas4-Cas1-Cas2 formation.

(A) Coomassie-blue stained SDS/PAGE gel of the fractions eluted from the size exclusion column when purifying the complex of Cas4-Cas1-Cas2 with the target DNA. The chromatogram is shown below to indicate where fractions eluted off the column.

https://doi.org/10.7554/eLife.44248.004
Figure 1—figure supplement 2
Formation of the Cas4-Cas1-Cas2 complex in the presence of prespacer DNA.

(A) Superdex 75 size exclusion chromatograms (SEC) for samples in which Cas4, Cas1 and Cas2 were incubated with either prespacer (24 bp duplex with 15-nt single-strand overhangs) or the CRISPR hairpin target (Figure 1A, gray solid line, the same trace is shown in Figure 1B). The prespacer alone was also run for reference, and the resulting chromatogram is shown as a dashed line. An additional peak observed in the Cas4 +Cas1+Cas2+prespacer chromatogram is due to excess DNA that was used during complex formation. (B) Coomassie-blue stained SDS-PAGE gel of proteins present in the earliest eluted peak fraction of Cas4+Cas1+Cas2+prespacer. (C) SYBR Gold stained 4–20% PAGE gel of DNA present in the peak fraction of Cas4+Cas1+Cas2+prespacer. The DNA lane is a prespacer sample prepared at the same concentration as the estimated amount of DNA in the peak fraction. The similarity in the two bands indicates that the expected concentration of DNA is present in the complex.

https://doi.org/10.7554/eLife.44248.005
Figure 2 with 6 supplements
Architecture of Cas1-Cas2 and Cas4-Cas1-Cas2 complexes formed in the presence of CRISPR hairpin target DNA.

(A) Segmented density for Cas1-Cas2 reconstruction. Two copies of a structural model of BhCas1 dimer (see Materials and methods) were fit in the two assigned Cas1 densities (blue, purple). The crystal structure of BhCas2 (PDB 4ES3) was used for fitting to density assigned to Cas2 (tan) (Nam et al., 2012). (B–C) Segmented density for (B) symmetrical and (C) asymmetrical reconstructions of Cas4-Cas1-Cas2. BhCas1 and BhCas2 structural models are fit to segments and colored as in (A). Two copies of a structural model of BhCas4 are fit into assigned Cas4 densities in (B) (orange, gold). One copy of BhCas4 structural model is fit into assigned Cas4 density in (C) (orange).

https://doi.org/10.7554/eLife.44248.006
Figure 2—figure supplement 1
Single particle EM analysis of Cas1-Cas2 and Cas4-Cas1-Cas2.

(A) Representative raw micrographs of Cas1-Cas2 and Cas4-Cas1-Cas (with CRISPR hairpin target or prespacer bound) samples. (B) Representative two-dimensional class averages of Cas1-Cas2 and Cas4-Cas1-Cas2 (with CRISPR hairpin target or prespacer bound) samples. Box size is ~152 × 152 Å. (C) Fourier shell correlation curves for Cas1-Cas2 (black), asymmetrical Cas4-Cas1-Cas2 (red) and symmetrical Cas4-Cas1-Cas2 (blue) bound to CRISPR hairpin target DNA. The resolution using an FSC cutoff of 0.5 is indicated for each structure. (D) Fourier shell correlation curves for asymmetrical Cas4-Cas1-Cas2 (red) and symmetrical Cas4-Cas1-Cas2 (blue) bound to prespacer DNA. The resolution using an FSC cutoff of 0.5 is indicated for each structure. (E) Angular distributions for the final reconstruction for each complex. Cas1-Cas2 and symmetrical Cas4-Cas1-Cas2 complexes were refined with C2 symmetry.

https://doi.org/10.7554/eLife.44248.007
Figure 2—figure supplement 2
Three-dimensional classification of Cas1-Cas2 and Cas4-Cas1-Cas2.

The initial model used for 3D classifications is shown at top. The number of particles in each class is shown above each reconstruction. (A) Three-dimensional classes for Cas1-Cas2-target complex. The top row shows the first round of classification into six classes using the initial model. Particles from the 3D classes in the dashed box were combined and refined (second row). The particles were then subjected to a second round of classification into three classes using the refined structure filtered to 60 Å resolution as the starting model (third row). The 3D class in the dashed box was further refined while enforcing C2 symmetry (bottom row). (B) Three-dimensional classes for Cas4-Cas1-Cas2-target complex. The top row shows the first round of classification into six classes using the initial model. Particles from the 3D classes in the dashed box were combined and refined (second row). The particles were then subjected to a second round of classification into four classes using the refined structure filtered to 60 Å resolution as the starting model (third row). The asymmetrical 3D class in the dashed box was further refined with C1 symmetry, while the symmetrical 3D classes in the dashed box were further refined while enforcing C2 symmetry (bottom row). (C) Three-dimensional classes for Cas4-Cas1-Cas2-prespacer complex. The top row shows the first round of classification into five classes using the initial model. Particles from the 3D classes in the dashed box were combined and refined (second row). The particles were then subjected to a second round of classification into three classes using the refined structure filtered to 60 Å resolution as the starting model (third row). The asymmetrical 3D class in the dashed box was further refined with C1 symmetry, while the symmetrical 3D class in the dashed box was further refined while enforcing C2 symmetry (bottom row).

https://doi.org/10.7554/eLife.44248.008
Figure 2—figure supplement 3
Modeling of Cas1-Cas2 structures.

(A) Structural model for B. halodurans Cas1 sequence and B. halodurans Cas2 X-ray crystal structure modelled into Cas1-Cas2 density using Fit in Segments package in UCSF Chimera (Pettersen et al., 2004; Pintilie et al., 2010). (B) X-ray crystal structure of E. faecalis Cas1-Cas2 fit to all segments (Xiao et al., 2017). (C) X-ray crystal structure of E. coli Cas1-Cas2 fit to all segments (Nuñez et al., 2015b). Two Cas1 dimers are in blue and purple, Cas2 is in tan.

https://doi.org/10.7554/eLife.44248.009
Figure 2—figure supplement 4
Modelling possible orientations of Cas4 within assigned density.

(A) Sequence alignment of P. calidifontis (Pc) and B. halodurans (Bh) Cas4 sequences. The sequence corresponding to the P. calidifontis N-terminal domain is highlighted in red. The sequence included in the predicted BhCas4 structural model is highlighted in blue (B) Crystal structure of PcCas4 (PDB 4R5Q, tan and red, [Lemak et al., 2014]) and structural model of BhCas4 (predicted using Phyre2 server [Kelley et al., 2015], blue). The N-terminal domain of PcCas4, which is not predicted to be present in BhCas4, is highlighted in red. The N- and C-termini of each model are labeled (Pc N-terminus is in red, Bh is in blue, both C-termini are in black). (C) Cartoon depicting four possible orientations of Cas4. Cas1 cartoon is in blue, Cas4 cartoon is in orange. H indicates Cas1 active site, K indicates Cas4 active site, and asterisk indicates Cas4 Fe2S2 cluster. The point-of-view with respect to the orientation shown in Figure 2 is depicted for the cartoon on the left. Cas4 rotates ~180° around either the z-axis or y-axis from one cartoon to the next, as depicted in the axes shown above Cas4. (D–E) Top four fits of Cas4 into segmented density from the (D) symmetrical Cas4-Cas1-Cas2-target complex and (E) asymmetrical Cas4-Cas1-Cas2-target complex. Fits reflect the possible orientations shown in cartoon within same column of (C). The Fe2S2 cluster and active site residues of Cas1 (H234) and Cas4 (K110) are indicated. The distance (Dist.) between alpha carbons of the two active site residues and cross-correlation value (Corr.) for each fit are indicated above each structural model.

https://doi.org/10.7554/eLife.44248.010
Figure 2—figure supplement 5
Model of Cas1-Cas2 full-site integration product fit in symmetrical Cas4-Cas1-Cas2-target reconstruction.

The protein subunits of the crystal structure of E. faecalis Cas1-Cas2 bound to full-site intermediate (PDB 5XVP) were docked in the reconstruction (Xiao et al., 2017). Proteins are colored as in Figure 2. The prespacer is shown as a red ladder, the CRISPR repeat is shown as a black ladder, and the repeat flanking regions are shown as gray ladders. The segmented Cas4 density is shown in mesh. The Cas4 density lies along the same surface of Cas1 where the CRISPR is bound in the crystal structure.

https://doi.org/10.7554/eLife.44248.011
Figure 2—figure supplement 6
Comparison of Cas4-Cas1-Cas2 complexes formed in the presence of CRISPR hairpin target or prespacer DNA.

All volumes were set to a contour level of 0.2 in UCSF Chimera. The highest-resolution EM density (target-bound symmetrical complex) has the best-defined features out of all four volumes.

https://doi.org/10.7554/eLife.44248.012
Figure 3 with 1 supplement
Single-stranded DNA processing by the Cas4-Cas1-Cas2 complex.

(A) Schematic of prespacer cleavage assay for (B). L indicates leader, R indicates repeat, S indicates spacer in the CRISPR DNA substrate. Radiolabel is indicated with a star. (B) Prespacer processing assay using ssDNA or duplex prespacer in the absence or presence of CRISPR DNA. Black arrow indicates the cleavage product. Red arrow indicates integration products following processing. (C) Schematic of cleavage assay using 25 nt single-stranded substrates provided in cis or in trans with a 25 bp duplex. (D) Cleavage assay using cis dsDNA or 25-nt ssDNA with titration of 25 bp duplex provided in trans.

https://doi.org/10.7554/eLife.44248.013
Figure 3—figure supplement 1
Integration of unprocessed and processed prespacers.

(A) Schematic of integration into the mini-CRISPR array. L – leader, R – repeat, S – spacer, P – processed prespacer following integration, U – unprocessed prespacer following integration. (B) Analysis of processing and integration products in the absence or presence of CRISPR DNA. The same gel is shown in Figure 3B. In this image, the contrast was increased to see the unprocessed integration products in the absence of Cas4.

https://doi.org/10.7554/eLife.44248.014
Figure 4 with 1 supplement
Cas4-Cas1-Cas2 processes directly upstream of PAM sites.

(A) Prespacer processing assay for ssDNA containing one PAM (GAA) site between T-rich sequences. (B) Prespacer processing assay for ssDNA containing three PAM sites with 2-nt intervals. (C) Prespacer processing assay with ssDNA containing three consecutive PAM sites. The first four lanes are Sanger sequencing reactions using the indicated ddNTP. The lane labeled DNA is a negative control reaction in which no proteins were added. Lanes labeled ‘Cas4’, ‘Cas1 + 2’ or ‘Cas4 + 1 + 2’ are reactions performed with the indicated proteins. Arrows indicate the predominant cleavage site.

https://doi.org/10.7554/eLife.44248.015
Figure 4—figure supplement 1
Cleavage of ssDNA with three PAMs.

(A) Schematic of ssDNA containing three PAM sites with 10, 8, 6, 4, 2, or 0-nt between the sites. (B) Cleavage assay with ssDNA substrates that have 10, 8, 6 or four nt between PAM sites. Sanger sequencing reaction lanes are labeled with the ddNTP used in the reaction. The lane labeled DNA is a negative control reaction in which no proteins were added. The ‘Cas4 + 1 + 2’ lane is a reaction containing all three proteins.

https://doi.org/10.7554/eLife.44248.016
Figure 5 with 1 supplement
Cleavage of ssDNA substrates with different PAM-flanking regions.

(A) Substrate with AT-rich sequences upstream and downstream of the PAM. (B) Substrate with T-rich sequence upstream and random sequence downstream of PAM. (C) Substrate with random sequence upstream and T-rich sequence downstream of PAM. (D) Substrate with random sequence upstream and downstream of PAM. The first four lanes are Sanger sequencing reactions using the indicated ddNTP. The lane labeled DNA is a negative control reaction in which no proteins were added. Lanes labeled ‘Cas4’, ‘Cas1 + 2’ or ‘Cas4 + 1 + 2’ are reactions performed with the indicated proteins. Arrow indicates predominant cleavage site.

https://doi.org/10.7554/eLife.44248.017
Figure 5—figure supplement 1
PAM-flanking sequence depletion assay.

(A) Schematic of processing assay. Red arrow indicates a primer used for primer extension assay and the orange arrows contain forward and reverse primers for PCR. (B) Prespacer processing assay using eight substrates containing between 1–4 degenerate nucleotides upstream or downstream of the PAM. Substrates are indicated by the numbers in the legend above the gel. (C) PCR products for DNA only, Cas1-Cas2 and Cas4-Cas1-Cas2. Substrates are indicated as numbers as in (B). (D–E) The fraction of counts for each degenerate sequence is plotted in the absence (x-axis) or presence (y-axis) of Cas4 for substrates with degenerate sequences (D) upstream or (E) downstream of the PAM. No significant differences were observed in the absence or presence of Cas4.

https://doi.org/10.7554/eLife.44248.018
Processing of duplex prespacers with varied PAM positions in single-strand overhangs.

(A) Panel of substrates used in processing experiments. The 5ʹ-GAA-3ʹ PAM begins after 2, 4, 6 or eight nt from the end of the duplex. Radiolabel is indicated with an orange star. (B) Polyacrylamide gel image showing cleavage of substrates shown in (A). A second set of +Cas4 reactions were loaded in the last four lanes on the right for ease of comparison of product sizes. (C) Quantitation of percent cleaved for substrates shown in (A). The average of three replicates is shown, with error bars representing standard deviation.

https://doi.org/10.7554/eLife.44248.019

Tables

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional
information
Strain, strain background (Escherichia coli)BL21 Star (DE3)Thermo Fisher ScientificC6010-03
Strain, strain background (Escherichia coli)BL21 (DE3)New England BiolabsC2527I
Recombinant DNA reagentpET52bEMD Millipore72554
Recombinant DNA reagentpET52b/ His6 Cas4Lee et al., 2018N/A
Recombinant DNA reagentpSV272/ His6-MBP-TEV Cas1Lee et al., 2018N/A
Recombinant DNA reagentpSV272/ His6-MBP-TEV Cas2Lee et al., 2018N/A
Recombinant DNA reagentpRKSUF017Takahashi and Tokumoto, 2002N/A
Commercial assay or kitQIAprep Spin Miniprep KitQiagen#27106
Commercial assay or kitWizard SV Gel and PCR Clean-up systemPromega#A9282
Commercial assay or kitWizard Plus SV minipreps DNA purification systemPromega#A1460
Commercial assay or kitHisPur Ni-NTA Spin columnsThermo Fisher Scientific#88224
Commercial assay or kitHisPur Ni-NTA resinThermo Fisher Scientific#88223
Commercial assay or kitHiTrap SP HPGE Healthcare#7115201
Commercial assay or kitHiTrap Heparin HPGE Healthcare#17-0407-03
Commercial assay or kitHiLoad 16/600 Superdex 200GE Healthcare#28989335
Commercial assay or kitHiLoad 16/600 Superdex 75GE Healthcare#28989333
Commercial assay or kitSequenase Version 2.0 DNA Sequencing KitThermo Fisher Scientific707701KT
Software, algorithmScipionde la Rosa-Trevín et al., 2016scipion.i2pc.es
Software, algorithmXmippAbrishami et al., 2013; Sorzano et al., 2013; Vargas et al., 2013xmipp.i2pc.es
Software, algorithmRELIONScheres, 2012mrc-lmb.cam.ac.uk/reli
Software, algorithmRELIONScheres, 2012on/index.php/Main_Page
Software, algorithmPhyre2Kelley et al., 2015sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id = index
Software, algorithmChimeraPettersen et al., 2004cgl.ucsf.edu/chimera/
Software, algorithmSeggerPintilie et al., 2010cryoem.bcm.edu/cryoem/downloads/segger
OtherFormvar/Carbon 400 mesh, Copper approx. grid hole size: 42 μmTed Pella, Inc.01754 F
OtherPyrobaculum calidifontis Cas4Lemak et al., 2014PDB: 4R5QDeposited data
OtherArchaeoglobus fulgidus Cas1Kim et al., 2013PDB: 4N06Deposited data
OtherBacillus halodurans Cas2Nam et al., 2012PDB: 4ES3Deposited data
OtherEscherichia coli Cas1-Cas2Nuñez et al., 2014PDB: 4P6IDeposited data
OtherEscherichia coli Cas1-Cas2-prespacerNuñez et al., 2015bPDB: 5DS4Deposited data
OtherEnterococcus
faecalis Cas1-Cas2-prespacer
Xiao et al., 2017PDB: 5XVNDeposited data
OtherEnterococcus
faecalis Cas1-Cas2-full site
Xiao et al., 2017PDB: 5XVPDeposited data
OtherBacillus halodurans Cas1-Cas2-targetThis paperEMDB-20127Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-target asymmetricalThis paperEMDB-20128Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-target symmetricalThis paperEMDB-20129Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-prespacer asymmetricalThis paperEMDB-20130Deposited data
OtherBacillus halodurans Cas4-Cas1-Cas2-prespacer symmetricalThis paperEMDB-20131Deposited data
Chemical compound, drugAgarAMRESCO#J637-1kg
Chemical compound, drugCarbenicillin disodium saltRPI#C46000-25.0
Chemical compound, drugKanamycin monosulfateRPI#K22000-25.0
Chemical compound, drugAmpicillinRPI#A40040-100.0
Chemical compound, drugTetracycline HClRPI#T17000-25.0
Chemical compound, drugLB Broth (Miller)Thermo Fisher Scientific#BP1426-2
Chemical compound, drugIPTGRPI#I56000-100.0
Chemical compound, drugDTTRPI#D11000-100.0
Chemical compound, drugTryptoneRPI#T60060-5000.0
Chemical compound, drugSodium chlorideAMRESCO#7647–14.5
Chemical compound,
drug
Yeast extractThermo Fisher Scientific#BP1422-2
Chemical compound, drugAgaroseThermo Fisher Scientific#BP160-500
Chemical compound, drugHEPESThermo Fisher Scientific#BP310-1
Chemical compound, drugSodium phosphate dibasic heptahydrateThermo Fisher Scientific#S373-3
Chemical compound, drugGlycerolVWR analytical BDH#BDH1172-4LP
Chemical compound, drugImidazoleThermo Fisher Scientific#O31960599
Chemical compound, drugPMSFRPI#P20270-25.0
Chemical compound, drugFerrous sulfateThermo Fisher Scientific#I146-500
Chemical compound, drugFerric sulfateSigma#F3388-250G
Chemical compound, drugL-Cysteine free baseMP Biomedicals#194646
Chemical compound, drugManganese chloride tetrahydrateThermo Fisher Scientific#M87-100
Chemical compound, drugPotassium chlorideRPI#D41000-2500.0
Chemical compound, drugBrilliant blue R-250RPI#B43000-50.0
Chemical compound, drug40% Acrylamide/Bis solution, 19:1Thermo Fisher Scientific#BP1406-1
Chemical compound, drugUreaRPI#U20200-25000.0
Chemical compound, drugBoric acidRPI#B32050-5000.0
Chemical compound, drugTrisRPI#T60040-5000.0
Chemical compound,
drug
EDTAThermo Fisher Scientific#BP120-1
Chemical compound, drug2X RNA loading dyeNew England Biolabs#B0363A
Chemical compound, drugT4 Polynucleotide KinaseNew England Biolabs#M0201L
Chemical compound, drug[γ-32P]-ATPPerkin Elmer#BLU502A250UC
Chemical compound,
drug
Phenol:Chloroform:Isoamyl Alcohol (25:24:1)Thermo Fisher Scientific#15593049
Table 1
Oligonucleotides used in this study.
https://doi.org/10.7554/eLife.44248.020
Sequence (5ʹ → 3ʹ)Description
GATTTTCGCTGTCGCACTCTTCATGGGTGCGTGGATTGAAAT
ATTGAcgatagTCAATATTTCAATCCACGCACCCATGAAGAGTGC
GACAGCGAAAATC
CRISPR hairpin target*
GATTTTCGCTGTCGCACTCTTCATGGGTGCGTGGATTGAAAT
ATTGAGGTAGGTATTG
Mini-CRISPR array
CAATACCTACCTCAATATTTCAATCCACGCACCC
ATGAAGAGTGCGACAGCGAAAATC
RC
CGTAGCTGAGGACCACCAGAACAG TTTTGAATTTTTTTT15-nt 3ʹ overhang prespacer, 4-nt between duplex and PAM††
CGTAGCTGAGGACCACCAGAACAG TTGAATTTTTTTTTT2-nt between duplex and PAM
CGTAGCTGAGGACCACCAGAACAG TTTTTTGAATTTTTT6-nt between duplex and PAM
CGTAGCTGAGGACCACCAGAACAG TTTTTTTTGAATTTT8-nt between duplex and PAM
CTGTTCTGGTGGTCCTCAGCTACG TTTTGAATTTTTTTTRC of previous four oligos
GATTTTCGCTGTCGCACTCTTCATGGGTGCGTGGATTGAAATATTGACRISPR DNA substrate
TCAATATTTCAATCCACGCACCCATGAAGAGTGCGACAGCGAAAATCRC
GCGTAGCTGAGGACCACCAGAACAGTTTTGAATTTTTTTTTTTTTTTTTT25-nt 3ʹ overhang prespacer
GCGTAGCTGAGGACCACCAGAACAG25 bp duplex
CTGTTCTGGTGGTCCTCAGCTACGCRC
GCGTAGCTGAGGACCTTTTTTTTTTTTTGAATTTTTTTTTTTTTTCAGGT CGACAAGCTTGT-rich ssDNA prespacer
CAAGCTTGTCGACCTGAAAAAAAAAAAAAATTCAAAAAAAAAAAAA
GGTCCTCAGCTACGC
RC
CTAGTATGATCATGTCCAACGAATCAATACCTACCTCAATGAACGGAT48 bp duplex
ATCCGTTCATTGAGGTAGGTATTGATTCGTTGGACATGATCATACTAGRC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTTTTTGAATTGAATTGAA
TTTTTTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed in 2-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAAAAAAAATTCAATTCAATTCA
AAAAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTTTTTTTGAAGAAGAATTTTT
TTTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites without spacing
TGTCGCAAGCTTGTCAAAAAAAAAAAAAAAAAAAATTCTTCTTCAAA
AAAAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTGAATTTTTTTTTTGAATTTT TTTTTTGAATTTTTTTTTTGACAAGCTTGCGACA3 PAM sites interspersed with 10-nt
TGTCGCAAGCTTGTCAAAAAAAAAATTCAAAAAAAAAATTCAAAAA
AAAAATTCAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTGAATTTTTTTTGAATTTTTTTT
GAATTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed with 8-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAATTCAAAAAAAATTCAAAAAAAA
TTCAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTGAATTTTTTGAATTTT
TTGAATTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed with 6-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAAAATTCAAAAAATTCAAAA
AATTCAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTTTTGAATTTTGAATTTTGAA
TTTTTTTTTTTTTTTTGACAAGCTTGCGACA
3 PAM sites interspersed with 4-nt
TGTCGCAAGCTTGTCAAAAAAAAAAAAAAAATTCAAAATTCAAAA
TTCAAAAAAAAAAAAAAAAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTATATATATATATGAATATATATATATATA CAGGTCGACAAGCTTGAT-rich ssDNA prespacer
CAAGCTTGTCGACCTGTATATATATATATATTCATATATATAT
ATAGGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTGGTATTCAACAGAATTTTTTTTTTTTTTCA
GGTCGACAAGCTTG
Non-T-rich upstream/T rich downstream ssDNA prespacer
CAAGCTTGTCGACCTGAAAAAAAAAAAAAATTCTGTTGAATACCAAG
GTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTTTTTTTTTTTTGAACTCGTATTCAACAG CAGGTCGACAAGCTTGT-rich upstream/non T-rich downstream ssDNA prespacer
CAAGCTTGTCGACCTGCTGTTGAATACGAGTTCAAAAAAAAAAAAA
GGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCTTGGTATTCAACAGAACTCGTATTC AACAGCAGGTCGACAAGCTTGNon-T-rich up- and downstream ssDNA prespacer
CAAGCTTGTCGACCTGCTGTTGAATACGAGTTCTGTTGAATACCAA
GGTCCTCAGCTACGC
RC
GCGTAGCTGAGGACCPrimer used for ddNTP Sanger sequencing
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTNNNNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNNN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCAGTTTTTNNNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCAGGTTTTTNNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCAGGCTTTTTNGAA TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGN on upstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAANNNN TTTTTGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNNN on downstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAANNNTTTTT CGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNNN on downstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAANN TTTTTCAGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTGNN on downstream region
GCGTAGCTGAGGACCCGTGGCACCGACATGGCATTTTTGAAN
TTTTTCATGCTGGGCGCTAAGGGACAACTCCAGGTCGACAAGCTTG
N on downstream region
CAAGCTTGTCGACCTGPrimer used for primer extension
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAAGCTTGTCGACCTGPrimer used for amplification-Forward
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCGTAGCTGAGGACCPrimer used for amplification-Reverse
  1. *For CRISPR oligonucleotides, leader is in italics, repeat is in bold, and spacer is in plain uppercase font. For hairpin, the loop region is in lowercase.

    RC = reverse complement of previous oligonucleotide.

  2. ††For cleavage substrates, PAM sequences are underlined.

Data availability

The negative-stain EM volumes for the Cas1-Cas2-target, asymmetrical Cas4-Cas1-Cas2-target, symmetrical Cas4-Cas1-Cas2-target, asymmetrical Cas4-Cas1-Cas2-prespacer and symmetrical Cas4-Cas1-Cas2-prespacer complexes have been deposited to EMDB under the accession numbers EMDB-20127, EMDB-20128, EMDB-20129, EMDB-20130 and EMDB-20131, respectively.

The following data sets were generated
  1. 1
    Electron Microscopy Data Bank
    1. H Lee
    2. Y Dhingra
    3. DG Sashital
    (2019)
    ID EMD-20127. Bacillus halodurans Cas1-Cas2-target.
  2. 2
    Electron Microscopy Data Bank
    1. H Lee
    2. Y Dhingra
    3. DG Sashital
    (2019)
    ID EMD-20128. Bacillus halodurans Cas4-Cas1-Cas2-target asymmetrical.
  3. 3
    Electron Microscopy Data Bank
    1. H Lee
    2. Y Dhingra
    3. DG Sashital
    (2019)
    ID EMD-20129. Bacillus halodurans Cas4-Cas1-Cas2-target symmetrical.
  4. 4
    Electron Microscopy Data Bank
    1. H Lee
    2. Y Dhingra
    3. DG Sashital
    (2019)
    ID EMD-20130. Bacillus halodurans Cas4-Cas1-Cas2-prespacer asymmetrical.
  5. 5
    Electron Microscopy Data Bank
    1. H Lee
    2. Y Dhingra
    3. DG Sashital
    (2019)
    ID EMD-20131. Bacillus halodurans Cas4-Cas1-Cas2-prespacer symmetrical.
The following previously published data sets were used
  1. 1
  2. 2
    Protein Data Bank
    1. TY Kim
    2. M Shin
    3. LHT Yen
    4. JS Kim
    (2013)
    ID 4N06. Crystal structure of Cas1 from Archaeoglobus fulgidus and its nucleolytic activity.
  3. 3
    Protein Data Bank
    1. A Ke
    2. KH Nam
    (2012)
    ID 4ES3. Double-stranded Endonuclease Activity in B. halodurans Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Cas2 Protein.
  4. 4
    Protein Data Bank
    1. JK Nunez
    2. PJ Kranzusch
    (2014)
    ID 4P6I. Crystal structure of the Cas1-Cas2 complex from Escherichia coli.
  5. 5
    Protein Data Bank
    1. JK Nunez
    2. LB Harrington
    3. PJ Kranzusch
    4. AN Engelman
    5. JA Doudna
    (2015)
    ID 5DS4. Crystal structure the Escherichia coli Cas1-Cas2 complex bound to protospacer DNA.
  6. 6
    Protein Data Bank
    1. Y Xiao
    2. S Ng
    3. KH Nam
    (2017)
    ID 5XVN. E. far Cas1-Cas2/prespacer binary complex.
  7. 7
    Protein Data Bank
    1. Y Xiao
    2. S Ng
    3. KH Nam
    (2017)
    ID 5XVP. E. fae Cas1-Cas2/prespacer/target ternary complex revealing the fully integrated states.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)