1. Neuroscience

Conditional deletion of glucocorticoid receptors in rat brain results in sex-specific deficits in fear and coping behaviors

  1. Jessie R Scheimann
  2. Rachel D Moloney  Is a corresponding author
  3. Parinaz Mahbod
  4. Rachel L Morano
  5. Maureen Fitzgerald
  6. Olivia Hoskins
  7. Benjamin A Packard
  8. Evelin M Cotella
  9. Yueh-Chiang Hu
  10. James P Herman  Is a corresponding author
  1. University of Cincinnati, United States
  2. Cincinnati Children’s Hospital Medical Center, United States
  3. University of Cincinnati College of Medicine, United States
  4. Cincinnati Children's Hospital Medical Center, United States
https://doi.org/10.7554/eLife.44672
Share this article
Cite this article
  1. Jessie R Scheimann
  2. Rachel D Moloney
  3. Parinaz Mahbod
  4. Rachel L Morano
  5. Maureen Fitzgerald
  6. Olivia Hoskins
  7. Benjamin A Packard
  8. Evelin M Cotella
  9. Yueh-Chiang Hu
  10. James P Herman
(2019)
Conditional deletion of glucocorticoid receptors in rat brain results in sex-specific deficits in fear and coping behaviors
eLife 8:e44672.
https://doi.org/10.7554/eLife.44672
  2. Download BibTeX
  3. Download .RIS
8 figures, 3 tables and 2 additional files

Figures

Figure 1
Download asset Open asset
Generation of Nr3c1 conditional knockdown rat.

(A) Schematic illustration of the targeting strategy. Two LoxP sequences flanking exon three were inserted via CRISPR/Cas9-mediated deletion by two sgRNAs, followed by homology-directed repair with a donor plasmid. The CRISPR reagents were injected into the cytoplasm of rat zygotes, followed by embryo transfer into surrogate mothers for fetal development and birth. Correctly targeted rats were bred to homozygosity. Deletion of exon three is achieved by recombination of two LoxP sequences upon the exposure of Cre recombinase. (B) The donor plasmid contains two LoxP sequences flanking exon 3, restriction enzyme sites, and two homologous arms. The LoxP sequence is located at the sgRNA cut site (three nucleotides prior to the PAM) to block re-cutting. (C) Primers used to confirm the correctly targeted events are listed in the boxes. (D) Primers P5 and P8 are external to homologous arms. (E–G) Sample PCR results are shown.

https://doi.org/10.7554/eLife.44672.002
Figure 2
Download asset Open asset
Viral validation of conditional glucocorticoid receptor (GR) knockdown rat.

(A) AAV8-hSyn-Cre administration to the basolateral amygdala (BLA) in SD:nr3c1fl/fl rats (panel A1- site of injection, 4X). Note the absence of GR (purple) in Cre+ neurons (green) (panels A2-4, 40x, yellow triangles). (B) AAV8-hSyn-Cre administration to the BLA in SD:nr3c1wt rats (panel B1- site of injection, 4X). Note the presence of GR (purple) in Cre+ neurons (green) (panels B2-4, 40x, white triangles). (C) AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40 (CaMKIIα Cre) injected into SD:nr3c1f/f rats results in decreased GR (C4 yellow arrows) in cells infected with virus as shown by GFP labeling (C2 yellow arrows) that are also CaMKIIα positive (C3 yellow arrows). CaMKIIα cells not infected with GFP, show endogenous GR expression (C1-4 white arrows). (D) CaMKIIα Cre injected into SD:nr3c1wt rats (panel C2-4 40x white arrows) shows endogenous GR staining (D4) in cells infected with virus shown in GFP (D2) and CaMKIIα positive (D3). (E) AAVrg-pmSyn1-EBFP-Cre administration to the BLA in SD:nr3c1fl/fl rats (panel E-1 site of injection, 4X) and retrograde trafficking of the virus to cell somas in the prefrontal cortex (PFC) (panel E2-4). Note absence of GR expression (purple) in Cre+ neurons (green) (panel E5-7, 20x, yellow triangles). (F) AAVrg-CAG-GFP administration to the BLA in SD:nr3c1fl/fl rats (panel F1- site of injection, 4X) and retrograde trafficking of the virus to cell somas in the PFC (panel F2-4, 10X). Note expression of GR (purple) in GFP+ neurons (green) (panel F5-7, 20x, white triangles).

https://doi.org/10.7554/eLife.44672.003
Figure 3
Download asset Open asset
Verification of glucocorticoid receptor (GR) knockdown in the prelimbic division of the prefrontal cortex (PL-PFC).

(A) Female SD:nr3c1fl/fl rats injected with AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40 show reduced GR expression in virus infected neurons (GFP+) compared to controls (****p<0.0001, unpaired t-test, GRKD = SD:nr3c1fl/fl plus CaMKIIα Cre, n = 5; Control = SD:nr3c1wt plus CaMKIIα Cre, n = 10). (B) Male SD:nr3c1fl/fl rats injected with AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40 show reduced GR expression in virus infected neurons (GFP+) compared to controls (****p<0.0001, unpaired t-test, GRKD = SD:nr3c1fl/fl plus CaMKIIα Cre, n = 6; Control = SD:nr3c1wt plus CaMKIIα Cre, n = 9). (C) Representative image of GR expression in GFP+ neurons in the area of infection (PL-PFC) in a SD:nr3c1wt rat. Green = viral infected neurons, Red = GR, yellow = GFP cell outline. (D) Representative image of GR knockdown in GFP+ neurons in the area of infection (PL-PFC) in a SD:nr3c1fl/fl rat injected with AAV9.CamKII.HI.eGFP-Cre.WPRE.SV40. Green = viral infected neurons, Red = GR, yellow = GFP cell outline. (E) Representative image of CaMKIIα injection site and area of infection in the PL-PFC. Red = Cre recombinase protein.

https://doi.org/10.7554/eLife.44672.004
Figure 4
Download asset Open asset
Behavioral profile of glucocorticoid receptor (GR) knockdown in CaMKIIα cells in the prelimbic division of the prefrontal cortex (PL-PFC).

(A) Female rats with PL-PFC CaMKIIα GRKD showed heightened freezing to tone shock pairings compared to controls, as well as deficits in fear extinction, and heightened freezing during extinction retrieval indicating an inability to extinguish conditioned fear (*=p < 0.05 with Bonferroni posthoc). (B) Male rats with PL-PFC CaMKIIα GRKD did not differ from controls during auditory fear conditioning. (C–D) Male rats with CaMKIIα GRKD in the PL-PFC did not show differences from controls in immobility on either day in the forced swim test, (E–F), but PL-PFC CaMKIIα GRKD male rats did show a greater number of dives on both days suggesting a more active coping behavior (*=p < 0.05 Student's two-tailed T-test). (G–J) Female rats with PL-PFC CaMKIIα GRKD did not show differences from controls in the forced swim test. (K) Females with PL-PFC CaMKIIα GRKD show a significant GRKD x time interaction in corticosterone after acute restraint as well as higher corticosterone at the 120 min time point (p=0.050 with Bonferroni posthoc). (L) Male rats with PL-PFC CaMKIIα GR knockdown do not show differences from control in corticosterone release to acute restraint. (GRKD = SD:nr3c1fl/fl plus AAV CaMKIIα Cre, n = 5–6 male and female; Control = SD:nr3c1wt plus AAV CaMKIIα Cre, n = 10 male and female).

https://doi.org/10.7554/eLife.44672.005
Appendix 1—figure 1
Download asset Open asset
Validation of sgRNA editing activity by the T7E1 assay in rat C6 glioma cells, compared side-by-side with ApoE sgRNA that was previously shown to work efficiently in rat zygotes.

Data presented as relative fold change between the percentage of cut band intensity over total band intensity induced by the individual sgRNAs and that of the control ApoE sgRNA.

https://doi.org/10.7554/eLife.44672.010
Appendix 1—figure 2
Download asset Open asset
Screen for random integration of the donor plasmid in homozygous Nr3c1 floxed rats.

(A) SYBR Green-based qPCR was used to determine the copy number of the transgene in rats. Three regions of the integrated area were chosen for the analysis (Set A, Set B, and Set C). A region outside of the integrated area was used as an internal reference (Set D). Data presented as relative copy number of each region between the SD:nr3c1wt (WT) and SD:nr3c1fl/fl (f/f) samples. The delta Ct value of the WT sample as set as two copies per genome. (B) PCR amplifying two distant regions of the donor plasmid backbone was performed to detect the random integration event. A limited amount of the donor plasmid DNA was spiked into the WT genomic DNA as positive control.

https://doi.org/10.7554/eLife.44672.012
Appendix 1—figure 3
Download asset Open asset
SD:nr3c1fl/fl (f/f) rats did not show behavioral differences from SD:nr3c1wt (wt) controls in common behavioral assays.

Male (A) and female (B) f/f and wt controls spent equal time in the open arms of the elevated plus maze. Males (C) and females (D) showed no differences in time spent in the center of the open field. No locomotor phenotype was observed in male (E) and female (F) f/f rats compared to wt controls in the open field. There were no differences in immobility in the forced swim test for male (G) or female (H) f/f rats compared to controls.

https://doi.org/10.7554/eLife.44672.013
Appendix 1—figure 4
Download asset Open asset
SD:nr3c1fl/fl (f/f) rats did not differ in bodyweight compared to SD:nr3c1wt (wt) controls.

Male (A) and female (B) fl/fl and wt rats did not differ in weight at weening (w) or over the course of the experiment.

https://doi.org/10.7554/eLife.44672.014

Tables

Appendix 1—table 1
List of sgRNA chosen to target exon 3 of the Nr3c1 gene (glucocorticoid receptor) for insertion of LoxP sites.
https://doi.org/10.7554/eLife.44672.009
Target locationIDsgRNA target sequence
5' to exon 3sg-1TAAGGTGAACAGTAAACTAC
sg-2GGAAGGGAAAGGTCTAT
sg-3GTCATTTGATAGCATGGCA
3' to exon 3sg-4GAGCAGCTTTATTTTGGA
sg-5GATTTGCTGTGAGATCAATC
sg-6GATCCAAAGGAAACTGT
controlApoE sgRNAGGTAATCCCAGAAGCGGTTC
Appendix 1—table 2
List of off-target sequences used to identify the off-target events.
https://doi.org/10.7554/eLife.44672.011
Off-target sequences
OT5' guide sequenceoff-target sequenceLocationStrandLocus descriptionMismatch found
OT-1TCTGGAAGGGAAAGGTCTAT AGGTTGAGAACGGAAAGGTCTAT GGGchr19:18822843–18822865-intergenic:AABR07043040.1-AABR07043071.10
OT-2TCTGGAAGGGAAAGGTCTAT AGGTTGAGAACGGAAAGGTCTAT GGGchr19:18815538–18815560-intergenic:AABR07043039.1-AABR07043040.10
OT-3TCTGGAAGGGAAAGGTCTAT AGGGTAAGAAGGGAAAGGTCTAT GGGchr7:13815358–13815380+intergenic:Slc1a6-Cyp4f370
OT-4TCTGGAAGGGAAAGGTCTAT AGGTATGCAGAGGAAAGGTCTAT TGGchr3:171628668–171628690+intergenic:LOC689618-Rab22a0
OT-5TCTGGAAGGGAAAGGTCTAT AGGTAAGCAAGTGAAAGGTCTAT AGGchr4:25084248–25084270+intergenic:U1-Steap10
OT-6TCTGGAAGGGAAAGGTCTAT AGGGCAGTAAGGGGAAGGTCTAT GGGchr6:38673626–38673648+intron:Nbas0
OT-7TCTGGAAGGGAAAGGTCTAT AGGACAGGAAGGATAAGGTCTAT TGGchr15:91803840–91803862+intergenic:AABR07019155.1-AABR07019162.10
3' guide sequenceoff-target sequenceLocationstrandlocus descriptionmismatch found
OT-8AGAGATCCAAAGGAAACTGT GGGAATTCTCCAAAGGAAACTGT GGGchr14: 46180580–46180602-intergenic:Nwd2-AABR07015040.10
OT-9AGAGATCCAAAGGAAACTGT GGGGGAAATGCACAGGAAACTGT GGGchr13:47968158–47968180-intron:Rassf50
OT-10AGAGATCCAAAGGAAACTGT GGGACACAGCGAAAGGAAACTGT GGGchr7:101131361–101131383-intron:LOC5008770
OT-11AGAGATCCAAAGGAAACTGT GGGATGAATCCTAAGGAAACTGT AGGchr2:189985378–189985400-intergenic:U1/S100a3-S100a30
OT-12AGAGATCCAAAGGAAACTGT GGGTGAGCTCCTGAGGAAACTGT AGGchr11:75363850–75363872+intergenic:Hrasls-Mb21d20
Appendix 1—table 3
Hearts, thymi, and adrenal weights did not differ in fl/fl vs. wt controls.
https://doi.org/10.7554/eLife.44672.015
MalesOrganWt weight (mg)St errorF/f Weight (g)St errorT-testP value
Heart1284.76237.3181272.99021.168T(20) = 0.286p=0.778
Thymus302.54615.669272.88016.244T(20) = 1.299p=0.209
Adrenals Averaged28.1880.56529.0501.266T(20) = −0.581p=0.568
FemalesOrganwt Weight (mg)St Errorf/f Weight (g)St ErrorT-testP value
Heart805.40860.710835.46716.912T(19) = −0.417p=0.681
Thymus211.38313.307230.7339.894T(19) = −1.097p=0.287
Adrenals Averaged45.1002.11342.6331.007T(19) = 0.947p=0.355

Additional files

Supplementary file 1

List of primers used to identify the off-target events.

https://doi.org/10.7554/eLife.44672.006
Transparent reporting form
https://doi.org/10.7554/eLife.44672.007

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Jessie R Scheimann
  2. Rachel D Moloney
  3. Parinaz Mahbod
  4. Rachel L Morano
  5. Maureen Fitzgerald
  6. Olivia Hoskins
  7. Benjamin A Packard
  8. Evelin M Cotella
  9. Yueh-Chiang Hu
  10. James P Herman
(2019)
Conditional deletion of glucocorticoid receptors in rat brain results in sex-specific deficits in fear and coping behaviors
eLife 8:e44672.
https://doi.org/10.7554/eLife.44672