Cell non-autonomous functions of S100a4 drive fibrotic tendon healing
- University of Rochester Medical Center, United States
Figures
Figure 1 with 1 supplement
S100a4 is expressed by resident tenocytes and the S100a4+cell population expands during tendon healing.
(A and B) S100a4-Cre; Rosa-Ai9 reporter mice demonstrate efficient targeting of resident tendon cells. Following injury, the S100a4-lineage (S100a4Lin+) population expands, with S100a4Lin+ cells in the native tendon stubs and the bridging scar tissue at D7 and D14 post-surgery. Tendons are outlined in white, and bridging granulation tissue outlined in blue. (C) Quantification of S100a4Lin+ area over time. (*) indicates p<0.05 (1-way ANOVA). (D) The S100a4-GFPpromoter construct identifies cells actively expressing S100a4 (S100a4-GFPpromoter+). (E) A subpopulation of resident tenocytes is S100a4-GFPpromoter+ at baseline, and the S100a4-GFPpromoter+ population increases following injury, with S100a4-GFPpromoter+ cells observed in the bridging scar tissue and native tendon ends through D28 post-surgery. Tendons are outlined in white, and bridging granulation tissue outlined in orange, (*) identifies sutures. (F) Quantification of the S100a4-GFPpromoter+ area over time. (*) indicates p<0.05 (1-way ANOVA). (G) qPCR analysis of S100a4 during tendon healing demonstrates peak S100a4 expression at D10, followed by a progressive decline through D28 (n = 3 per time-point). (*) indicates p<0.05 vs. D3 repair (1-way ANOVA). Data were normalized to expression in D3 repairs, and the internal control β-actin.
Figure 1—figure supplement 1
S100a4+cells are found in the healthy and healing Achilles tendon.
S100a4-GFPPromoter+ cells are observed in the native Achilles tendon, and a S100a4+ population persists following complete transection and repair of the Achilles tendon at D14 post-surgery.
Figure 2 with 2 supplements
S100a4 haploinsufficiency promotes regenerative, mechanically superior tendon healing.
(A) S100a4GFP/+ haploinsufficient and wild type (WT) littermates underwent transection and repair of the FDL tendon, and tendons were harvested at D14 post-surgery. (B) S100a4 mRNA expression was reduced by 50% in S100a4GFP/+ tendon repairs, relative to WT (n = 3 per group). (C) A substantial reduction in S100a4 protein expression was observed in S100a4GFP/+ tendon repairs, relative to WT. Tendon ends are outlined in blue and bridging scar tissue outlined in black (n = 3–4 per group). (D–G) At D14, MTP Flexion Angle was significantly increased in S100a4GFP/+ repairs (D), and Gliding Resistance was significantly decreased in S100a4GFP/+ repairs (E). Max load at failure was significantly improved in S100a4GFP/+ repairs (F), while no change in Stiffness was observed between genotypes (G) (n = 7–10 per group). (*) indicates p<0.05, (**) indicates p<0.01 between genotypes, n = 7–10 for (D–G) (un-paired t-test).
Figure 2—figure supplement 1
S100a4 haploinsufficiency does not alter gliding function or mechanical properties of un-injured tendons.
No changes in (A) MTP Flexion Angle, (B) Gliding Resistance, (C) Max load at failure, or (D) Stiffness were observed between WT and S100a4GFP/+ un-injured contralateral control FDL tendons. n = 11–13, (un-paired t-test).
Figure 2—figure supplement 2
S100a4GFP/+mice permit tracing of S100a4 haploinsufficient cells.
To determine if S100a4 haploinsufficiency altered the S100a4+ population during healing, fluorescent imaging of uninjured and D14 repairs from S100a4GFP/+ and S100a4+/+ (WT) mice were analyzed. No GFP expression was observed in S100a4+/+ WT mice either at baseline or at D14 post-surgery. In contrast, knock-down of S100a4 does not alter the S100a4GFP+ resident tendon cell population, or the expansion of the S100a4GFP+ population at D14 post-surgery. Orange insets identify high-power magnification images.
Figure 3
S100a4 haploinsufficiency enhances deposition of a mature Collagen matrix and reduced myofibroblast content.
(A) ABH/OG and picrosirius red staining demonstrate an increase in mature collagen fibers (blue arrows) bridging the tendon ends in S100a4GFP/+ repairs compared to WT littermates (n = 3–4 per group) (*) indicate sutures. (B–D) S100A4GFP/+ tendons expressed significantly more Col1a1 mRNA (B), while transcript levels of Col3a1 (C) and Scx (D) were unaffected by S100a4 haploinsufficiency. (*) indicates p<0.05 (un-paired t-test), n = 3 per group. (E and F) α-SMA mRNA expression was significantly decreased in S100a4GFP/+ repairs (E) (n = 3 per group), while a substantial reduction in α-SMA protein expression was observed in S100a4GFP/+, relative to WT, using immunofluorescence (F). White arrows indicate areas of α-SMA+ cells in the healing tissue, yellow arrowheads denote α-SMA staining of vessels, blue boxes indicate location of higher magnification images.
Figure 4 with 3 supplements
S100a4 haploinsufficiency alters the macrophage response to tendon injury.
(A) F4/80 staining demonstrates decreased macrophage content in the healing tendon of S100a4GFP/+ repairs at D14. White arrows identify concentrated areas of macrophages. (B) Expression of the M1 macrophage marker iNOS is markedly reduced in S100a4GFP/+ repairs at D14. (C) Expression of the M2 macrophage marker IL1ra is not different between WT and S100a4GFP/+ repairs at D14. Tendon ends are outlined in white, scar tissue is outlined in yellow, blue boxes indicate location of higher magnification images (n = 4 per group). (D) The percent area of F4/80+, iNOS+ and IL1ra+ staining, normalized to tissue area was quantified (n = 4) (un-paired t-test).
Figure 4—figure supplement 1
S100a4 is expressed by macrophages during early tendon healing.
To identify S100a4+ macrophages, Csf1r-iCre; Rosa-Ai9; S100a4-GFPpromoter+ mice were induced with tamoxifen. Tmx was given on D0-2 for mice harvested on D3, and D0-2 and every 48 hr thereafter until harvest for samples harvested at D14. On D3 several macrophages actively express S100a4 (white arrows). By D14 the presence of Csfr1Lin+ cells increased, but very few cells actively expressed S100a4 (white arrows).
Figure 4—figure supplement 2
S100a4 promotes macrophage migration and alters polarization.
(A) S100a4 promotes migration of C57BL/6J bone marrow derived macrophages (BMDMs). (****) Indicates p<0.0001 vs. vehicle treated cells (1-way ANOVA). (B) No change in migration was observed in vehicle treated WT and S100a4GFP/+ BMDMs, while significant increases in migration were observed in WT and S100a4GFP/+ BMDM treated with 50 ng/mL and 1000 ng/mL S100a4-RP. (*) indicates p<0.05, (**) indicates p<0.01 vs. genotype-matched vehicle treated cells (2-way ANOVA). (C and D) Following treatment with S100a4-RP (20–1000 ng/mL), significant increases in M1 polarization markers (iNos, CD64) were observed relative to vehicle treated C57BL/6J BMDMs, as was a significant decrease in TNFα, and no change in CD86 expression (C). Significant increases in M2 markers Arg2 and IL1ra were seen with S100a4-RP treatment, while a decrease in CD163 expression, and no change in CD206 was also observed in C57BL/6J BMDMs (D). (*) indicates p<0.05 between vehicle and S100a4-RP treatment (1-way ANOVA). (E and F) Expression of M1 (E) and M2 (F) macrophage markers were not significantly different between WT and S100a4GFP/+ BMDMs in vehicle treated or upon treatment with 1000 ng/mL S100a4-RP. (*) indicates p<0.05 vs. genotype-matched vehicle treated cells (2-way ANOVA). (n = 3 per treatment).
Figure 4—figure supplement 3
Tendon cell S100a4 haploinsufficiency does not alter tenogenic and matrix gene expression or proliferation but enhances migration.
(A) qPCR analysis primary tendon cells from WT and S100a4GFP/+ mice. Expression of S100a4 is significantly reduced (~50%) in S100a4GFP/+ tendon cells, relative to WT. No changes in tenogenic genes Scx, Tnmd and Mkx. (*) indicates p<0.05 vs. expression in WT cells. (B) No changes in expression of matrix genes Col1a1, Col3a1 or Fn are observed between WT and S100a4GFP/+ tendon cells. Data are normalized to WT expression and β-actin. (un-paired t-test). (C) No changes in proliferation were observed between WT and S100a4GFP/+ tendon cells (2-way ANOVA). (D). Cell migration was assessed by measuring closure of a scratch wound. Data are plotted as % of initial scratch area. Closure was significantly increased in S100a4GFP/+ tendon cells at 24 hr (2-way ANOVA).
Figure 5
Inhibition of S100a4 signaling via RAGE antagonism improves tendon healing.
(A) Co-immunofluorescence demonstrated co-localization of S100a4 and its putative receptor RAGE in the healing tendon (n = 3). (B) C57Bl/6J mice were treated with either RAP or vehicle, via i.p. injection from D5-10 post-surgery, and harvested at D14 for functional testing. (C–F) At D14 RAP treatment significantly improved measures of gliding function relative to vehicle, with a (C) significant increase in MTP Flexion Angle, and (D) a significant decrease in Gliding Resistance. No change in (E) Max load at failure, or (F) Stiffness was observed between treatments (n = 13 per group). (**) indicates p<0.01 between treatments (un-paired t-test).
Figure 6 with 3 supplements
Delayed depletion of S100a4+cells impairs restoration of mechanical properties and alters matrix deposition.
(A) WT and S100a4-TK mice were treated twice daily with ganciclovir (GCV) from D5-10 post-surgery. (B) S100a4+ cell depletion results in a 91% reduction in S100a4 mRNA at D10 post-surgery (n = 3). (C) A substantial reduction in S100a4 protein expression was observed S100a4-TK repairs, relative to WT. Tendon is outlined in blue, scar tissue is outlined in black and (*) identify sutures (n = 4). (D–G) At D14 no change in MTP Flexion Angle (D) and Gliding Resistance (E) were observed between WT and S100a4-TK repairs. (F) Max load at failure was significantly reduced following S100a4-cell depletion, while no change in Stiffness was observed (G) (n = 7–10), (**) indicates p<0.01 (un-paired t-test). (H and I) Morphologically, (H) ABH/OG and (I) Picrosirius staining demonstrate reduced matrix deposition bridging the tendon ends in the S100a4-TK repairs, relative to WT. (*) Indicates sutures.
Figure 6—figure supplement 1
S100a4+cell depletion alters expression of matrix, tenogenic and myofibroblast-associated genes.
qPCR analyses demonstrated significant increases in (A) Col1a1, and (B) Col3a1 expression, while (C) Scx and (D) α-SMA expression levels were significantly reduced in S100a4-TK, relative to WT. Data were normalized to expression in WT samples and the internal control β-actin. (*) Indicates p<0.05, (***) indicates p<0.001, (n = 3 per group) (un-paired t-test).
Figure 6—figure supplement 2
S100a4+cell depletion reduces α-SMA+myofibroblast content during healing.
At D14 post-surgery, abundant α-SMA+ myofibroblasts (red) were observed in WT repairs. In contrast, α-SMA+ myofibroblast content was markedly reduced in S100a4-TK (D5-10) repairs. White arrows indicate areas of α-SMA+ cells in the healing tissue, while yellow arrowheads denote α-SMA staining of vessels. Tendons are outlined in white and scar tissue outlined in red.
Figure 6—figure supplement 3
S100a4+cell depletion reduces macrophage content during healing.
At D14 post-surgery abundant F4/80+ macrophages (red) were observed in WT repairs. In contrast, F4/80+ macrophage content was markedly reduced in S100a4-TK (D5-10) repairs. White arrows identify concentrated areas of macrophages. Tendon ends are outlined in white, while scar tissue is outlined in red. (*) indicates sutures.
Figure 7
Sustained ablation of S100a4+impairs restoration of gliding function and mechanical properties.
(A) WT and S100a4-TK mice were treated with GCV from D1-14 post-surgery to ablate proliferating S100a4+ cells. At D14 (B) MTP Flexion Angle was significantly reduced, and (C) Gliding Resistance was significantly increased in S100a4-TK repairs, relative to WT. (D) A non-significant decrease in Max load at failure and (E) a significant reduction in Stiffness were observed in S100a4-TK repairs (n = 8–11). (*) indicates p<0.05, (**) indicates p<0.01 (un-paired t-test).
Figure 8
S100a4-lineage cells lose S100a4 expression during the transition to α-SMA+myofibroblasts.
(A) Co-localization of Red Fluorescent Protein (S100a4Lin+ cells; red) and the myofibroblast marker α-SMA (white) demonstrated abundant co-localization (yellow arrows) during tendon healing. (B) Minimal co-localization of α-SMA (white) and cells actively expressing S100a4 (S100a4-GFPpromoter+; green) was observed during healing (n = 3). (C) Quantification of the percent α-SMA+ area that is also S100a4Lin+ (red and white bar) or S100a4-GFPpromoter+ (green and white bar) at D14 (n = 3–4 per group) (**) indicates p<0.01 between groups (un-paired t-test). (D) Schematic representation of the proposed cell non-autonomous signaling functions of S100a4 in fibrotic healing, as well as cell fate of S100a4-lineage cells. The identities and discrete functions of specific populations of S100a4+ cells remains to be determined.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus. musculus) | B6.Cg-Tg(S100a4-EGFP)M1Egn/YunkJ (S100A4-GFPpromoter) | Jackson Laboratory | Stock #: 012893 RRID: MGI:4819362 | |
| Genetic reagent (M. musculus) | B6.Cg-Tg(S100a4-TK)M31Egn/YunkJ (S100a4-TK) | Jackson Laboratory | Stock #: 012902 RRID:MGI:4454768 | |
| Genetic reagent (M. musculus) | B6.129S6-S100a4tm1Egn/YunkJ (S100a4GFP/+) | Jackson Laboratory | Stock #: 012904 RRID:MGI:4819358 | |
| Genetic reagent (M. musculus) | BALB/c-Tg(S100a4-cre)1Egn/YunkJ (S100a4-Cre) | Jackson Laboratory | Stock #: 012641 RRID:MGI:4454332 | |
| Genetic reagent (M. musculus) | B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (ROSA-Ai9) | Jackson Laboratory | Stock #: 007909 RRID:MGI:3809523 | |
| Genetic reagent (M. musculus) | Tg(Csf1r-Mer-iCre-Mer)1Jwp (Csf1r-iCre) | Jackson Laboratory | Stock #: 019098 RRID:IMSR_JAX:019098 | |
| Genetic reagent (M. musculus) | C57BL/6J | Jackson Laboratory | Stock #: 000664 RRID:MGI:3028467 | |
| Antibody | anti-RAGE (mouse monoclonal) | Santa Cruz Biotechnology | Cat. #: sc-365154 RRID:AB_10707685 | 1:100 |
| Antibody | anti-F4/80 (goat polyclonal) | Santa Cruz Biotechnology | Cat. #: sc-26642 RRID:AB_2098333 | 1:500 |
| Antibody | anti-GFP (goat polyclonal) | Abcam | Cat. #: ab6673 RRID:AB_305643 | 1:5000 |
| Antibody | anti-RFP (rabbit polyclonal) | Abcam | Cat. #: ab62341 RRID:AB_945213 | 1:500 |
| Antibody | anti-S100a4 (rabbit monoclonal) | Abcam | Cat. #: ab197896 RRID:AB_2728774 | 1:20000 |
| Antibody | anti-iNOS (rabbit polyclonal) | Abcam | Cat. #: ab15323 RRID: AB_301857 | 1:100 |
| Antibody | Anti-ILIRa (rabbit monoclonal) | Abcam | Cat. #: ab124962 RRID:AB_11130394 | 1:10000 |
| Antibody | anti-alpha-SMA-Cy3 (mouse monoclonal) | Sigma-Aldrich | Cat. #: C6198 RRID: AB_476856 | 1:250 |
| Antibody | Donkey anti-rabbit AlexaFluor594 secondary | Jackson ImmunoResearch | Cat. #: 711-585-152 RRID: AB_2340621 | 1:200 |
| Antibody | Donkey anti-rabbit 647 secondary | Jackson ImmunoResearch | Cat. #: 711-605-152 RRID: AB_2492288 | 1:200 |
| Antibody | Donkey anti-rabbit Rhodamine-Red-X | Jackson ImmunoResearch | Cat. #: 711-296-152 RRID:AB_2340614 | 1:100 |
| Antibody | Donkey anti-goat 488 secondary | Jackson ImmunoResearch | Cat. #: 705-546-147 RRID: AB_2340430 | 1:200 |
| Antibody | Goat anti-mouse AlexaFluor488 secondary | ThermoFisher | Cat. #: A11029 RRID:AB_138404 | 1:1000 |
| Chemical compound, drug | Nucleoside analog ganciclovir (GCV) | TSZCHEM | Cat #: 82410-32-0 | 75 mg/kg |
| Peptide, recombinant protein | RAGE Antagonist Peptide (RAP) | MilliporeSigma | Cat. #: 553031 | 100 ug (peptide) |
| Peptide, recombinant protein | Human S100a4 Recombinant protein | LSBio | Cat #: G1305 | 20–1000 ng/mL (recombinant protein) |
| Commercial kit | Rabbit polymer kit | Vector Laboratories | Cat #: MP-7401 | |
| Software | OlyVIA software | Olympus (https://www.olympus-lifescience.com/en/support/downloads/) | RRID:SCR_016167 | Version 2.9 |
| Software | ImageJ software | ImageJ (http://imagej.nih.gov/ij/) | RRID:SCR_003070 | |
| Software | GraphPad Prism software | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | Version 8.0.0 |
Table 1
qPCR Primer Sequences
https://doi.org/10.7554/eLife.45342.019| Gene | Sequence (5'- > 3') | Reference | |
|---|---|---|---|
| Actb | Fwd | AGATGTGCATCAGCAAGCAG | NM_007393.5 |
| Rev | GCGCAAGTTAGGTTTTGTCA | ||
| S100a4 | Fwd | AAGCTGAACAAGACAGAGCTCAAG | NM_011311.2 |
| Rev | GTCCTTTTCCCCAGGAAGCTA | ||
| Fn | Fwd | CGAGGTGACAGAGACCACAA | NM_001276413.1 |
| Rev | CTGGAGTCAAGCCAGACACA | ||
| Tnmd | Fwd | TGTACTGGATCAATCCCACTCT | NM_022322.2 |
| Rev | GCTCATTCTGGTCAATCCCCT | ||
| Scx | Fwd | TGGCCTCCAGCTACATTTCT | NM_198885.3 |
| Rev | TGTCACGGTCTTTGCTGAAC | ||
| Mkx | Fwd | CACCGTGACAACCCGTACC | NM_177595.4 |
| Rev | GCACTAGCGTCATCTGCGAG | ||
| Col1a1 | Fwd | GCTCCTCTTAGGGGCCACT | NM_007742.4 |
| Rev | CCACGTCTCACCATTGGGG | ||
| Col3a1 | Fwd | ACGTAGATGAATTGGGATGCAG | NM_009930.2 |
| Rev | GGGTTGGGGCAGTCTAGTG | ||
| Acta2 | Fwd | GAGGCACCACTGAACCCTAA | NM_007392.3 |
| Rev | CATCTCCAGAGTCCAGCACA | ||
| iNOS | Fwd | CAGAGGACCCAGAGACAAGC | NM_001313921.1 |
| Rev | TGCTGAAACATTTCCTGTGC | ||
| TNFa | Fwd | AACTGTAAGCGGGGCAATCA | NM_013693.3 |
| Rev | CCCCTTTCCTCCCAAACCAA | ||
| Cd86 | Fwd | TCTCCACGGAAACAGCATCT | NM_019388.3 |
| Rev | CTTACGGAAGCACCCATGAT | ||
| Cd64 | Fwd | TCCTTCTGGAAAATACTGACC | NM_010186.5 |
| Rev | GTTTGCTGTGGTTTGAGACC | ||
| Cd206 | Fwd | CAGGTGTGGGCTCAGGTAGT | NM_008625.2 |
| Rev | TGTGGTGAGCTGAAAGGTGA | ||
| Arg1 | Fwd | AGGAACTGGCTGAAGTGGTTA | NM_007482.3 |
| Rev | GATGAGAAAGGAAAGTGGCTGT | ||
| IL1ra | Fwd | GCATCTTGCAGGGTCTTTTC | NM_001159562.1 |
| Rev | GTGAGACGTTGGAAGGCAGT | ||
| Cd163 | Fwd | TCCACACGTCCAGAACAGTC | NM_001170395.1 |
| Rev | CCTTGGAAACAGAGACAGGC |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.45342.020
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Cell non-autonomous functions of S100a4 drive fibrotic tendon healing
eLife 8:e45342.
https://doi.org/10.7554/eLife.45342
