(A–B) The superficial vascular plexus of P7 retinas from the indicated genotypes (column 1), with boxed regions shown at higher magnification (columns 2 and 3). Dashed white lines indicate the edge …
(A,B) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P14 retinas (top) with representative traces of the vasculature for quantification (bottom), as described in …
(A–B) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P18 retinas from the indicated genotypes (column 1), with boxed regions displayed at higher magnification in …
(A–E) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P18 retinas from the indicated genotypes (column 1), with boxed regions displayed at higher magnification in …
(A–D) Sagittal sections of P18 brains from the indicated genotypes, with color channels for the indicated histochemical stains and/or immunostains indicated in each image. In each set, the boxed …
(A,B) Sagittal sections of P18 brains from the indicated genotypes, with color channels for the indicated histochemical stains and/or immunostains listed in the corner of each image. In each image …
(A–D) P7 retinas from the indicated genotypes, with the boxed region in column 1 shown at higher magnification in columns 2 and 3, and the boxed region in column 4 shown at higher magnification in …
(A,B) P7 retinas, with the boxed region in column 1 shown at higher magnification in columns 2 and 3, and the boxed region in column 4 shown at higher magnification in column 5. Mice were injected …
(A–C) WT STF (A), Dlg1 KO STF Clone #12 (B), and Dlg1 KO STF Clone #15 (C) were transfected with Norrin and Fz4 plasmids together with the indicated concentrations of Myc-Dlg1 plasmid DNA. The …
(A) Schematic of the strategy for creating a CRISPR/Cas9-mediated deletion in exon 10 of the Dlg1 gene, leading to a frameshift mutation and termination of the open reading frame in exon 11. (B) By …
(A) Co-immunoprecipitation followed by immunoblotting to assess the interactions between Myc-Dlg1 and Rim-Fz4. HEK/293T cells were co-transfected with Myc-Dlg1 and WT Rim-Fz4, Rim-Fz4(4A), or an …
Surface biotinylation, as described in Materials and methods, of Dlg1 KO STF Clone #15 cells transfected with Rim-Fz4, Rim-Tspan12, and/or Myc-Dlg1.
(A) Diagram of the Fz4 allele produced by CRISPR/Cas9 editing (Fz4MGK). Numbers indicate exons. TVV, the C-terminal three amino acids, were substituted with MGK. Right, sequencing chromatograms from …
(A) Diagram of WT Myc-Dlg1 and its domain deletion mutants. (B) Dlg1 KO STF Clone #15 cells were transfected with Tspan12, Norrin, and Fz4, together with Myc-Dlg1, the indicated domain deletion …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Genetic reagent (M. musculus) | Dlg1fl | PMID: 18842882 | Richard Huganir (Johns Hopkins) | |
Genetic reagent (M. musculus) | Dlg1Δ | this paper | Generated by breeding mice carrying the germline Sox2-Cre transgene with floxed mice | |
Genetic reagent (M. musculus) | Fz4Δ | PMID: 15035989 | ||
Genetic reagent (M. musculus) | Fz4MGK | this paper | Please find details under Materials and methods (Gene Targeting) | |
Genetic reagent (M. musculus) | Tspan12Δ | PMID: 19837033 | Harald Junge (University of Colorado Boulder) | |
Genetic reagent (M. musculus) | NdpΔ | PMID: 19837032; Jackson Laboratory | Stock #: 012287; RRID:IMSR_JAX:012287 | |
Genetic reagent (M. musculus) | Ctnnb1flex3 | PMID: 10545105 | Makoto Taketo (Kyoto University) | |
Genetic reagent (M. musculus) | Tie2-Cre | Jackson Laboratory | Stock #: 008863; RRID:IMSR_JAX:008863 | |
Genetic reagent (M. musculus) | Pdgfb-CreER | PMID: 18257043 | ||
Genetic reagent (M. musculus) | Sox2-Cre | PMID: 12617844 | ||
Cell line (H. sapiens) | HEK/293T | ATCC | Cat. #: CRL-3216 | |
Cell line (E. coli) | BL21 | New England Biolabs | Cat. #: C2530H | |
Cell line (H. sapiens) | Super TOP Flash (STF) luciferase reporter cell line | PMID: 15035989 | ||
Cell line (H. sapiens) | STF Dlg1 KO Clone #12 | this paper | Please find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines) | |
Cell line (H. sapiens) | STF Dlg1 KO Clone #15 | this paper | Please find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines) | |
Antibody | Rabbit polyclonal anti-Glut1 | Thermo Fisher Scientific | Cat. #: RB-9052-P1; RRID: AB_177895 | 1:400 dilution |
Antibody | Rat monoclonal anti-PLVAP/MECA-32 | BD Biosciences | Cat. #: 553849; RRID: AB_395086 | 1:400 dilution |
Antibody | Mouse monoclonal anti-Claudin5, Alexa 488 conjugate | Thermo Fisher Scientific | Cat. #: 352588; RRID: AB_2532189 | 1:400 dilution |
Antibody | Rabbit polyclonal anti-6xMyc | PMID: 28803732 | 1:10,000 dilution | |
Antibody | Rabbit monoclonal anti-V5 | Cell Signaling Technology | Cat. #: 13202; RRID: AB_2687461 | 1:1000 dilution |
Antibody | Mouse monoclonal anti-RIM3F4 | PMID: 9092582 | 1:10,000 dilution | |
Antibody | Mouse monoclonal anti-actin | Millipore Sigma | Cat. #: MAB1501; RRID: AB_2223041 | 1:10,000 dilution |
Antibody | Rabbit monoclonal anti-SAP97 | Abcam | Cat. #: ab134156 | 1:1000 dilution |
Antibody | Goat polyclonal anti-rabbit IgG (H + L) cross-adsorbedsecondary antibody, Alexa 488, 594, and 647 conjugates | Thermo Fisher Scientific | Cat. #s: A-11008, RRID: AB_143165; A-11012, RRID: AB_2534079; A-21244,RRID: AB_2535812 | 1:400 dilution |
Antibody | IRDye 800CW goat anti-mouse IgG (H + L) secondary antibody | LI-COR | Cat. #: 925–32210 | 1:10,000 dilution |
Antibody | IRDye 680RD goat anti-rabbit IgG (H + L) secondary antibody | LI-COR | Cat. #: 925–68071 | 1:10,000 dilution |
Oligonucleotides | Fz4MGK guide RNA: AGGAAAAGGCAACGAGACTG | this paper | Please find details under Materials and methods (Gene Targeting) | |
Oligonucleotides | Dlg1 guide RNA: AAGCTCATTAAAGGTCCTAA | this paper | Please find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines) | |
Recombinant DNA reagents | Rat Myc-Dlg1 cDNA | PMID: 12805297 | Richard Huganir (Johns Hopkins) | |
Recombinant DNA reagents | pMAL-cR1 expression vector | New England Biolabs | ||
Recombinant DNA reagents | Mouse Norrin, Wnts, and Frizzleds cDNA | PMID: 23095888 | ||
Recombinant DNA reagents | Mouse Tspan12 cDNA | PMID: 30478038 | ||
Recombinant DNA reagents | Mouse Reck cDNA | PMID: 28803732 | ||
Recombinant DNA reagents | Mouse Gpr124 cDNA | PMID: 28803732 | ||
Recombinant DNA reagents | Mouse Dlg2 cDNA | Origene | Cat. #: MR222602 | |
Recombinant DNA reagents | Mouse Dlg3 cDNA | GE Dharmacon | Clone #: 6842105 | |
Recombinant DNA reagents | Mouse Dlg4 cDNA | GE Dharmacon | Clone #: 4501403 | |
Recombinant DNA reagents | Mouse V5-Dlg5 cDNA | PMID: 17765678 | Alex Kolodkin (Johns Hopkins) | |
Recombinant DNA reagents | pSpCasp9(BB)−2A-GFP vector | Addgene | Plasmid #: 48138 | |
Peptide, recombinant protein | Rhodopsin peptide (SKTETSQVAPA) | this paper | Please find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells) | |
Peptide, recombinant protein | Fz4 WT peptide (WVKPGKGNETVV) | this paper | Please find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells) | |
Peptide, recombinant protein | Fz4 MGK peptide (WVKPGKGNEMGK) | this paper | Please find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells) | |
Commercial assay or kit | MEGAshortscript T7 Kit | Invitrogen | Cat. #: AM1354 | |
Commercial assay or kit | MEGAclear Transcription Clean-Up Kit | Invitrogen | Cat. #: AM1908 | |
Commercial assay or kit | mMESSAGE mMACHINE T7 Ultra Transcription Kit | Invitrogen | Cat. #: AM1345 | |
Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | Cat. #: E1910 | |
Chemical compound, drug | (Z)−4-Hydroxytamoxifen | Sigma-Aldrich | Cat. #: H7904 | |
Chemical compound, drug | Sunflower seed oil from Helianthus annuus | Sigma-Aldrich | Cat. #: S5007 | |
Chemical compound, drug | EZ-Link Sulfo-NHS-LC-Biotin | Thermo Fisher Scientific | Cat. #: 21335 | |
Software, algorithm | ImageJ | https://imagej.nih.gov/ij | ||
Software, algorithm | Adobe Photoshop CS6 | https://adobe.com/photoshop | ||
Software, algorithm | Adobe Illustrator CS6 | https://adobe.com/illustrator | ||
Software, algorithm | GraphPad Prism 7 | http://www.graphpad.com | ||
Other | FuGENE HD Transfection Reagent | Promega | Cat. #: E2311 | |
Other | Pierce NeutrAvidin agarose resin | Thermo Fisher Scientific | Cat. #: 29200 | |
Other | Protein G Dynabeads | Thermo Fisher Scientific | Cat. #: 10004D | |
Other | Amylose resin | New England Biolabs | Cat. #: E8021S | |
Other | Streptavidin Dynabeads | Thermo Fisher Scientific | Cat. #: 11047 | |
Other | Fluoromount G | EM Sciences | Cat. #: 17984–25 | |
Other | Protease Inhibitor | Roche | Cat. #: 11836170001 | |
Other | 1x BugBuster Protein Extraction Reagent | Millipore Sigma | Cat. #: 70584 | |
Other | Texas Red Streptavidin | Vector Laboratories | Cat. #: SA-5006 |