Dlg1 activates beta-catenin signaling to regulate retinal angiogenesis and the blood-retina and blood-brain barriers

  1. Chris Cho
  2. Yanshu Wang
  3. Philip M Smallwood
  4. John Williams
  5. Jeremy Nathans  Is a corresponding author
  1. Johns Hopkins University School of Medicine, United States
  2. Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, United States
8 figures, 1 table and 1 additional file

Figures

Figure 1 with 1 supplement
Dlg1 promotes angiogenesis in the mammalian retina.

(A–B) The superficial vascular plexus of P7 retinas from the indicated genotypes (column 1), with boxed regions shown at higher magnification (columns 2 and 3). Dashed white lines indicate the edge …

https://doi.org/10.7554/eLife.45542.002
Figure 1—figure supplement 1
Quantification of Claudin5 and PLVAP accumulation in retinal ECs.

(A,B) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P14 retinas (top) with representative traces of the vasculature for quantification (bottom), as described in …

https://doi.org/10.7554/eLife.45542.003
Dlg1 genetically interacts with Fz4 to regulate retinal angiogenesis and the BRB.

(A–B) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P18 retinas from the indicated genotypes (column 1), with boxed regions displayed at higher magnification in …

https://doi.org/10.7554/eLife.45542.004
Dlg1 genetically interacts with Tspan12 in the developing retinal vasculature.

(A–E) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P18 retinas from the indicated genotypes (column 1), with boxed regions displayed at higher magnification in …

https://doi.org/10.7554/eLife.45542.005
Figure 4 with 1 supplement
Dlg1 genetically interacts with Tspan12 and Ndp to regulate BBB integrity.

(A–D) Sagittal sections of P18 brains from the indicated genotypes, with color channels for the indicated histochemical stains and/or immunostains indicated in each image. In each set, the boxed …

https://doi.org/10.7554/eLife.45542.006
Figure 4—figure supplement 1
Loss of Dlg1 in endothelial cells has no effect on vascular leakage or vascular markers GLUT1 and PLVAP.

(A,B) Sagittal sections of P18 brains from the indicated genotypes, with color channels for the indicated histochemical stains and/or immunostains listed in the corner of each image. In each image …

https://doi.org/10.7554/eLife.45542.007
Figure 5 with 1 supplement
Stabilizing beta-catenin in endothelial cells corrects the retinal vascular defect caused by loss of Dlg1.

(A–D) P7 retinas from the indicated genotypes, with the boxed region in column 1 shown at higher magnification in columns 2 and 3, and the boxed region in column 4 shown at higher magnification in …

https://doi.org/10.7554/eLife.45542.008
Figure 5—figure supplement 1
Loss of Dlg1 in endothelial cells in P7 retinas: marker expression and biotin leakage.

(A,B) P7 retinas, with the boxed region in column 1 shown at higher magnification in columns 2 and 3, and the boxed region in column 4 shown at higher magnification in column 5. Mice were injected …

https://doi.org/10.7554/eLife.45542.009
Figure 6 with 1 supplement
Dlg1 activates Wnt signaling in transfected cells.

(A–C) WT STF (A), Dlg1 KO STF Clone #12 (B), and Dlg1 KO STF Clone #15 (C) were transfected with Norrin and Fz4 plasmids together with the indicated concentrations of Myc-Dlg1 plasmid DNA. The …

https://doi.org/10.7554/eLife.45542.010
Figure 6—figure supplement 1
Dlg1 null mutations created by CRISPR/Cas9-mediated gene editing in the STF reporter cell line.

(A) Schematic of the strategy for creating a CRISPR/Cas9-mediated deletion in exon 10 of the Dlg1 gene, leading to a frameshift mutation and termination of the open reading frame in exon 11. (B) By …

https://doi.org/10.7554/eLife.45542.011
Figure 7 with 1 supplement
The Fz4 C-terminal PDZ-binding motif binds to PDZ domains 1 and 2 of Dlg1.

(A) Co-immunoprecipitation followed by immunoblotting to assess the interactions between Myc-Dlg1 and Rim-Fz4. HEK/293T cells were co-transfected with Myc-Dlg1 and WT Rim-Fz4, Rim-Fz4(4A), or an …

https://doi.org/10.7554/eLife.45542.012
Figure 7—figure supplement 1
Plasma membrane localization of Fz4 in Dlg1 KO STF Cells.

Surface biotinylation, as described in Materials and methods, of Dlg1 KO STF Clone #15 cells transfected with Rim-Fz4, Rim-Tspan12, and/or Myc-Dlg1.

https://doi.org/10.7554/eLife.45542.013
Figure 8 with 2 supplements
Mutation of the Fz4 C-terminal PDZ-binding domain enhances the severity of retinal vascular defects in a Dlg1 mutant background.

(A) Diagram of the Fz4 allele produced by CRISPR/Cas9 editing (Fz4MGK). Numbers indicate exons. TVV, the C-terminal three amino acids, were substituted with MGK. Right, sequencing chromatograms from …

https://doi.org/10.7554/eLife.45542.014
Figure 8—figure supplement 1
Effect of Dlg1 domain deletions on canonical beta-catenin signaling in STF cells, and effect of WT Dlg1 on signaling by WT Rim-Fz4 vs. Rim-Fz4(4A).

(A) Diagram of WT Myc-Dlg1 and its domain deletion mutants. (B) Dlg1 KO STF Clone #15 cells were transfected with Tspan12, Norrin, and Fz4, together with Myc-Dlg1, the indicated domain deletion …

https://doi.org/10.7554/eLife.45542.015
Figure 8—figure supplement 2
Summary diagram of Dlg1 in beta-catenin signaling for CNS angiogenesis and BBB/BRB maintenance.
https://doi.org/10.7554/eLife.45542.016

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or
reference
IdentifiersAdditional
information
Genetic reagent (M. musculus)Dlg1flPMID: 18842882Richard Huganir (Johns Hopkins)
Genetic reagent (M. musculus)Dlg1Δthis paperGenerated by breeding mice carrying the germline Sox2-Cre transgene with floxed mice
Genetic reagent (M. musculus)Fz4ΔPMID: 15035989
Genetic reagent (M. musculus)Fz4MGKthis paperPlease find details under Materials and methods (Gene Targeting)
Genetic reagent (M. musculus)Tspan12ΔPMID: 19837033Harald Junge (University of Colorado Boulder)
Genetic reagent (M. musculus)NdpΔPMID: 19837032; Jackson LaboratoryStock #: 012287; RRID:IMSR_JAX:012287
Genetic reagent (M. musculus)Ctnnb1flex3PMID: 10545105Makoto Taketo (Kyoto University)
Genetic reagent (M. musculus)Tie2-CreJackson LaboratoryStock #: 008863;
RRID:IMSR_JAX:008863
Genetic reagent (M. musculus)Pdgfb-CreERPMID: 18257043
Genetic reagent
(M. musculus)
Sox2-CrePMID: 12617844
Cell line (H. sapiens)HEK/293TATCCCat. #: CRL-3216
Cell line (E. coli)BL21New England BiolabsCat. #: C2530H
Cell line (H. sapiens)Super TOP Flash (STF) luciferase reporter cell linePMID: 15035989
Cell line (H. sapiens)STF Dlg1 KO Clone #12this paperPlease find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines)
Cell line (H. sapiens)STF Dlg1 KO Clone #15this paperPlease find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines)
AntibodyRabbit polyclonal anti-Glut1Thermo Fisher ScientificCat. #: RB-9052-P1; RRID: AB_1778951:400 dilution
AntibodyRat monoclonal anti-PLVAP/MECA-32BD BiosciencesCat. #: 553849; RRID: AB_3950861:400 dilution
AntibodyMouse monoclonal anti-Claudin5, Alexa 488 conjugateThermo Fisher ScientificCat. #: 352588; RRID: AB_25321891:400 dilution
AntibodyRabbit polyclonal
anti-6xMyc
PMID: 288037321:10,000 dilution
AntibodyRabbit monoclonal anti-V5Cell Signaling TechnologyCat. #: 13202; RRID: AB_26874611:1000 dilution
AntibodyMouse monoclonal anti-RIM3F4PMID: 90925821:10,000 dilution
AntibodyMouse monoclonal anti-actinMillipore SigmaCat. #: MAB1501; RRID: AB_22230411:10,000 dilution
AntibodyRabbit monoclonal anti-SAP97AbcamCat. #: ab1341561:1000 dilution
AntibodyGoat polyclonal anti-rabbit IgG (H + L) cross-adsorbedsecondary antibody, Alexa 488, 594, and 647 conjugatesThermo Fisher ScientificCat. #s: A-11008, RRID: AB_143165; A-11012, RRID: AB_2534079; A-21244,RRID: AB_25358121:400 dilution
AntibodyIRDye 800CW goat anti-mouse IgG (H + L) secondary antibodyLI-CORCat. #: 925–322101:10,000 dilution
AntibodyIRDye 680RD goat anti-rabbit IgG (H + L) secondary antibodyLI-CORCat. #: 925–680711:10,000 dilution
OligonucleotidesFz4MGK guide
RNA: AGGAAAAGGCAACGAGACTG
this paperPlease find details under Materials and methods (Gene Targeting)
OligonucleotidesDlg1 guide RNA: AAGCTCATTAAAGGTCCTAAthis paperPlease find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines)
Recombinant DNA reagentsRat Myc-Dlg1 cDNAPMID: 12805297Richard Huganir (Johns Hopkins)
Recombinant DNA reagentspMAL-cR1 expression vectorNew England Biolabs
Recombinant DNA reagentsMouse Norrin, Wnts, and Frizzleds cDNAPMID: 23095888
Recombinant DNA reagentsMouse Tspan12 cDNAPMID: 30478038
Recombinant DNA reagentsMouse Reck cDNAPMID: 28803732
Recombinant DNA reagentsMouse Gpr124 cDNAPMID: 28803732
Recombinant DNA reagentsMouse Dlg2 cDNAOrigeneCat. #: MR222602
Recombinant DNA reagentsMouse Dlg3 cDNAGE DharmaconClone #: 6842105
Recombinant DNA reagentsMouse Dlg4 cDNAGE DharmaconClone #: 4501403
Recombinant
DNA reagents
Mouse V5-Dlg5 cDNAPMID: 17765678Alex Kolodkin (Johns Hopkins)
Recombinant DNA reagentspSpCasp9(BB)−2A-GFP vectorAddgenePlasmid #: 48138
Peptide, recombinant proteinRhodopsin peptide (SKTETSQVAPA)this paperPlease find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells)
Peptide, recombinant
protein
Fz4 WT peptide (WVKPGKGNETVV)this paperPlease find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells)
Peptide, recombinant proteinFz4 MGK peptide (WVKPGKGNEMGK)this paperPlease find details under Materials and methods
(Biotin-peptide binding to proteins expressed in HEK/293T cells)
Commercial assay or kitMEGAshortscript T7 KitInvitrogenCat. #: AM1354
Commercial assay or kitMEGAclear Transcription Clean-Up KitInvitrogenCat. #: AM1908
Commercial assay or kitmMESSAGE mMACHINE T7 Ultra Transcription KitInvitrogenCat. #: AM1345
Commercial assay or kitDual-Luciferase Reporter Assay SystemPromegaCat. #: E1910
Chemical compound, drug(Z)−4-HydroxytamoxifenSigma-AldrichCat. #: H7904
Chemical compound, drugSunflower seed oil from Helianthus annuusSigma-AldrichCat. #: S5007
Chemical compound, drugEZ-Link Sulfo-NHS-LC-BiotinThermo Fisher ScientificCat. #: 21335
Software, algorithmImageJhttps://imagej.nih.gov/ij
Software, algorithmAdobe Photoshop CS6https://adobe.com/photoshop
Software, algorithmAdobe Illustrator CS6https://adobe.com/illustrator
Software, algorithmGraphPad Prism 7http://www.graphpad.com
OtherFuGENE HD Transfection ReagentPromegaCat. #: E2311
OtherPierce NeutrAvidin agarose resinThermo Fisher ScientificCat. #: 29200
OtherProtein G DynabeadsThermo Fisher ScientificCat. #: 10004D
OtherAmylose resinNew England BiolabsCat. #: E8021S
OtherStreptavidin DynabeadsThermo Fisher ScientificCat. #: 11047
OtherFluoromount GEM SciencesCat. #: 17984–25
OtherProtease InhibitorRocheCat. #: 11836170001
Other1x BugBuster Protein Extraction ReagentMillipore SigmaCat. #: 70584
OtherTexas Red StreptavidinVector LaboratoriesCat. #: SA-5006

Additional files

Download links