Dlg1 activates beta-catenin signaling to regulate retinal angiogenesis and the blood-retina and blood-brain barriers
- Johns Hopkins University School of Medicine, United States
- Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, United States
Figures
Figure 1 with 1 supplement
Dlg1 promotes angiogenesis in the mammalian retina.
(A–B) The superficial vascular plexus of P7 retinas from the indicated genotypes (column 1), with boxed regions shown at higher magnification (columns 2 and 3). Dashed white lines indicate the edge …
Figure 1—figure supplement 1
Quantification of Claudin5 and PLVAP accumulation in retinal ECs.
(A,B) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P14 retinas (top) with representative traces of the vasculature for quantification (bottom), as described in …
Figure 2
Dlg1 genetically interacts with Fz4 to regulate retinal angiogenesis and the BRB.
(A–B) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P18 retinas from the indicated genotypes (column 1), with boxed regions displayed at higher magnification in …
Figure 3
Dlg1 genetically interacts with Tspan12 in the developing retinal vasculature.
(A–E) Maximum projection of the superficial, intermediate, and deep vascular plexuses of P18 retinas from the indicated genotypes (column 1), with boxed regions displayed at higher magnification in …
Figure 4 with 1 supplement
Dlg1 genetically interacts with Tspan12 and Ndp to regulate BBB integrity.
(A–D) Sagittal sections of P18 brains from the indicated genotypes, with color channels for the indicated histochemical stains and/or immunostains indicated in each image. In each set, the boxed …
Figure 4—figure supplement 1
Loss of Dlg1 in endothelial cells has no effect on vascular leakage or vascular markers GLUT1 and PLVAP.
(A,B) Sagittal sections of P18 brains from the indicated genotypes, with color channels for the indicated histochemical stains and/or immunostains listed in the corner of each image. In each image …
Figure 5 with 1 supplement
Stabilizing beta-catenin in endothelial cells corrects the retinal vascular defect caused by loss of Dlg1.
(A–D) P7 retinas from the indicated genotypes, with the boxed region in column 1 shown at higher magnification in columns 2 and 3, and the boxed region in column 4 shown at higher magnification in …
Figure 5—figure supplement 1
Loss of Dlg1 in endothelial cells in P7 retinas: marker expression and biotin leakage.
(A,B) P7 retinas, with the boxed region in column 1 shown at higher magnification in columns 2 and 3, and the boxed region in column 4 shown at higher magnification in column 5. Mice were injected …
Figure 6 with 1 supplement
Dlg1 activates Wnt signaling in transfected cells.
(A–C) WT STF (A), Dlg1 KO STF Clone #12 (B), and Dlg1 KO STF Clone #15 (C) were transfected with Norrin and Fz4 plasmids together with the indicated concentrations of Myc-Dlg1 plasmid DNA. The …
Figure 6—figure supplement 1
Dlg1 null mutations created by CRISPR/Cas9-mediated gene editing in the STF reporter cell line.
(A) Schematic of the strategy for creating a CRISPR/Cas9-mediated deletion in exon 10 of the Dlg1 gene, leading to a frameshift mutation and termination of the open reading frame in exon 11. (B) By …
Figure 7 with 1 supplement
The Fz4 C-terminal PDZ-binding motif binds to PDZ domains 1 and 2 of Dlg1.
(A) Co-immunoprecipitation followed by immunoblotting to assess the interactions between Myc-Dlg1 and Rim-Fz4. HEK/293T cells were co-transfected with Myc-Dlg1 and WT Rim-Fz4, Rim-Fz4(4A), or an …
Figure 7—figure supplement 1
Plasma membrane localization of Fz4 in Dlg1 KO STF Cells.
Surface biotinylation, as described in Materials and methods, of Dlg1 KO STF Clone #15 cells transfected with Rim-Fz4, Rim-Tspan12, and/or Myc-Dlg1.
Figure 8 with 2 supplements
Mutation of the Fz4 C-terminal PDZ-binding domain enhances the severity of retinal vascular defects in a Dlg1 mutant background.
(A) Diagram of the Fz4 allele produced by CRISPR/Cas9 editing (Fz4MGK). Numbers indicate exons. TVV, the C-terminal three amino acids, were substituted with MGK. Right, sequencing chromatograms from …
Figure 8—figure supplement 1
Effect of Dlg1 domain deletions on canonical beta-catenin signaling in STF cells, and effect of WT Dlg1 on signaling by WT Rim-Fz4 vs. Rim-Fz4(4A).
(A) Diagram of WT Myc-Dlg1 and its domain deletion mutants. (B) Dlg1 KO STF Clone #15 cells were transfected with Tspan12, Norrin, and Fz4, together with Myc-Dlg1, the indicated domain deletion …
Figure 8—figure supplement 2
Summary diagram of Dlg1 in beta-catenin signaling for CNS angiogenesis and BBB/BRB maintenance.
https://doi.org/10.7554/eLife.45542.016Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Dlg1fl | PMID: 18842882 | Richard Huganir (Johns Hopkins) | |
| Genetic reagent (M. musculus) | Dlg1Δ | this paper | Generated by breeding mice carrying the germline Sox2-Cre transgene with floxed mice | |
| Genetic reagent (M. musculus) | Fz4Δ | PMID: 15035989 | ||
| Genetic reagent (M. musculus) | Fz4MGK | this paper | Please find details under Materials and methods (Gene Targeting) | |
| Genetic reagent (M. musculus) | Tspan12Δ | PMID: 19837033 | Harald Junge (University of Colorado Boulder) | |
| Genetic reagent (M. musculus) | NdpΔ | PMID: 19837032; Jackson Laboratory | Stock #: 012287; RRID:IMSR_JAX:012287 | |
| Genetic reagent (M. musculus) | Ctnnb1flex3 | PMID: 10545105 | Makoto Taketo (Kyoto University) | |
| Genetic reagent (M. musculus) | Tie2-Cre | Jackson Laboratory | Stock #: 008863; RRID:IMSR_JAX:008863 | |
| Genetic reagent (M. musculus) | Pdgfb-CreER | PMID: 18257043 | ||
| Genetic reagent (M. musculus) | Sox2-Cre | PMID: 12617844 | ||
| Cell line (H. sapiens) | HEK/293T | ATCC | Cat. #: CRL-3216 | |
| Cell line (E. coli) | BL21 | New England Biolabs | Cat. #: C2530H | |
| Cell line (H. sapiens) | Super TOP Flash (STF) luciferase reporter cell line | PMID: 15035989 | ||
| Cell line (H. sapiens) | STF Dlg1 KO Clone #12 | this paper | Please find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines) | |
| Cell line (H. sapiens) | STF Dlg1 KO Clone #15 | this paper | Please find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines) | |
| Antibody | Rabbit polyclonal anti-Glut1 | Thermo Fisher Scientific | Cat. #: RB-9052-P1; RRID: AB_177895 | 1:400 dilution |
| Antibody | Rat monoclonal anti-PLVAP/MECA-32 | BD Biosciences | Cat. #: 553849; RRID: AB_395086 | 1:400 dilution |
| Antibody | Mouse monoclonal anti-Claudin5, Alexa 488 conjugate | Thermo Fisher Scientific | Cat. #: 352588; RRID: AB_2532189 | 1:400 dilution |
| Antibody | Rabbit polyclonal anti-6xMyc | PMID: 28803732 | 1:10,000 dilution | |
| Antibody | Rabbit monoclonal anti-V5 | Cell Signaling Technology | Cat. #: 13202; RRID: AB_2687461 | 1:1000 dilution |
| Antibody | Mouse monoclonal anti-RIM3F4 | PMID: 9092582 | 1:10,000 dilution | |
| Antibody | Mouse monoclonal anti-actin | Millipore Sigma | Cat. #: MAB1501; RRID: AB_2223041 | 1:10,000 dilution |
| Antibody | Rabbit monoclonal anti-SAP97 | Abcam | Cat. #: ab134156 | 1:1000 dilution |
| Antibody | Goat polyclonal anti-rabbit IgG (H + L) cross-adsorbedsecondary antibody, Alexa 488, 594, and 647 conjugates | Thermo Fisher Scientific | Cat. #s: A-11008, RRID: AB_143165; A-11012, RRID: AB_2534079; A-21244,RRID: AB_2535812 | 1:400 dilution |
| Antibody | IRDye 800CW goat anti-mouse IgG (H + L) secondary antibody | LI-COR | Cat. #: 925–32210 | 1:10,000 dilution |
| Antibody | IRDye 680RD goat anti-rabbit IgG (H + L) secondary antibody | LI-COR | Cat. #: 925–68071 | 1:10,000 dilution |
| Oligonucleotides | Fz4MGK guide RNA: AGGAAAAGGCAACGAGACTG | this paper | Please find details under Materials and methods (Gene Targeting) | |
| Oligonucleotides | Dlg1 guide RNA: AAGCTCATTAAAGGTCCTAA | this paper | Please find details under Materials and methods (Constructing CRISPR/Cas9 STF cell lines) | |
| Recombinant DNA reagents | Rat Myc-Dlg1 cDNA | PMID: 12805297 | Richard Huganir (Johns Hopkins) | |
| Recombinant DNA reagents | pMAL-cR1 expression vector | New England Biolabs | ||
| Recombinant DNA reagents | Mouse Norrin, Wnts, and Frizzleds cDNA | PMID: 23095888 | ||
| Recombinant DNA reagents | Mouse Tspan12 cDNA | PMID: 30478038 | ||
| Recombinant DNA reagents | Mouse Reck cDNA | PMID: 28803732 | ||
| Recombinant DNA reagents | Mouse Gpr124 cDNA | PMID: 28803732 | ||
| Recombinant DNA reagents | Mouse Dlg2 cDNA | Origene | Cat. #: MR222602 | |
| Recombinant DNA reagents | Mouse Dlg3 cDNA | GE Dharmacon | Clone #: 6842105 | |
| Recombinant DNA reagents | Mouse Dlg4 cDNA | GE Dharmacon | Clone #: 4501403 | |
| Recombinant DNA reagents | Mouse V5-Dlg5 cDNA | PMID: 17765678 | Alex Kolodkin (Johns Hopkins) | |
| Recombinant DNA reagents | pSpCasp9(BB)−2A-GFP vector | Addgene | Plasmid #: 48138 | |
| Peptide, recombinant protein | Rhodopsin peptide (SKTETSQVAPA) | this paper | Please find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells) | |
| Peptide, recombinant protein | Fz4 WT peptide (WVKPGKGNETVV) | this paper | Please find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells) | |
| Peptide, recombinant protein | Fz4 MGK peptide (WVKPGKGNEMGK) | this paper | Please find details under Materials and methods (Biotin-peptide binding to proteins expressed in HEK/293T cells) | |
| Commercial assay or kit | MEGAshortscript T7 Kit | Invitrogen | Cat. #: AM1354 | |
| Commercial assay or kit | MEGAclear Transcription Clean-Up Kit | Invitrogen | Cat. #: AM1908 | |
| Commercial assay or kit | mMESSAGE mMACHINE T7 Ultra Transcription Kit | Invitrogen | Cat. #: AM1345 | |
| Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | Cat. #: E1910 | |
| Chemical compound, drug | (Z)−4-Hydroxytamoxifen | Sigma-Aldrich | Cat. #: H7904 | |
| Chemical compound, drug | Sunflower seed oil from Helianthus annuus | Sigma-Aldrich | Cat. #: S5007 | |
| Chemical compound, drug | EZ-Link Sulfo-NHS-LC-Biotin | Thermo Fisher Scientific | Cat. #: 21335 | |
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij | ||
| Software, algorithm | Adobe Photoshop CS6 | https://adobe.com/photoshop | ||
| Software, algorithm | Adobe Illustrator CS6 | https://adobe.com/illustrator | ||
| Software, algorithm | GraphPad Prism 7 | http://www.graphpad.com | ||
| Other | FuGENE HD Transfection Reagent | Promega | Cat. #: E2311 | |
| Other | Pierce NeutrAvidin agarose resin | Thermo Fisher Scientific | Cat. #: 29200 | |
| Other | Protein G Dynabeads | Thermo Fisher Scientific | Cat. #: 10004D | |
| Other | Amylose resin | New England Biolabs | Cat. #: E8021S | |
| Other | Streptavidin Dynabeads | Thermo Fisher Scientific | Cat. #: 11047 | |
| Other | Fluoromount G | EM Sciences | Cat. #: 17984–25 | |
| Other | Protease Inhibitor | Roche | Cat. #: 11836170001 | |
| Other | 1x BugBuster Protein Extraction Reagent | Millipore Sigma | Cat. #: 70584 | |
| Other | Texas Red Streptavidin | Vector Laboratories | Cat. #: SA-5006 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.45542.017
