Club cells form lung adenocarcinomas and maintain the alveoli of adult mice
- University of Patras, Greece
- University Hospital, Ludwig-Maximilians University, Helmholtz Center Munich, The German Center for Lung Research (DZL), Germany
- German Cancer Research Center (DKFZ), The German Center for Lung Research (DZL), Germany
- Biomedical Sciences Research Center "Alexander Fleming", Greece
- Evangelismos Hospital, National and Kapodistrian University of Athens, Greece
Figures
Figure 1 with 19 supplements
Airway cells in urethane-induced lung tumors.
(A) Cartoon of the different lung epithelial lineages, their distribution in the airways (club, goblet, ciliated, and basal cells) and the alveoli (alveolar type I and II cells), their permanent …
Figure 1—figure supplement 1
Table of pulmonary lineage markers and key abbreviations used in this study.
TUBA1A, Tubulin alpha 1a or acetylated tubulin; KRT5, Keratin 5; FOXJ1, Forkhead box J1; CCSP, Secretoglobin, family 1A, member 1 (uteroglobin) or Clara cell secretory protein or Clara cell 10 KDa …
Figure 1—figure supplement 2
Genetic labeling of pulmonary lineages in eleven mouse strains and intercrosses: summary of results.
CRE, causes recombination; TOMATO, tdTomato; GFP, green fluorescent protein; CCSP, Clara cell secretory protein; SFTPC, surfactant protein C; LYZ2, lysozyme 2; SOX2, sex determining region Y …
Figure 1—figure supplement 3
Genetic labeling of pulmonary lineages in seven lineage reporter strains on the C57BL/6 background: representative images.
Representative photographs (top row) and green epifluorescence images (second row) of whole lungs, as well as fluorescent microscopic images of lung sections for nuclear Hoechst33258 stain (third …
Figure 1—figure supplement 4
Genetic labeling of pulmonary lineages in seven lineage reporter strains on the C57BL/6 background: data summary.
XY plot of GFP-labeled airway versus alveolar cells from n = 5 mice/mouse strain. Arrows denote the three lineage-reporter strains selected for further study including GFP;CCSP.CRE (green), GFP;LYZ2.…
-
Figure 1—figure supplement 4—source data 1
Quantification of GFP+ alveolar and bronchial cells in our reporter mice.
- https://doi.org/10.7554/eLife.45571.008
Figure 1—figure supplement 5
Flow cytometric quantification of lineage-labeled cells in three lineage reporter strains on the C57BL/6 background.
Schematic representation of genetic lineage labeling of GFP;CCSP.CRE, GFP;SFTPC.CRE, and GFP;LYZ2.CRE mice (left), flow cytometric gating strategy to quantify GFP+ and TOMATO+ cells (middle), and …
-
Figure 1—figure supplement 5—source data 1
Flow cytometric quantification of GFP+ and TOMATO+ cells in three lineage reporter mice.
- https://doi.org/10.7554/eLife.45571.010
Figure 1—figure supplement 6
Genetic lineage labels of protein-marked cells in three lineage reporter strains on the C57BL/6 background: representative images.
Representative merged fluorescent microscopic images from lineage marker-stained lung sections of 6-week-old lineage-labeled mice (n = 5/group). Arrows indicate cells expressing the respective …
Figure 1—figure supplement 7
Genetic lineage labels of protein-marked cells in seven lineage reporter strains on the C57BL/6 background: data summary.
XY plot of ratios of genetic GFP-labeled to protein marker CCSP and SFTPC-immunoreactive cells (n = 5/group). Arrows denote the three lineage-reporter strains selected for further study including …
-
Figure 1—figure supplement 7—source data 1
Quantification of GFP+/SFTPC+ and GFP+/CCSP+ cells in our reporter mice.
- https://doi.org/10.7554/eLife.45571.013
Figure 1—figure supplement 8
Protein markings of lineage-labeled cells in three lineage reporter strains on the C57BL/6 background: data summary.
Quantification of protein marker expression of genetic-labeled cells of GFP;CCSP.CRE, GFP;LYZ2.CRE, and GFP;SFTPC.CRE mice (n = 6/strain) for Clara cell secretory protein (CCSP), surfactant protein …
-
Figure 1—figure supplement 8—source data 1
Quantification of protein marker expression of GFP+ cells in three lineage reporter mice.
- https://doi.org/10.7554/eLife.45571.015
Figure 1—figure supplement 9
Two carcinogen regimens for reproducible lung tumor induction in naturally resistant C57BL/6 mice.
Top: schematic of multi-hit urethane administration tailored to yield 90% tumor incidence in C57BL/6 mice: ten weekly intraperitoneal injections of 1 g/Kg urethane (ethyl carbamate, EC; gray arrows) …
Figure 1—figure supplement 10
Lung tumors induced in C57BL/6 mice by two carcinogen regimens.
Eighty-four C57BL/6 mice received ten weekly intraperitoneal injections of 1 g/Kg urethane (ethyl carbamate, EC) initiated at six weeks of age and lungs were examined six months after the first …
-
Figure 1—figure supplement 10—source data 1
Quantification of data shown in Figure 1—figure supplement 10.
- https://doi.org/10.7554/eLife.45571.018
Figure 1—figure supplement 11
Airway links of urethane-induced lung adenocarcinomas.
Proliferating cell nuclear antigen (PCNA)-stained lung sections of urethane-treated C57BL/6 mice at six months post-treatment start. Arrows: airway hyperplasias (gray) and lung adenocarcinomas …
Figure 1—figure supplement 12
Genetic labeling of urethane-induced lung adenocarcinomas in four lineage reporter strains on the C57BL/6 background: representative images.
Representative photographs (top row) and green epifluorescence images (second row), as well as merged fluorescent microscopic images of lung sections for nuclear Hoechst33258 stain, endogenous …
Figure 1—figure supplement 13
Genetic labeling of urethane-induced lung adenocarcinomas in four lineage reporter strains on the C57BL/6 background: data summary.
XY plot of percentage of GFP-labeled tumors/lung versus GFP-labeled tumor cells/tumor averaged per lung in strains from Figure 1—figure supplement 12 (n = 30, 22, 18, and 20/group, respectively). …
-
Figure 1—figure supplement 13—source data 1
Quantification of GFP+ tumors/lung and GFP+ cells/tumor in four lineage reporter mice after urethane exposure.
- https://doi.org/10.7554/eLife.45571.022
Figure 1—figure supplement 14
Genetic labeling of MCA/BHT-induced lung adenocarcinomas in two lineage reporter strains on the C57BL/6 background: representative images.
Single-channel (endogenous TOMATO and GFP labeling and Hoechst 33258 nuclear stain) and merged images of lung hyperplasias and tumors (dashed outlines) of TOMATO and GFP;CCSP.CRE mice at six months …
Figure 1—figure supplement 15
Protein marker expression of urethane-induced lung adenocarcinomas in three lineage-labeled mouse strains on the C57BL/6 background: representative images.
Lineage marker protein-stained lung adenocarcinomas (dashed outlines) from genetically marked mice (n = 10/group). Note the genetic GFP-labeled tumor cells of GFP;CCSP.CRE mice that have lost CCSP …
Figure 1—figure supplement 16
Genetic lineage labels of protein-marked cells in three lineage reporter strains on the FVB background: representative images.
Representative merged fluorescent microscopic images from lineage marker-stained lung sections of 6-week-old lineage reporter mice (n = 5/group). Arrows indicate cells expressing the respective …
Figure 1—figure supplement 17
A single-hit mouse model for urethane-induced lung adenocarcinoma induction in naturally susceptible FVB mice.
Schematic of single-hit urethane administration tailored to yield 100% tumor incidence in FVB mice: one intraperitoneal injection of 1 g/Kg urethane (ethyl carbamate, EC; gray arrow) is delivered at …
Figure 1—figure supplement 18
High-throughput epifluorescent detection of genetic labeling of urethane-induced lung adenocarcinomas in four lineage reporter strains on the FVB background: representative images.
Representative photographs (top) and green (middle) and red (bottom) epifluorescence images of tumor-bearing lungs from genetically lineage-marked FVB mice at six months after a single …
Figure 1—figure supplement 19
Genetic labeling of urethane-induced lung adenocarcinomas in three lineage reporter strains on the FVB background: representative images.
Representative merged fluorescent microscopic images of lineage marker protein-stained lung tumors (dashed outlines) from genetically marked mice (FVB background) at six months after a single …
Figure 2 with 1 supplement
Airway cells sustain KrasQ61R mutations inflicted by urethane and give rise to juxtabronchial lung adenocarcinomas.
(A) DNA was extracted from the lungs of GFP;CCSP.CRE and GFP;LYZ2.CRE mice (FVB strain) one and two weeks post-urethane treatment (n = 5/group). Summary of duplexed digital droplet PCR (ddPCR) …
-
Figure 2—source data 1
Quantification ofKrasmutant droplets in duplexed digital droplet PCR (ddPCR).
- https://doi.org/10.7554/eLife.45571.031
-
Figure 2—source data 2
Quantification of tumor airway link.
- https://doi.org/10.7554/eLife.45571.032
Figure 2—figure supplement 1
Airway cells sustain KrasQ61R mutations inflicted by urethane.
DNA was extracted from the lungs of GFP;CCSP.CRE and GFP;LYZ2.CRE mice (FVB strain) one and two weeks post-urethane treatment (n = 5/group). Representative gating strategy of digital droplet PCR …
Figure 3 with 6 supplements
Expansion of airway cells in the tumor-initiated lung.
(A) Non-neoplastic alveolar regions from lung sections of saline-, urethane (ethyl carbamate, EC)-, and 3-methyl-1,2-dyhydrobenzo[j]aceanthrylene/butylated hydroxytoluene (MCA/BHT)-treated GFP;CCSP.C…
Figure 3—figure supplement 1
Airway-labeled cells in the alveoli of carcinogen-exposed C57BL/6 mice: representative images.
Single-channel microscopy images (endogenous TOMATO and GFP labeling with Hoechst 33258 nuclear stain) of non-neoplastic alveolar regions of GFP;CCSP.CRE mice treated as in Figure 3A.
Figure 3—figure supplement 2
Airway-labeled cells in the alveoli of carcinogen-exposed C57BL/6 mice: data summary.
Data summary (shown as violin plot) from GFP;CCSP.CRE mice treated as in Figure 3A (n = 10/group). P, overall probability, one-way ANOVA. ns and **: p>0.05 and p<0.01 for the indicated comparisons, …
-
Figure 3—figure supplement 2—source data 1
Quantification of alveolar GFP+ cells in GFP;CCSP.CRE mice after carcinogen hit.
- https://doi.org/10.7554/eLife.45571.040
Figure 3—figure supplement 3
Airway-labeled cells in the alveoli of carcinogen-exposed mice express SFTPC.
Single-channel images of non-neoplastic distal lung regions of urethane-treated GFP;CCSP.CRE mice at six months into treatment (n = 22), stained for the lung cell markers Clara cell secretory …
Figure 3—figure supplement 4
Airway-labeled cells in environmental-induced lung tumors express SFTPC.
Juxtabronchial regions, alveolar hyperplasias, and tumors (dashed lines) of lungs from urethane-treated GFP;CCSP.CRE mice at six months into treatment (n = 22) stained for lineage marker proteins …
Figure 3—figure supplement 5
In vivo bioluminescent detection of the airway lineage in the lungs of saline- and carcinogen-treated mice.
Representative merged bioluminescence/photographic images (left) and data summary (right) of LUC;CCSP.CRE mice (FVB background) before and seven months after saline (one intraperitoneal injection of …
-
Figure 3—figure supplement 5—source data 2
Quantification of chest bioluminescence signal in LUC;CCSP.CRE mice after urethane exposure.
- https://doi.org/10.7554/eLife.45571.041
Figure 3—figure supplement 6
Human lung adenocarcinomas co-express airway and alveolar markers.
Co-staining of human lung adenocarcinomas for SFTPC and either CCSP (A; n = 10) or KRT5 (B; n = 10) shows absence of CCSP expression and significant co-localization of SFTPC and KRT5 in a subset of …
Figure 4 with 4 supplements
Airway cells in alveolar repair.
(A) Non-neoplastic alveolar regions from lung sections of aging GFP;CCSP.CRE mice (bottom right section is also SFTPC-immunostained) show increasing numbers of alveolar GFP-labeled cells with age …
-
Figure 4—source data 1
Quantification of alveolar GFP+ cells in GFP;CCSP.CRE mice during aging.
- https://doi.org/10.7554/eLife.45571.047
-
Figure 4—source data 2
Quantification of SFTPC+ and GFP+ cells in GFP;CCSP.CRE mice after bleomycin treatment.
- https://doi.org/10.7554/eLife.45571.048
-
Figure 4—source data 3
Data of mean linear intercept and GFP+/SFTPC+cells in GFP;CCSP.CRE mice after hyperoxia treatment.
- https://doi.org/10.7554/eLife.45571.049
-
Figure 4—source data 4
Data of GFP+/SFTPC+ cells in GFP;CCSP.CRE and GFP;LYZ2.CRE mice after naphthalene treatment.
- https://doi.org/10.7554/eLife.45571.050
Figure 4—figure supplement 1
Alveolar type II cell ablation using bleomycin pre-treatment increases airway-labeled cells in urethane-induced lung tumors: representative images.
Representative epifluorescence (top) and merged fluorescent microscopy (bottom) images of tumor-bearing lungs and lung tumors of six-week-old GFP;CCSP.CRE mice that received intratracheal saline or …
Figure 4—figure supplement 2
Alveolar type II cell ablation using bleomycin pre-treatment increases airway-labeled cells in urethane-induced lung tumors: data summary.
Violin plot of GFP-labeled tumors/mouse (n = 6 mice/group) and GFP-labeled cells/tumor (n = 12 tumors/group; n = 2 tumors/mouse were examined) from experiment described in Figure 4—figure supplement …
-
Figure 4—figure supplement 2—source data 1
Quantification of GFP+ tumors/lung and GFP+ cells/tumor in GFP;CCSP.CRE mice after bleomycin and urethane treatment.
- https://doi.org/10.7554/eLife.45571.051
Figure 4—figure supplement 3
Airway epithelial cell ablation using naphthalene is restored by airway-labeled cells: representative images.
Representative fluorescent microscopic images of lungs of GFP;CCSP.CRE mice at different time-points after intraperitoneal injection of 250 mg/Kg naphthalene given at six weeks of age. Shown are …
Figure 4—figure supplement 4
Airway epithelial cell ablation by naphthalene: data summary.
Violin plot of percentage of GFP-labeled airway cells from experiment described in Figure 4—figure supplement 3 (n = 6 mice/time-point). P, overall probability, one-way ANOVA. ***: p<0.001 for the …
-
Figure 4—figure supplement 4—source data 2
Quantification of GFP+ airway cells in GFP;CCSP.CRE mice after naphthalene treatment.
- https://doi.org/10.7554/eLife.45571.052
Figure 5 with 2 supplements
Airway cell-ablated mice display alveolar destruction and are protected from carcinogenesis.
(A) Lineage marker-immunostained lung sections of 12-week-old GFP;CCSP.CRE;DTA and GFP;LYZ2.CRE;DTA mice (n = 6/group) show increased bronchial and alveolar size and flat CCSP+ SFTPC+ LYZ2+ cells in …
-
Figure 5—source data 1
Quantifications of data shown in Figure 5C.
- https://doi.org/10.7554/eLife.45571.056
-
Figure 5—source data 2
Quantifications of data shown in Figure 5D and E.
- https://doi.org/10.7554/eLife.45571.057
Figure 5—figure supplement 1
Triple transgenic mouse models for validation of genetic pulmonary lineage ablation: representative images.
Representative lung sections of 12-week-old GFP;CCSP.CRE, GFP;LYZ2.CRE, GFP;CCSP.CRE;DTA, and GFP;LYZ2.CRE;DTA mice (n = 6/group). Shown are merges of Hoechst 33258-stained endogenous TOMATO- and …
Figure 5—figure supplement 2
Triple transgenic mouse models for validation of genetic pulmonary lineage ablation: data summary.
Violin plot of GFP-labeling of lung sections of 12-week-old mice from Figure 5—figure supplement 1 (n = 6/group). Note the complete ablation of airway cells in GFP;CCSP.CRE mice and the persistence …
-
Figure 5—figure supplement 2—source data 1
Data of GFP+ cells in airways and alveoli of GFP;CCSP.CRE, GFP;CCSP.CRE;DTA, GFP;LYZ2.CRE and GFP;LYZ2.CRE;DTA mice.
- https://doi.org/10.7554/eLife.45571.058
Figure 6 with 6 supplements
Airway and alveolar signatures in murine and human lung adenocarcinoma (LUAD).
(A, B) RNA of mouse urethane-induced LUAD cell lines, lungs obtained pre- and one week post-urethane treatment, airway epithelial cells (AEC), alveolar type II cells (ATII), and bone marrow-derived …
-
Figure 6—source data 1
Cross-examination of signature genes of murine AEC, ATII cells, BMDM, LUAD cells and lungs.
- https://doi.org/10.7554/eLife.45571.066
-
Figure 6—source data 2
Cross-examination of signature genes of human AEC, ATII cells, BMDM, LUAD cells and lungs.
- https://doi.org/10.7554/eLife.45571.067
-
Figure 6—source data 3
Quantification of gene set enrichment analyses data shown in Figure 6E.
- https://doi.org/10.7554/eLife.45571.068
-
Figure 6—source data 4
Quantification of gene set enrichment analyses data shown in Figure 6F.
- https://doi.org/10.7554/eLife.45571.069
Figure 6—figure supplement 1
Lineage-specific gene expression in mouse lung adenocarcinoma cell lines induced by urethane compared with mouse lungs.
RNA of mouse urethane-induced lung adenocarcinoma (LUAD) cell lines, lungs obtained pre- and one week post-urethane treatment, and airway epithelial cells (AEC), alveolar type II cells (ATII), and …
Figure 6—figure supplement 2
Loss of lineage marker expression in mouse lung adenocarcinoma cell lines induced by urethane.
Mean expression levels of selected transcripts, including lineage markers and markers of histologic subtype in lung adenocarcinoma (LUAD) cell lines compared with lungs pre- and one week …
-
Figure 6—figure supplement 2—source data 1
Quantification of gene expression levels of data shown in Figure 6—figure supplement 2.
- https://doi.org/10.7554/eLife.45571.070
Figure 6—figure supplement 3
Loss of lineage marker expression in mouse lung adenocarcinoma cell lines induced by urethane compared with mouse lungs: heat maps.
528 genes differentially expressed between six different lung adenocarcinoma cell lines cultured from urethane-induced lung tumors and six benign respiratory mouse samples, including lungs of …
Figure 6—figure supplement 4
Loss of lineage marker expression in mouse lung adenocarcinoma cell lines induced by urethane compared with mouse lungs: volcano plot.
Shown are selected top over- and under-represented genes (arrows) from microarrays from Figure 6—figure supplement 2.
Figure 6—figure supplement 5
Mouse gene set enrichment analyses.
Shown are gene set enrichment analyses of airway epithelial cell (AEC), alveolar type II cell (ATII), and bone marrow-derived macrophage (BMDM) transcriptome signatures in mouse lungs (top) and …
Figure 6—figure supplement 6
Human gene set enrichment analyses.
Affymetrix Human Gene ST1.0 microarrays hybridized with RNA of human lung adenocarcinomas (LUAD; n = 40), never-smoker lung tissues (n = 30), primary airway epithelial cells (AEC; n = 5), primary …
Figure 7
Proposed role of airway-marked cells in murine lung maintenance and adenocarcinoma.
(A) Our evidence supports the existence of distinct developmental ancestries for airway epithelial (AEC) and alveolar type II (ATII) cells, notwithstanding their common descent from an early …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | C57BL/6 | Jackson Laboratory | Stock #: 000664; RRID:IMSR_JAX:000664 | |
| Strain, strain background (M. musculus) | FVB | Jackson Laboratory | Stock #: 001800; RRID:IMSR_JAX:001800 | |
| Genetic reagent (M. musculus) | TOMATO | Jackson Laboratory | Stock #: 007676; RRID:IMSR_JAX:007676 | Muzumdar et al., 2007 |
| Genetic reagent (M. musculus) | LUC | Jackson Laboratory | Stock #: 005125; RRID:IMSR_JAX:005125 | Safran et al., 2003 |
| Genetic reagent (M. musculus) | DTA | Jackson Laboratory | Stock #: 009669; RRID:IMSR_JAX:009669 | Voehringer et al., 2008 |
| Genetic reagent (M. musculus) | LYZ2.Cre | Jackson Laboratory | Stock #: 004781; RRID:IMSR_JAX:004781 | PMID: 10621974 |
| Genetic reagent (M. musculus) | SOX2.Cre | Jackson Laboratory | Stock #: 008454; RRID:IMSR_JAX:008454 | Hayashi et al., 2002 |
| Genetic reagent (M. musculus) | VAV.Cre | Jackson Laboratory | Stock #: 008610; RRID:IMSR_JAX:008610 | Ogilvy et al., 1998 |
| Genetic reagent (M. musculus) | NES.Cre | Jackson Laboratory | Stock #: 003771; RRID:IMSR_JAX:003771 | Tronche et al., 1999 |
| Genetic reagent (M. musculus) | CCSP.Cre | European Mouse Mutant Archive | Stock #: EM:04965; RRID:IMSR_M231009 | Oikonomou et al., 2012 |
| Genetic reagent (M. musculus) | SFTPC.Cre | Mouse Genome Informatics | RRID:MGI:3574949 | Okubo et al., 2005 |
| Cell line (M. musculus) | LUAD cells | PMID: 30828726 | Derived from urethane models | |
| Biological sample (Homo sapiens) | Lung adenocarcinomas | Giopanou et al., 2015 | Archival samples of patients with LUAD | |
| Antibody | rabbit poyclonal anti-PCNA | Abcam | Cat. #: ab2426; RRID:AB_303062 | IHC (1:3000) |
| Antibody | rabbit monoclonal anti-LYZ2 | Abcam | Cat. #: ab108508; RRID:AB_10861277 | IF (1:50) |
| Antibody | rabbit polyclonal anti-KRT5 | Abcam | Cat. #: ab53121; RRID:AB_869889 | IF (1:200) |
| Antibody | rabbit polyclonal anti-SFTPC | Santa Cruz Biotechnology | Cat. #: sc-13979; RRID:AB_2185502 | IF (1:200) |
| Antibody | rabbit polyclonal anti-CCSP | Santa Cruz Biotechnology | Cat. #: sc-25555; RRID:AB_2269914 | IF (1:200) |
| Antibody | goat polyclonal anti-CCSP | Santa Cruz Biotechnology | Cat. #: sc-9772; RRID:AB_2238819 | IF (1:1000) |
| Antibody | mouse monoclonal anti-acetylated α-tubulin | Sigma-Aldrich | Cat. #: T7451; RRID:AB_609894 | IF (1:2000) |
| Antibody | rabbit polyclonal anti-SFTPC | Merck-Millipore | Cat. #: AB3786; RRID:AB_91588 | IF (1:500) |
| Antibody | mouse monoclonal anti-KRT5 MA5-17057, | Thermo Fisher Scientific | Cat. #: MA5-17057; RRID:AB_2538529 | IF (1:200) |
| Antibody | mouse monoclonal anti-CD45 FITC conjugated | eBioscience | Cat. #: 11-0451-85; RRID:AB_465051 | FC (0,05 μg) |
| Antibody | mouse monoclonal anti-CD11b PE conjugated | eBioscience | Cat. #: 12-0112-82; RRID:AB_2734869 | FC (0,05 μg) |
| Antibody | donkey polyclonal anti-rabbit Alexa Fluor 488 | Molecular Probes | Cat. #: A21206; RRID:AB_141708 | IF (1:500) |
| Antibody | donkey polyclonal anti-goat Alexa Fluor 568 | Molecular Probes | Cat. #: A11057; RRID:AB_142581 | IF (1:500) |
| Antibody | donkey polyclonal anti-rabbit Alexa Fluor 647 | Molecular Probes | Cat. #: A31573; RRID:AB_2536183 | IF (1:500) |
| Antibody | donkey polyclonal anti-mouse Alexa Fluor 647 | Molecular Probes | Cat. #: A31571; RRID:AB_162542 | IF (1:500) |
| Antibody | donkey polyclonal anti-mouse Alexa Fluor 568 | Abcam | Cat. #: ab175700 | IF (1:500) |
| Sequence-based reagent | Digital droplet PCR primers | This paper | KrasQ61R mutation detection | Forward: ATCTGACGTGCTTTGCCTGT, Reverse: CCCTCCCCAGTTCTCATGTA |
| Sequence-based reagent | Digital droplet PCR probe | This paper | KrasQ61Rmutation detection | sequence: GACACAGCAGGTCAAGAGGAGTACA |
| Sequence-based reagent | Digital droplet PCR primers and probe | Bio-Rad Laboratories | Registration #: dCNS685684912 | Tomato allele detection |
| Sequence-based reagent | Quantitative PCR | This paper | Scgb1a1 gene | Forward: ATCACTGTGGTCATGCTGTCC, Reverse: GCTTCAGGGATGCCACATAAC |
| Sequence-based reagent | Quantitative PCR | This paper | Sftpc gene | Forward: TCGTTGTCGTGGTGATTGTAG, Reverse: TCGTTGTCGTGGTGATTGTAG |
| Sequence-based reagent | Quantitative PCR | This paper | Gusb gene | Forward: TTACTTTAAGACGCTGATCACC, Reverse: ACCTCCAAATGCCCATAGTC |
| Commercial assay or kit | GenElute Mammalian Genomic DNA Minipreps Kit | Sigma-Aldrich | Cat. #: G1N70 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Cat. #: 74106 | |
| Commercial assay or kit | SYBR FAST qPCR Kit | Kapa Biosystems | Cat. #: KK4600 | |
| Commercial assay or kit | MycoAlert Mycoplasma Detection Kit | LONZA | Cat. #: LT07-318 | |
| Chemical compound, drug | Urethane, ethyl carbamate (EC) | Sigma-Aldrich | Cat. #: U2500 | 1 g/Kg |
| Chemical compound, drug | 3-methylcholanthrene (MCA) | Sigma-Aldrich | Cat. #: 442388 | 15 mg/Kg |
| Chemical compound, drug | Butylated hydroxytoluene (BHT) | Sigma-Aldrich | Cat. #: W218405 | 200 mg/Kg |
| Chemical compound, drug | Naphthalene | Sigma-Aldrich | Cat. #: 84679 | 250 mg/Kg |
| Chemical compound, drug | Bleomycin A2 | Calbiochem | Cat. #: 203401 | 0.08 units |
| Software, algorithm | Transcriptome Analysis Console Software | https://www.thermofisher.com/tw/zt/home/life-science/microarray-analysis/microarray-analysis-instruments-software-services/microarray-analysis-software/affymetrix-transcriptome-analysis-console-software.html | RRID:SCR_016519 | |
| Software, algorithm | FlowJo software | TreeStar | RRID:SCR_008520 | |
| Software, algorithm | FloMax Software | Partec | RRID:SCR_014437 | |
| Software, algorithm | Broad Institute pre-ranked GSEA module software | http://software.broadinstitute.org/gsea/index.jsp | Subramanian et al., 2005 | |
| Software, algorithm | NRECON software | Bruker | ||
| Software, algorithm | CT analysis (Ctan) software | Bruker | ||
| Software, algorithm | CTVox software | Bruker | ||
| Software, algorithm | QuantaSoft | Bio-Rad Laboratories (http://www.bio-rad.com/en-gr/sku/1864011-quantasoft-software-regulatory-edition?ID=1864011) | ||
| Software, algorithm | G*power | http://www.gpower.hhu.de/ | RRID:SCR_013726 | Faul et al., 2007 |
| Software, algorithm | GraphPad Prism | http://www.graphpad.com/ | RRID:SCR_002798 | Version 8 |
| Software, algorithm | Fiji | http://fiji.sc | RRID:SCR_002285 | PMID: 22743772 |
| Software, algorithm | Living Image software | Perkin-Elmer (http://www.perkinelmer.com/catalog/category/id/living%20image%20software) | RRID:SCR_014247 | Version 4.2 |
| Other | Microarray data | This paper | Gene Expression Omnibus (GEO) accession ID: GSE94981 | LUAD cells, bone marrow derived macrophages (BMDM), and tracheal AEC cells |
| Other | Microarray data | Gene Expression Omnibus (GEO) | Accession ID: GSE82154; GSE55459; GSE46749; GSE18816; GSE43458 | M. musculus ATII cells; H. sapiens AEC cells; H. sapiens ATII cells;H. sapiensAMΦ; H. sapiens non-smokers lung and LUAD |
| Other | GeneChip Mouse Gene 2.0 ST array; GeneChip Human Gene1.0 ST array | Thermo Fisher Scientific | Cat. #: 902119; Cat. #: 901085 | |
| Other | Hoechst33258 nuclear dye | Sigma-Aldrich | Cat. #: 14530 | 1:5000 |
| Other | D-Luciferin potassium salt | Gold Biotechnology | Cat. #: LUCK-100 | 1 mg |
| Other | Trizol | Thermo Fisher Scientific | Cat. #: 15596026 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.45571.072
