Ceapins block the unfolded protein response sensor ATF6α by inducing a neomorphic inter-organelle tether
- University of California, San Francisco, United States
- Howard Hughes Medical Institute, University of California, San Francisco, United States
- Vanderbilt University, United States
- Chan Zuckerberg Biohub, United States
Figures
Figure 1 with 2 supplements
ABCD3 KD desensitizes cells to Ceapin-A7.
(A) Schematic of the ER stress element (ERSE) reporter cassette. K562 ERSE reporter cells were transduced with the indicated sgRNAs and treated with vehicle (DMSO) or tunicamycin (Tm) (6 μg/ml) for …
-
Figure 1—source data 1
Reporter phenotypes and p values for genes in CRISPRi screen.
- https://doi.org/10.7554/eLife.46595.005
Figure 1—figure supplement 1
Genome-scale CRISPRi screen to identify molecular target of Ceapin.
(A and B) K562 ERSE reporter cells were transduced with the indicated sgRNAs and treated with vehicle (DMSO) or tunicamycin (Tm) (6 μg/ml) for 16 hr. (C) Reporter phenotypes from CRISPRi screens …
Figure 1—figure supplement 2
ABCD3 KD does not affect ATF6α nuclear translocation.
Quantification of nuclear translocation of ATF6α. Endogenous ABCD3 was knocked-down in 3xFLAG-ATF6α HEK293 CRISPRi cells and full length GFP-ABCD3 construct was added back by FACS soring for narrow, …
Figure 2 with 3 supplements
ABCD3 is required for Ceapin-induced ATF6α foci.
(A) HEK293 CRISPRi cells stably expressing doxycycline inducible 3xFLAG-ATF6α with ABCD3 or NegCtrl KD were treated either with DMSO or Ceapin (6 μM) for 30 min prior to fixation, staining with …
Figure 2—figure supplement 1
ABCD3 is not co-translationally translocated into the ER.
Data from Jan et al. (2014) is plotted. Gene enrichments obtained with the general BirA-Sec61ß ER marker in HEK293 cells and signal sequence (SS) annotations predicted by SignalP. ABCD4 was …
Figure 2—figure supplement 2
Ceapin-induced ATF6α foci colocalize with peroxisomal matrix protein Thiolase.
(A) 3xFLAG-ATF6α HEK293 CRISPRi cells with NegCtrl KD were treated and fixed as in Figure 2A and stained for Thiolase. Scale bar, 10 μm. (B) Quantification of the correlation of ATF6α and Thiolase …
Figure 2—figure supplement 3
PEX19 KD desensitizes cells to Ceapin and is required for Ceapin-induced ATF6α foci.
(A) K562 ERSE reporter cells with NegCtrl or PEX19 sgRNA KD were treated with ER stressor (6 μg/ml Tm) and increasing concentrations of Ceapin-A7 for 16 hr. Reporter fluorescence was measured by …
Figure 3
Ceapin treatment does not inhibit ABCD3 activity.
Bile acid levels were measured in HepG2 CRISPRi cells with NegCtrl or ABCD3 KD treated with vehicle (DMSO), EC50 of Ceapin (600 nM), and ten times the EC50 of Ceapin-A7 (6 μM).
Figure 4
Ceapin-induced ATF6α-ABCD3 interaction does not require known ER-peroxisome tethers.
(A) ER tether components, VAPA and VAPB, and peroxisome tether components, ACBD4 and ACBD5, were individually knocked-down in 3xFLAG-ATF6α HEK293 CRISPRi cell line, treated, fixed, and stained as in …
Figure 5 with 2 supplements
Ceapin-induced interactions do not require ER localized ATF6α nor ABCD3 transporter activity.
(A) Diagram of GFP-ATF6α constructs tested. A nuclear exit signal (NES) was added to ATF6α truncated constructs to retain ATF6α in the cytosol. Endogenous ATF6α was knocked-down in 3xFLAG-ATF6α …
Figure 5—figure supplement 1
ATF6α(2-90) colocalizes with peroxisomal matrix protein Thiolase.
(A) Endogenous ATF6 was knocked-down in U2OS Flp-In CRISPRi cells and FACS sorted for narrow, low GFP levels so only GFP-ATF6α(2-90) construct was expressed. Cells were treated and fixed as in Figure…
Figure 5—figure supplement 2
ABCD3 constructs localization to peroxisome.
Endogenous ABCD3 was knocked-down in 3xFLAG-ATF6α HEK293 CRISPRi cells and FACS sorted for narrow, low GFP levels so only GFP-ABCD3 constructs were expressed. GFP-ABCD3 cell lines were treated with …
Figure 6
Ceapin drives ATF6α-ABCD3 interaction in cells and in vitro.
(A and B) Proteomic analysis and immunoblot (IB) of anti-FLAG affinity purification from 3xFLAG-ATF6α HEK293 cells treated with stress (100 nM Tg) and inactive Ceapin-A5 analog (6 μM) or active …
-
Figure 6—source data 1
Excel spreadsheet showing all the proteins identified with affinity-purified FLAG-ATF6 treated with ER stress and Ceapin-A5 or Ceapin-A7.
- https://doi.org/10.7554/eLife.46595.016
Figure 7
Model for Ceapin induced ATF6α inhibition.
Ceapins sequester ATF6α into a transport-incompetent pool during ER stress by tethering ATF6α to peroxisomal ABCD3. ATF6α is occluded from COPII trafficking, while its transmembrane domain remains …
Tables
Table 1
Protospacer sequence of sgRNAs.
https://doi.org/10.7554/eLife.46595.018| Gene | Protospacer |
|---|---|
| NegCtrl | GCGCCAAACGTGCCCTGACGG |
| ATF6 | GTGGGATCTGAGAATGTACCA |
| ABCD3-1 | GGTACCAGCGAGCCGGCGAG |
| ABCD3-2 | GACTGCCGGTACCAGCGAGC |
| PEX19-1 | GGCCGAAGCGGACAGGGAAT |
| PEX19-2 | GGAGGAAGGCTGTAGTGTCG |
| ACBD4 | GCCGGCCCTGCTGGACCCCG |
| ACBD5 | GGGAGCCGCTCTCCCACCCT |
| VAPA | GCACCGAACCGGTGACACAG |
| VAPB | GCGGGGGTCCTCTACCGGGT |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.46595.019
