Misfolded GPI-anchored proteins are escorted through the secretory pathway by ER-derived factors
- MRC Laboratory of Molecular Biology, United Kingdom
Figures
Figure 1 with 1 supplement
A stable-inducible cell line to study GPI-anchored protein quality control.
(A) HEK293-TRex cells containing either GFP-PrP or GFP-PrP* stably integrated at the same locus were induced to express the proteins with doxycycline for 48 hr prior to analysis by immunoblotting …
Figure 1—figure supplement 1
Effect of Brefeldin A on GFP-PrP* degradation.
Cells expressing GFP-PrP* were treated for 3 hr with vehicle (DMSO) or 100 nM thapsigargin (Tg) without or with 2.5 µg/ml Brefeldin A. 100 µg/ml cycloheximide was included in all samples during the …
Figure 2 with 1 supplement
Misfolded PrP is detectable at the cell surface prior to lysosomal degradation.
(A) Cells expressing GFP-PrP and GFP-PrP* were incubated on ice with 200 nM extracellular Alexa647-conjugated Nb and Alexa647 fluorescence was measured by flow cytometry. Uninduced cells were …
Figure 2—figure supplement 1
Characterization of Nb surface staining and isolation.
(A) Cells expressing GFP-PrP were incubated on ice with varying concentrations of Alexa647-Nb, washed, and analyzed for Alexa647 fluorescence by flow cytometry. (B) GFP-PrP* on the cell surface was …
Figure 3 with 1 supplement
The majority of misfolded PrP transits the cell surface en route to lysosomes.
(A) Experimental strategy to measure GFP-PrP* transit through the cell surface (top) relative to a known standard generated by saturating surface labeling of GFP-PrP cells. (B) Cells expressing …
Figure 3—figure supplement 1
Additional characterization of GFP-PrP* trafficking.
(A) Cells expressing GFP-PrP* (or uninduced controls) were allowed to internalize Alexa546-Nb for 3 hr, after which the cells were washed, put into Nb-free medium, and further cultured for the …
Figure 4 with 1 supplement
A complex of several TMED proteins facilitates GFP-PrP* degradation.
(A) Wild type (WT) or TMED10 knockout (KO) cells expressing GFP-PrP* were assayed for thapsigargin-stimulated extracellular Nb uptake as in Figure 3D. In addition, the KO cells were transiently …
Figure 4—figure supplement 1
Additional characterization of TMED family members.
(A) Cell lysates prepared under non-denaturing conditions were separated by size on a 5–25% sucrose gradient, and analyzed by immunoblotting. Purified recombinant nanobody (18 kDa) peaks in fraction …
Figure 5 with 1 supplement
Proteomic analysis of PrP* interactions during its trafficking to lysosomes.
(A) Cells expressing GFP-PrP and GFP-PrP* were lysed under non-denaturing conditions, affinity purified via immobilized anti-GFP Nb, separated by SDS-PAGE, and stained with SYPRO-Ruby. The positions …
-
Figure 5—source data 1
Complete tandem mass tagging mass spectrometry data.
The eight samples corresponding to the four time points each for WT and ∆TMED10 cells from Figure 5D were analyzed by tandem mass tagging (TMT) quantitative proteomics and the data tabulated in the Excel table. Each tab of the Excel table illustrates the sequential steps in the normalization and analysis of the raw data, ending in the graph depicted in Figure 5E.
- https://doi.org/10.7554/eLife.46740.012
Figure 5—figure supplement 1
Additional analysis of GFP-PrP* interaction partners.
(A) Independent replicate of the affinity purification experiment shown in Figure 5A. The two lanes corresponding to GFP-PrP and GFP-PrP* are from the same gel and exposure, with the vertical line …
Figure 6 with 2 supplements
Cell surface PrP* is associated with ER-derived factors.
(A) Cells expressing GFP-PrP and GFP-PrP* were labeled on ice with saturating levels of extracellular Nb-FLAG, lysed under non-denaturing conditions, and separated by size on a 5–25% sucrose …
Figure 6—figure supplement 1
Characterization of cell surface GFP-PrP* complexes.
(A) Cells expressing GFP-PrP or GFP-PrP* were labeled on ice with saturating levels of Nb-FLAG, washed, and lysed under non-denaturing conditions. The Nb-FLAG complexes were immunopurified via the …
Figure 6—figure supplement 2
Characterization of APEX2-mediated biotinylation.
(A) Cells expressing GFP-PrP were surface labeled with 200 nM Nb-APEX2, washed, and incubated with biotin-phenol and H2O2 for the time indicated prior to quenching. Cell lysates were analyzed for …
Figure 7 with 1 supplement
GPI-anchored protein acutely misfolded at the cell surface is not degraded.
(A) Cells transiently transfected with FKBP*-YFP-GPI for 48 hr were grown in the presence or absence of 2 µM Shield1, lysed, and immunoblotted using anti-GFP (which also detects YFP). (B) Cells …
Figure 7—figure supplement 1
Characterization of FKBP*-YFP-GFP cells.
(A) Cells stably expressing inducible FKBP*-YFP-GPI grown with or without Shield1 were allowed to internalize Alexa647-Nb from the culture medium in the presence of thapsigargin-induced ER stress …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HEK293T | ATCC CRL-3216 | RRID:CVCL_0063 | |
| Cell line (H. sapiens) | HEK293 TRex Flp-in | Invitrogen | RRID:CVCL_U427 | |
| Cell line (H. sapiens) | HEK293 TRex GFP-PrP* | This paper | GFP-PrP* (see below) integrated into FRT site of HEK293 Trex Flp-in cell line | |
| Cell line (H. sapiens) | HEK293 TRex GFP-PrP | This paper | GFP-PrP (see below) integrated into FRT site of HEK293 Trex Flp-in cell line | |
| Cell line (H. sapiens) | HEK293 TRex GFP-PrP* TMED10 KO | This paper | Disruption of TMED10 by CRISPR/Cas9 in GFP-PrP* cell line | |
| Cell line (H. sapiens) | HEK293 TRex GFP-PrP TMED10 KO | This paper | Disruption of TMED10 by CRISPR/Cas9 in GFP-PrP cell line | |
| Cell line (H. sapiens) | HEK293 TRex FKBP*-YFP-GPI | This paper | FKBP*-YFP-GPI (see below) integrated into FRT site of HEK293 Trex Flp-in cell line | |
| Antibody | rabbit polyclonal anti-GFP | Stefanovic and Hegde, 2007 | (1:5000) | |
| Antibody | rabbit polyclonal anti-RFP | Stefanovic and Hegde, 2007 | (1:3000) | |
| Antibody | mouse monoclonal anti-FLAG (M2)-HRP conjugated | Sigma | Cat #A8592, RRID:AB_439702 | (1:10000) |
| Antibody | rabbit polyclonal anti-TMED10 C-terminus | Satpute-Krishnan et al., 2014 | (1:1000) | |
| Antibody | rabbit polyclonal anti-TMED2 | Jenne et al., 2002 | (1:6000) | |
| Antibody | rabbit polyclonal anti-TMED10 lumenal domain | Jenne et al., 2002 | (1:5000) | |
| Antibody | rabbit polyclonal anti-TMED7 | Jenne et al., 2002 | (1:5000) | |
| Antibody | rabbit polyclonal anti-TMED9 | Jenne et al., 2002 | (1:3000) | |
| Antibody | rabbit polyclonal anti-CNX N-terminus | Enzo | Cat #ADI-SPA-865, RRID:AB_10618434 | (1:2000 – 1:5000) |
| Antibody | rabbit polyclonal anti-CNX C-terminus | Enzo | Cat #ADI-SPA-860, RRID:AB_10616095 | (1:2000) |
| Antibody | rabbit polyclonal anti tagRFP (also recognizes tagBFP) | evrogen | Cat #AB233, RRID:AB_2571743 | (1:2000) |
| Antibody | mouse monoclonal anti-alpha adaptin (AP2) | BD Biosciences | Cat #610502, RRID:AB_397868 | (1:3000) |
| Antibody | mouse monoclonal anti-Transferrin receptor | Invitrogen | Cat #136800, RRID:AB_2533029 | (1:500) |
| Recombinant DNA reagent | pRSET-Nanobody-3x FLAG-His | This paper | Nanobody sequence from Addgene plasmid #49172 | |
| Recombinant DNA reagent | pX330-TMED10 sgRNA2 | This paper | sgRNA targeting TMED10 | |
| Recombinant DNA reagent | pX330-TMED10 sgRNA3 | This paper | sgRNA targeting TMED10 | |
| Recombinant DNA reagent | pcDNA3-HA-TMED10 | This paper | Human TMED10 with HA tag following signal sequence | |
| Recombinant DNA reagent | pcDNA3-HA-TMED10 si2R | This paper | HA-tagged human TMED10 as above with silent mutations to confer resistance to Stealth RNAi TMED10HSS 145904 | |
| Recombinant DNA reagent | pcDNA3-HA-RFP-TMED10 | This paper | Human TMED10 with HA tag and RFP following signal sequence | |
| Recombinant DNA reagent | pcDNA3-HA-TMED10 ΔCC | This paper | Human HA-TMED10 lacking coiled-coil domain (amino acids 130–183) | |
| Recombinant DNA reagent | pcDNA3-HA-RFP-TMED10 ΔGOLD | This paper | Human HA-RFP-TMED10 with GOLD domain deleted (residues 41–129 of original protein) | |
| Recombinant DNA reagent | pcDNA3-HA-RFP-TMED10 ΔCC | This paper | Human HA-RFP-TMED10 lacking coiled-coil domain (amino acids 130–183) | |
| Recombinant DNA reagent | FKBP12-YFP-GPI | Sengupta et al., 2015 | ||
| Recombinant DNA reagent | FKBP*-YFP-GPI | This paper | F36V and L106P mutations introduced into FKBP12-YFP-GPI | |
| Recombinant DNA reagent | pcDNA5-FRT/TO-FKBP *-YFP-GPI | This paper | FKBP*-YFP-GPI subcloned into pcDNA5-FRT/TO for stable inducible expression | |
| Recombinant DNA reagent | FKBP*-BFP | This paper | FKBP* followed by BFP for cytosolic expression | |
| Recombinant DNA reagent | pET15b-HisFKBP*12 F36V | Addgene | Cat #73180, RRID:Addgene_73180 | |
| Recombinant DNA reagent | FusionRed-Dynamin S45N | Almeida-Souza et al., 2018 | Dominant-negative dynamin mutant | |
| Recombinant DNA reagent | pcDNA3-3xmyc-TMED2 | This paper | Human TMED2 with 3xmyc tag following signal sequence. | |
| Recombinant DNA reagent | pRSET-Nanobody- APEX2-3xFLAG-His | This paper | Nanobody-APEX2-FLAG for bacterial expression. APEX2 sequence from Addgene plasmid #49386 | |
| Recombinant DNA reagent | mGFP1-N1 | Clontech | ||
| Recombinant DNA reagent | pcDNA5-FRT/TO- EGFP-PrP* | This paper | C179A mutant of hamster PrP with bovine prolactin signal sequence; EGFP @ unique Bsu36I site downstream of signal sequence. | |
| Recombinant DNA reagent | pcDNA5-FRT/TO- EGFP-PrP | This paper | Wild-type human PrP, with EGFP @ unique Bsu36I site downstream of signal sequence. | |
| Sequence-based reagent | CRISPR: TMED10 sgRNA2 | IDT | TAACGGAAAAGGGCCGCGCC | |
| Sequence-based reagent | CRISPR: TMED10 sgRNA3 | IDT | GCAGCAACGCTAACGGAAAA | |
| Sequence-based reagent | siRNA: nontargeting control | Dharmacon | D-001810–10 | |
| Sequence-based reagent | siRNA: AP2 (alpha-adaptin) | Dharmacon | gift of B. Nichols lab (MRC-LMB) | |
| Sequence-based reagent | siRNA: nontargeting control | Thermo Fisher | 4390843 | Silencer Select |
| Sequence-based reagent | siRNA: TMED1 (a) | Thermo Fisher | s21699 | Silencer Select |
| Sequence-based reagent | siRNA: TMED1 (b) | Thermo Fisher | s21700 | Silencer Select |
| Sequence-based reagent | siRNA: TMED2 (a) | Thermo Fisher | s21570 | Silencer Select |
| Sequence-based reagent | siRNA: TMED2 (b) | Thermo Fisher | s21571 | Silencer Select |
| Sequence-based reagent | siRNA: TMED3 (a) | Thermo Fisher | s23799 | Silencer Select |
| Sequence-based reagent | siRNA: TMED3 (b) | Thermo Fisher | s23800 | Silencer Select |
| Sequence-based reagent | siRNA: TMED4 (a) | Thermo Fisher | s48156 | Silencer Select |
| Sequence-based reagent | siRNA: TMED4 (b) | Thermo Fisher | s48157 | Silencer Select |
| Sequence-based reagent | siRNA: TMED5 (a) | Thermo Fisher | s27202 | Silencer Select |
| Sequence-based reagent | siRNA: TMED5 (b) | Thermo Fisher | s27203 | Silencer Select |
| Sequence-based reagent | siRNA: TMED6 (a) | Thermo Fisher | s44861 | Silencer Select |
| Sequence-based reagent | siRNA: TMED6 (b) | Thermo Fisher | s44862 | Silencer Select |
| Sequence-based reagent | siRNA: TMED7 (a) | Thermo Fisher | s27238 | Silencer Select |
| Sequence-based reagent | siRNA: TMED7 (b) | Thermo Fisher | s27239 | Silencer Select |
| Sequence-based reagent | siRNA: TMED9 (a) | Thermo Fisher | s29353 | Silencer Select |
| Sequence-based reagent | siRNA: TMED9 (b) | Thermo Fisher | s29354 | Silencer Select |
| Sequence-based reagent | siRNA: TMED10 | Thermo Fisher | HSS145904 | Stealth siRNA |
| Sequence-based reagent | siRNA: negative control | Thermo Fisher | 46–2001 | Stealth siRNA |
| Peptide, recombinant protein | Nanobody-FLAG-His | This paper | purified from E. coli (BL21) pLysS cells using immobilized metal affinity chromatography | |
| Peptide, recombinant protein | Nanobody-FLAG-APEX2 | This paper | purified from E. coli (BL21) pLysS cells using immobilized metal affinity chromatography | |
| Peptide, recombinant protein | FKBP12 (F36V) | Egeler et al., 2011 | purified from E. coli (BL21) pLysS cells using immobilized metal affinity chromatography | |
| Chemical compound, drug | Thapsigargin | Sigma | Cat #T9033 | |
| Chemical compound, drug | Bafilomycin A1 | Sigma | Cat #B1793 | |
| Chemical compound, drug | Brefeldin A | Invitrogen | Cat #B7450 | |
| Chemical compound, drug | Shield1 | Clontech/Takara | Cat #632189 | |
| Chemical compound, drug | Cycloheximide | Sigma | Cat #C4859 | |
| Chemical compound, drug | Alexa Fluor546 NHS Ester | Invitrogen | Cat #A20002 | |
| Chemical compound, drug | Alexa Fluor647 NHS Ester | Invitrogen | Cat #A37566 | |
| Chemical compound, drug | TMT labeling reagents | Thermo Fisher | Cat #90110 | |
| Chemical compound, drug | biotin-phenol | Iris Biotech | Cat #LS-3500 | |
| Other | GFP-trap | Chromotek | Cat #gta-20 | |
| Other | anti-FLAG M2 affinity resin | Sigma | Cat #A2220 | |
| Other | Streptavidin-HRP | Thermo Fisher | Cat #43–4323 | |
| Other | Streptavidin T1 Dynabeads | Invitrogen | Cat #65601 |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.46740.019
