N-chlorination mediates protective and immunomodulatory effects of oxidized human plasma proteins
- Ruhr University Bochum, Germany
Figures
Figure 1
HOCl-treated human serum decreases protein aggregation.
Human serum, when treated with a 10-fold molar excess of HOCl (Human serum 10xHOCl), significantly decreases aggregation of chemically denatured citrate synthase as measured by light scattering at …
-
Figure 1—source data 1
Numerical light scattering data obtained during protein aggregation assays represented in Figure 1a and b.
- https://doi.org/10.7554/eLife.47395.003
Figure 2 with 4 supplements
Conversion of serum albumin into a potent chaperone upon HOCl exposure is based on reversible N-chlorination of its basic amino acids.
(a, b) Serum albumin in different concentrations, when treated with a 10- or 50-fold molar excess of HOCl (HSA 10xHOCl and HSA 50xHOCl, respectively), significantly decreases aggregation of …
-
Figure 2—source data 1
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2a and b.
- https://doi.org/10.7554/eLife.47395.013
-
Figure 2—source data 2
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2c and d.
- https://doi.org/10.7554/eLife.47395.014
-
Figure 2—source data 3
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2e and f.
- https://doi.org/10.7554/eLife.47395.015
-
Figure 2—source data 4
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2g and h.
- https://doi.org/10.7554/eLife.47395.016
-
Figure 2—source data 5
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2i and j.
- https://doi.org/10.7554/eLife.47395.017
Figure 2—figure supplement 1
Serum albumin, when treated with a 50-fold molar excess of HOCl, significantly decreases aggregation of chemically denatured IlvA as measured by light scattering at 360 nm.
(a) Representative measurements are shown. (b) Data represented as means and standard deviations from three independent experiments. Student’s t-test: ***p<0.001. Aggregation of citrate synthase in …
-
Figure 2—figure supplement 1—source data 1
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2—figure supplement 1.
- https://doi.org/10.7554/eLife.47395.006
Figure 2—figure supplement 2
Serum albumin, when treated with a 50-fold molar excess of HOCl and then reduced with methionine, loses its propensity to decrease aggregation of chemically denatured citrate synthase.
(a) Representative measurements are shown. (b) Data represented as means and standard deviations from three independent experiments. Aggregation of citrate synthase in the absence of HSA was set to …
-
Figure 2—figure supplement 2—source data 1
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2—figure supplement 2.
- https://doi.org/10.7554/eLife.47395.008
Figure 2—figure supplement 3
Influence of reducing agents on the migration of HSA on reducing and non-reducing SDS PAGE gels.
(a) Untreated HSA and HSA treated with a 50-fold molar excess of HOCl and subsequently reduced with various reductants separated on a non-reducing gel. HOCl-treatment does not lead to accumulation …
-
Figure 2—figure supplement 3—source data 1
Original scans of gels represented in Figure 2—figure supplement 3.
- https://doi.org/10.7554/eLife.47395.010
Figure 2—figure supplement 4
Taurine N-chloramine, a model N-chloramine does not affect our light-scattering assay.
Taurine monochloramine was generated by incubation of 5 mM taurine with 50 µM HOCl. Taurine dichloramine was generated by incubation of 5 mM taurine with 10 mM HOCl. Untreated taurine or taurine …
-
Figure 2—figure supplement 4—source data 1
Numerical light scattering data obtained during protein aggregation assays represented in Figure 2—figure supplement 4.
- https://doi.org/10.7554/eLife.47395.012
Figure 3 with 1 supplement
N-chlorination of serum albumin decreases accessible amino group content and increases chloramine content and surface hydrophobicity.
(a, b) Amino group content of variously treated HSA was analyzed using fluorescamine. Treatment of HSA with HOCl resulted in a dose-dependent loss of free amino groups. Reduction of chlorinated HSA …
-
Figure 3—source data 1
Numerical fluorescence spectroscopy data obtained during determination of free amino groups represented in Figure 3a and b.
- https://doi.org/10.7554/eLife.47395.021
-
Figure 3—source data 2
Numerical fluorescence spectroscopy data obtained during determination of protein chloramines represented in Figure 3c.
- https://doi.org/10.7554/eLife.47395.022
-
Figure 3—source data 3
Numerical fluorescence spectroscopy data obtained during determination of protein chloramines represented in Figure 3d.
- https://doi.org/10.7554/eLife.47395.023
-
Figure 3—source data 4
Numerical fluorescence spectroscopy data obtained during determination of protein hydrophobicity represented in Figure 3e.
- https://doi.org/10.7554/eLife.47395.024
-
Figure 3—source data 5
Numerical fluorescence spectroscopy intensity data obtained during determination of protein hydrophobicity represented in Figure 3f.
- https://doi.org/10.7554/eLife.47395.025
Figure 3—figure supplement 1
Determination of the N-chloramine content of HOCl-treated HSA.
(a) Measurement of the standard curve using known concentrations of taurine monochloramine. The standard curve is shown in Figure 3c in the main manuscript. (b) Determination of the content of …
-
Figure 3—figure supplement 1—source data 1
Numerical fluorescence spectroscopy data obtained during determination of protein chloramines represented in Figure 3—figure supplement 1.
- https://doi.org/10.7554/eLife.47395.020
Figure 4 with 3 supplements
Activation of neutrophil-like cells by HOCl-treated serum albumin is mediated by reversible N-chlorination.
Treatment with a 50-fold molar excess of HOCl (HSA 50xHOCl) converted HSA into an efficient inducer of the neutrophil respiratory burst, reflected by the increased production and release of oxidants …
-
Figure 4—source data 1
Numerical chemiluminescence plate reader data represented in Figure 4a and c.
- https://doi.org/10.7554/eLife.47395.033
-
Figure 4—source data 2
Numerical chemiluminescence plate reader data represented in Figure 4b.
- https://doi.org/10.7554/eLife.47395.034
Figure 4—figure supplement 1
Activation of neutrophil-like cells by HOCl-treated serum albumin.
Treatment with a 50-fold molar excess of HOCl converted HSA into an efficient inducer of the neutrophil respiratory burst, irrespective of the preparation (1 mM HSA treated with 50 mM HOCl or 0.3 mM …
-
Figure 4—figure supplement 1—source data 1
Numerical chemiluminescence plate reader data represented in Figure 4—figure supplement 1.
- https://doi.org/10.7554/eLife.47395.028
Figure 4—figure supplement 2
N-chlorinated serum albumin converts 7‘-dichlorodihydrofluorescein diacetate (H2DCF-DA) to the fluorescent 2’, 7’-dichlorofluorescein (DCF).
H2DCF-DA is a commonly used fluorescent probe for monitoring intracellular production of reactive oxygen species. H2DCF-DA was preincubated with 1xPBS for 15 min prior to the addition of native HSA …
-
Figure 4—figure supplement 1—source data 1
Numerical chemiluminescence plate reader data represented in Figure 4—figure supplement 2.
- https://doi.org/10.7554/eLife.47395.030
Figure 4—figure supplement 3
Taurine N-chloride and hydrogen peroxide-treated HSA do not induce the respiratory burst in neutrophil-like cells.
(a) The model N-chloramine prepared in different ways (5 mM of taurine treated with either 50 µM or 10 mM of HOCl) at different molar excesses (1- or 99-fold the molarity of HSA used) did not lead …
-
Figure 4—figure supplement 3—source data 1
Numerical chemiluminescence plate reader data represented in Figure 4—figure supplement 3.
- https://doi.org/10.7554/eLife.47395.032
Figure 5
All plasma protein fractions tested exhibit reversible chaperone activity upon modification by HOCl.
α2-Macroglobulin (a, b), Cohn fraction IV (c, d) and the γ-globulin fraction (e, f) were analyzed for chaperone activity in a citrate synthase aggregation assay upon treatment with various doses of …
-
Figure 5—source data 1
Numerical light scattering data obtained during protein aggregation assays represented in Figure 5a and b.
- https://doi.org/10.7554/eLife.47395.036
-
Figure 5—source data 2
Numerical light scattering data obtained during protein aggregation assays represented in Figure 5c and d.
- https://doi.org/10.7554/eLife.47395.037
-
Figure 5—source data 3
Numerical light scattering data obtained during protein aggregation assays represented in Figure 5e and f.
- https://doi.org/10.7554/eLife.47395.038
Figure 6
The majority of human plasma proteins stimulate neutrophil respiratory burst upon N-chlorination by HOCl.
The effect of HOCl-treated α2-macroglobulin (α2M) (a, b), Cohn fraction IV (c, d) and the γ-globulin fraction (e, f) on the activity of the neutrophil NADPH oxidase was investigated. α2M, when …
-
Figure 6—source data 1
Numerical chemiluminescence plate reader data represented in Figure 6a and b.
- https://doi.org/10.7554/eLife.47395.040
-
Figure 6—source data 2
Numerical chemiluminescence plate reader data represented in Figure 6c and d.
- https://doi.org/10.7554/eLife.47395.041
-
Figure 6—source data 3
Numerical chemiluminescence plate reader data represented in Figure 6e and f.
- https://doi.org/10.7554/eLife.47395.042
Figure 7 with 1 supplement
Activation of the NADPH oxidase of neutrophil-like cells by HOCl-treated serum albumin and immunoglobulin G occurs predominantly via a PI3K-dependent signaling pathway.
Effect of 10 μM diphenyleneiodonium (DPI; NADPH oxidase inhibitor), 100 nM wortmannin (PI3K inhibitor) and 200 nM Gö 6983 (protein kinase C (PKC) inhibitor) on the NADPH oxidase activation mediated …
-
Figure 7—source data 1
Numerical chemiluminescence plate reader data represented in Figure 7a and d.
- https://doi.org/10.7554/eLife.47395.046
-
Figure 7—source data 2
Numerical chemiluminescence plate reader data represented in Figure 7b and d.
- https://doi.org/10.7554/eLife.47395.047
-
Figure 7—source data 3
Numerical chemiluminescence plate reader data represented in Figure 7c and d.
- https://doi.org/10.7554/eLife.47395.048
Figure 7—figure supplement 1
Addition of catalase, superoxide dismutase (SOD) or both inhibited immune cell-induced chemiluminescence of lucigenin.
(a) The addition of catalase (CAT), superoxide dismutase (SOD) or both to differentiated PLB-985 cells incubated with HOCl-treated HSA prevented lucigenin chemiluminescence. (b) Results shown in a …
-
Figure 7—figure supplement 1—source data 1
Numerical chemiluminescence plate reader data represented in Figure 7—figure supplement 1.
- https://doi.org/10.7554/eLife.47395.045
Figure 8
HOCl-treated serum albumin improves survival of neutrophil-like cells in the presence of the major mycobacterial protein antigen Ag85B.
Differentiated neutrophil-like PLB-985 cells were preincubated with 50 μM Z-VAD-FMK, 155 μM native (HSA UT) or HOCl-treated HSA (HSA 50xHOCl) prior to the addition of 1 μM Ag85B or 2 μM …
-
Figure 8—source data 1
Numerical flow cytometry data represented in Figure 8a and b.
- https://doi.org/10.7554/eLife.47395.050
Figure 9
HOCl-treated serum albumin binds to and prevents uptake of the major mycobacterial protein antigen Ag85B by neutrophil-like cells.
(a, b) HSA, treated with a 50-fold molar excess of HOCl (HSA 50xHOCl) significantly decreased aggregation of denatured Ag85B as measured by light scattering at 360 nm. Reduction of HSA 50xHOCl with …
-
Figure 9—source data 1
Numerical light scattering data obtained during protein aggregation assays represented in Figure 9a and b.
- https://doi.org/10.7554/eLife.47395.052
-
Figure 9—source data 2
Numerical flow cytometry data obtained during protein aggregation assays represented in Figure 9c and d.
- https://doi.org/10.7554/eLife.47395.053
Figure 10
Proposed mechanism of the immunomodulatory role of N-chlorination of plasma proteins at a site of inflammation.
At the site of inflammation neutrophils (and potentially other immune cells) are activated. Neutrophils then produce HOCl at concentrations of up to 25 to 50 mM per hour. Plasma proteins, such as …
Tables
Table 1
E. coli strains, plasmids and primers used in this study.
https://doi.org/10.7554/eLife.47395.055| Relevant properties or genotype | Source or reference | |
|---|---|---|
| E. coli strains | ||
| DH5α | supE44, ΔlacU169 (φ80 lacZΔM15) hsdR17 recA1 endA1 hsdR gyrA relA thi | Invitrogen |
| BL21(DE3) | F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5- T7 gene one ind1 sam7 nin5]) | Stratagene, Santa Clara, CA |
| Plasmids | ||
| pEXA_fbpB | AmpR pEX-A128 vector carrying synthesized fbpB gene from M. bovis | Eurofins Genomics |
| pET22b (+) | AmpR, vector for overexpression of genes in E. coli | Novagen |
| pET22b-fbpB | AmpR, vector for overexpression of fbpB gene in E. coli BL21(DE3) | This study |
| Primers | Sequence (5’ - > 3’) | |
| fbpB-fw | CCCCATATGTTCTCTCGTCCGG | |
| fbpB-rv | CCCCTCGAGACCAGCACCCAG | |
-
* AmpR, ampicillin resistance.
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.47395.056
