(A) Recombinant Hsf1-Ssa1 complexes (Input; IN) were immobilized onto Strep-Tactin Sepharose (StrepTag II in Hsf1) in the presence of 0, 1, 5 or 10 µM ATP and after washing, bound protein was eluted …
(A) Serial dilution of purified Hsf1-Ssa1 analyzed by SDS-PAGE for stoichiometric analysis. Densitometric quantification of the Coomassie stained gel is presented normalized to the level of total …
0.34 nmol Hsf1-Ssa1 complexes were mixed with buffer (dotted line) or preincubated with 10-fold molar excess of Ssa1-ATP (orange line) and were loaded onto a Superose 6 10/300 GL column. Two …
(A) Photocrosslinking (UV) of yeast cells grown at 30°C or subjected to a 3 min heat shock (HS) at 43°C that express Ssa1-HA with photoreactive Bpa (pBPa) incorporated at amino acid position 423 of …
(A) Schematic representation of Sse1-NLS binding to nuclear Hsp70. Binding accelerates Hsp70 nucleotide exchange and triggers substrate release. (B) Micrographs of the subcellular localization of …
(A) Msn2/4 activity determined by a bioluminescent reporter in cells carrying vector control (VC) or expressing Sse1, Sse1-NLS, Sse1-NES, Sse1*-NLS at 30°C. Data from triplicate experiments with …
(A) Micrographs of Hsp104-GFP in cells grown at 25°C and heat shocked (HS) for 15 min at 37°C either with or without the addition of CHX. The white scale bar is 5 μm. (B) Quantification of the …
(A) Hsf1 and Msn2/4 activity was followed over time in cells exposed to 10 mM AzC using bioluminescent transcriptional reporters promoted by HSE (Hsf1) or STRE (Msn2/4). (B) Hsf1 and Msn2/4 activity …
(A) Western analysis of NlucPEST levels following the addition of CHX to arrest translation. (B) Quantification of NlucPEST levels in A. Protein levels were normalized to the loading control Pgk1. …
(A) Schematic representation of Fes1-accelerated release of persistent substrates from Hsp70. In fes1Δ cells persistent substrates remain associated with Hsp70. (B) Hsf1 activity was determined in …
FKPM values from RNA seq analysis of heat-shocked WT and fes1Δ cells.
Data from three independent cultures of each strain (I, II, III) are provided.
(A) Bar plot showing mean FPKM values of Hsf1 target genes (Pincus et al., 2018) before and after heat shock in WT and fes1Δ cells. (B) Bar plot showing mean FPKM values of Msn2/4 target genes (Solís…
(A) Induction of SSA4 and (B) HSP104 in fes1Δ and fes1Δ msn2/4Δ cells before and after a 30 min heat shock (HS). levels of mRNA were determined by qPCR and normalized to TAF10. (C) FKPM values (RNA …
Hsf1 and Msn2/4 target genes has been described earlier (Pincus et al., 2018; Solís et al., 2016).
(A) Significantly enriched GO terms related to biological process. (B) Significantly enriched GO terms related to molecular function. (C) Significantly enriched GO terms related to cellular component.
(A) Total lysates and the aggregate pellet fractions of protein lysates from WT and fes1Δ cells grown at 25°C and heat shocked for 30 min at 37°C (HS). Proteins were visualized by silver staining. (B…
(A) Total lysates (T), the aggregate pellet (P) and the remaining soluble (S) fractions following centrifugation of protein lysates from WT and (B) fes1Δ cells grown at 25°C and heat shocked for 30 …
Summative graphical model of our current understanding of Hsf1 regulation. See Discussion for details.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (S. cerevisiae) | AMY31 | This paper | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | AMY41 | This paper | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | AMY46 | This paper | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | AMY62 | This paper | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | BY4721 | EUROSCARF; PMID: 9483801 | Y00000 | Distributed by EUROSCARF |
Strain, strain background (S. cerevisiae) | CAY1005 | EUROSCARF | Y02146 | Distributed by EUROSCARF |
Strain, strain background (S. cerevisiae) | CAY1015 | PMID: 23530227 | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | CAY1038 | EUROSCARF | Y01514 | Distributed by EUROSCARF |
Strain, strain background (S. cerevisiae) | CAY1057 | EUROSCARF | Y1512 | Distributed by EUROSCARF |
Strain, strain background (S. cerevisiae) | CAY1140 | This paper | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | CAY1221 | PMID: 26912797 | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | CAY1255 | PMID: 14562095 | HSP104-GFP | Dr. T Nyström, University of Gothenburg, Sweden |
Strain, strain background (S. cerevisiae) | CAY1257 | PMID: 23530227 | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Strain, strain background (S. cerevisiae) | NY137 | This paper | For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pAM14 | This paper | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pAM17 | This paper | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pAM23 | This paper | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pCA502 | PMID: 18948593 | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pCA503 | PMID: 18948593 | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pCA901 | This paper | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pCA926 | This paper | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pCA955 | PMID:26860732 | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pCA970 | PMID: 28289075 | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pCA1026 | This paper | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pJK001 | PMID:28289075 | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pJK010 | PMID: 28289075 | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pJK011 | This work | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | pJK070 | PMID: 29323280 | For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden | |
Recombinant DNA reagent | ECYRS-BpA (plasmid) | PMID: 17560600 | Dr. PG Schultz, The Scripps Research Institute, CA |
Strain | Genotype | Reference/source |
---|---|---|
AMY31 | MATa his3Δ1 leu2Δ0 ura3Δ0 HSF1-EGFP-hphMX SSA2-HA-kanMX | This work |
AMY41 | MATa his3Δ1 leu2Δ0 ura3Δ0 msn2::hphMX4 msn4::natMX4 fes1Δ::LEU2 | This work |
AMY46 | MATa his3Δ1 leu2Δ0 ura3Δ0 msn2::hphMX4 msn4::natMX4 | This work |
AMY62 | MATa his3Δ1 leu2Δ0 ura3Δ0 trp1Δ::natMX Hsf1-13*Myc-kanMX | This work |
BY4741 | MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 | (Brachmann et al., 1998) |
CAY1005 | MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 sse1Δ::kanMX4 | EUROSCARF |
CAY1015 | MATa his3Δ1 leu2Δ0 ura3Δ0 | (Gowda et al., 2013) |
CAY1038 | MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 hsp104Δ::kanMX4 | EUROSCARF |
CAY1057 | MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 ssa2Δ::kanMX4 | EUROSCARF |
CAY1140 | MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 fes1Δ::LEU2 | This work |
CAY1221 | MATa his3Δ1 leu2Δ0 ura3Δ0 fes1Δ::ura3 | (Gowda et al., 2016) |
CAY1255 | MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 HSP104::-GFP-his3M × 6 | This work |
CAY1267 | MATa his3Δ1 leu2Δ0 ura3Δ0 fes1-1 (A79R, R195A) | (Gowda et al., 2013) |
NY137 | MATa leu2Δ0 ura3Δ0 trp1Δ::natMX Hsf1-13*Myc-kanMX his3Δ1::[SSE1-NLS HIS3] | This work |
Plasmid | Description | Type | Reference/source |
---|---|---|---|
pAM14 | URA3 PCYC1-4xSTRE-yNlucPEST | CEN/ARS | This work |
pAM17 | URA3 PCYC1-3xHSE-yNlucPEST | CEN/ARS | This work |
pAM23 | URA3 PTHD3-yNlucPEST | CEN/ARS | This work |
pCA502 | HIS3 VC | CEN/ARS | (Andréasson et al., 2008) |
pCA503 | HIS3 SSE1 | CEN/ARS | (Andréasson et al., 2008) |
pCA901 | HIS3 SSE1*-NLS | CEN/ARS | This work |
pCA926 | HIS3 SSE1-NLS | YIP | This work |
pCA955 | URA3 PCYC1-HSE-yNlucPEST | CEN/ARS | (Masser et al., 2016) |
pCA970 | HIS3 SSE1-NES | CEN/ARS | (Kaimal et al., 2017) |
pCA1026 | PT7-lacO-6xHis-SUMO-Ssa1-S/D-Hsf1-StrepTag II PT7-Sis1 lacI | E. coli | This work |
pJK001 | HIS3 ysfGFP-SSE1 | CEN/ARS | (Kaimal et al., 2017) |
pJK010 | HIS3 SSE1-NLS | CEN/ARS | (Kaimal et al., 2017) |
pJK011 | HIS3 ysfGFP-Sse1-NLS | CEN/ARS | This work |
pJK070 | URA3 SSA1E423TAG-HA | 2 μ | (Gowda et al., 2018) |
ECYRS-BpA | TRP1 BPa system | 2 μ | (Chen et al., 2007) |
Gene | Sequence 5’−3’ | Reference/source |
---|---|---|
CUP1 | GTGCCAATGCCAATGTGGTAG CATTTCCCAGAGCAGCATGAC | This work |
HSC82 H | CTCGTTTTCTCGAACTTC CAAATCTCCTCCCTCATTAC | This work |
HSC82 O | GAGAGTTGATGAGGGTGGTG GTTAGTCAAATCTTTGACGGTC | This work |
TAF10 | ATATTCCAGGATCAGGTCTTCCGTAGC GTAGTCTTCTCATTCTGTTGATGTTGTTGTTG | (Teste et al., 2009) |
SSA4 | CCAAGAGGCGTACCACAAAT GCTTCTTGTTCATCTTCGGC | This work |
HSP104 | GTCGCTGAACCAAGTGTGAG CTCTTGCGACGGCGACACCA | This work |
Name | Sequence 5’−3’ | Reference/source |
---|---|---|
HSE-DY682 | TCGATTTTCCAGAACGTTCCATCGGC GCCGATGGAACGTTCTGGAAAATCGA | This work |
HSE | TCGATTTTCCAGAACGTTCCATCGGC GCCGATGGAACGTTCTGGAAAATCGA | This work |
HSE* | TCGATGTGCCAGTACGTAGCATCGGC GCCGATGCTACGTACTGGCACATCGA | This work |