Cytoplasmic protein misfolding titrates Hsp70 to activate nuclear Hsf1

  1. Anna E Masser
  2. Wenjing Kang
  3. Joydeep Roy
  4. Jayasankar Mohanakrishnan Kaimal
  5. Jany Quintana-Cordero
  6. Marc R Friedländer
  7. Claes Andréasson  Is a corresponding author
  1. Stockholm University, Sweden
  2. Science for Life Laboratory, Stockholm University, Sweden
7 figures, 5 tables and 1 additional file

Figures

Figure 1 with 2 supplements
Reconstitution of large ATP-sensitive Hsf1-Hsp70 complexes with chaperone regulated HSE-binding activity.

(A) Recombinant Hsf1-Ssa1 complexes (Input; IN) were immobilized onto Strep-Tactin Sepharose (StrepTag II in Hsf1) in the presence of 0, 1, 5 or 10 µM ATP and after washing, bound protein was eluted …

https://doi.org/10.7554/eLife.47791.002
Figure 1—figure supplement 1
The DNA-binding activity of recombinant Hsf1-Ssa1 complexes is inhibited by Hsp70.

(A) Serial dilution of purified Hsf1-Ssa1 analyzed by SDS-PAGE for stoichiometric analysis. Densitometric quantification of the Coomassie stained gel is presented normalized to the level of total …

https://doi.org/10.7554/eLife.47791.003
Figure 1—figure supplement 2
Hsf1 forms supercomplexes upon supplementation with excess Hsp70.

0.34 nmol Hsf1-Ssa1 complexes were mixed with buffer (dotted line) or preincubated with 10-fold molar excess of Ssa1-ATP (orange line) and were loaded onto a Superose 6 10/300 GL column. Two …

https://doi.org/10.7554/eLife.47791.004
Heat shock negatively regulates Hsp70 binding of Hsf1 via its SBD.

(A) Photocrosslinking (UV) of yeast cells grown at 30°C or subjected to a 3 min heat shock (HS) at 43°C that express Ssa1-HA with photoreactive Bpa (pBPa) incorporated at amino acid position 423 of …

https://doi.org/10.7554/eLife.47791.005
Figure 3 with 1 supplement
Accelerating Hsp70 substrate release in the nucleus activates Hsf1 and potentiates the heat-shock response.

(A) Schematic representation of Sse1-NLS binding to nuclear Hsp70. Binding accelerates Hsp70 nucleotide exchange and triggers substrate release. (B) Micrographs of the subcellular localization of …

https://doi.org/10.7554/eLife.47791.006
Figure 3—figure supplement 1
Expression of Sse1-NLS does not affect Msn2/4 activity but strongly induces the expression of Hsp70, Hsp90 and Hsp104.

(A) Msn2/4 activity determined by a bioluminescent reporter in cells carrying vector control (VC) or expressing Sse1, Sse1-NLS, Sse1-NES, Sse1*-NLS at 30°C. Data from triplicate experiments with …

https://doi.org/10.7554/eLife.47791.007
Figure 4 with 2 supplements
Heat shock activates Hsf1 by the misfolding of newly synthesized proteins.

(A) Micrographs of Hsp104-GFP in cells grown at 25°C and heat shocked (HS) for 15 min at 37°C either with or without the addition of CHX. The white scale bar is 5 μm. (B) Quantification of the …

https://doi.org/10.7554/eLife.47791.008
Figure 4—figure supplement 1
Heat shock activates Hsf1 by the misfolding of newly synthesized proteins.

(A) Hsf1 and Msn2/4 activity was followed over time in cells exposed to 10 mM AzC using bioluminescent transcriptional reporters promoted by HSE (Hsf1) or STRE (Msn2/4). (B) Hsf1 and Msn2/4 activity …

https://doi.org/10.7554/eLife.47791.009
Figure 4—figure supplement 2
Half-life of NlucPEST.

(A) Western analysis of NlucPEST levels following the addition of CHX to arrest translation. (B) Quantification of NlucPEST levels in A. Protein levels were normalized to the loading control Pgk1. …

https://doi.org/10.7554/eLife.47791.010
Figure 5 with 4 supplements
Limiting the available pool of Hsp70 by impairing cytosolic substrate release unleashes a Hsf1 hyper-stress program.

(A) Schematic representation of Fes1-accelerated release of persistent substrates from Hsp70. In fes1Δ cells persistent substrates remain associated with Hsp70. (B) Hsf1 activity was determined in …

https://doi.org/10.7554/eLife.47791.011
Figure 5—source data 1

FKPM values from RNA seq analysis of heat-shocked WT and fes1Δ cells.

Data from three independent cultures of each strain (I, II, III) are provided.

https://doi.org/10.7554/eLife.47791.016
Figure 5—figure supplement 1
Induction of Hsf1 and Msn2/4 target genes under heat shock and hyper-stress conditions.

(A) Bar plot showing mean FPKM values of Hsf1 target genes (Pincus et al., 2018) before and after heat shock in WT and fes1Δ cells. (B) Bar plot showing mean FPKM values of Msn2/4 target genes (Solís…

https://doi.org/10.7554/eLife.47791.012
Figure 5—figure supplement 2
Msn2/4 is dispensable for hyperinduction of the HSR and expression of the CUP1 gene.

(A) Induction of SSA4 and (B) HSP104 in fes1Δ and fes1Δ msn2/4Δ cells before and after a 30 min heat shock (HS). levels of mRNA were determined by qPCR and normalized to TAF10. (C) FKPM values (RNA …

https://doi.org/10.7554/eLife.47791.013
Figure 5—figure supplement 3
Density plot obtained from DESeq2 analysis showing gene expression changes following heat shock in (A) WT and (B) fes1Δ cells.

Hsf1 and Msn2/4 target genes has been described earlier (Pincus et al., 2018; Solís et al., 2016).

https://doi.org/10.7554/eLife.47791.014
Figure 5—figure supplement 4
GO analysis of differentially expressed genes in heat shocked cells.

(A) Significantly enriched GO terms related to biological process. (B) Significantly enriched GO terms related to molecular function. (C) Significantly enriched GO terms related to cellular component.

https://doi.org/10.7554/eLife.47791.015
Figure 6 with 1 supplement
The soluble pool of Hsp70 is titrated to the aggregate fraction by heat shock.

(A) Total lysates and the aggregate pellet fractions of protein lysates from WT and fes1Δ cells grown at 25°C and heat shocked for 30 min at 37°C (HS). Proteins were visualized by silver staining. (B

https://doi.org/10.7554/eLife.47791.017
Figure 6—figure supplement 1
Heat-shock-induced protein aggregation depends on translation in WT but not fes1Δ cells.

(A) Total lysates (T), the aggregate pellet (P) and the remaining soluble (S) fractions following centrifugation of protein lysates from WT and (B) fes1Δ cells grown at 25°C and heat shocked for 30 …

https://doi.org/10.7554/eLife.47791.018
Model that show how Hsf1 is negatively regulated by the nuclear pool of Hsp70.

Summative graphical model of our current understanding of Hsf1 regulation. See Discussion for details.

https://doi.org/10.7554/eLife.47791.019

Tables

Key resources table
Reagent type
(species) or
resource
DesignationSource or referenceIdentifiersAdditional
information
Strain, strain background (S. cerevisiae)AMY31This paperFor details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)AMY41This paperFor details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)AMY46This paperFor details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)AMY62This paperFor details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)BY4721EUROSCARF; PMID: 9483801Y00000Distributed by EUROSCARF
Strain, strain background (S. cerevisiae)CAY1005EUROSCARFY02146Distributed by EUROSCARF
Strain, strain background (S. cerevisiae)CAY1015PMID: 23530227For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)CAY1038EUROSCARFY01514Distributed by EUROSCARF
Strain, strain background (S. cerevisiae)CAY1057EUROSCARFY1512Distributed by EUROSCARF
Strain, strain background (S. cerevisiae)CAY1140This paperFor details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)CAY1221PMID: 26912797For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)CAY1255PMID: 14562095HSP104-GFPDr. T Nyström, University of Gothenburg, Sweden
Strain, strain background (S. cerevisiae)CAY1257PMID: 23530227For details see Table 1. Dr. C Andréasson, Stockholm University, Sweden
Strain, strain background (S. cerevisiae)NY137This paperFor details see Table 1.
Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpAM14This paperFor details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpAM17This paperFor details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpAM23This paperFor details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpCA502PMID: 18948593For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpCA503PMID: 18948593For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpCA901This paperFor details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpCA926This paperFor details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpCA955PMID:26860732For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpCA970PMID: 28289075For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpCA1026This paperFor details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpJK001PMID:28289075For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpJK010PMID: 28289075For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpJK011This workFor details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentpJK070PMID: 29323280For details see Table 2. Dr. C Andréasson, Stockholm University, Sweden
Recombinant DNA reagentECYRS-BpA (plasmid)PMID: 17560600Dr. PG Schultz, The Scripps Research Institute, CA
Table 1
Yeast strains.
https://doi.org/10.7554/eLife.47791.020
StrainGenotypeReference/source
AMY31MATa his3Δ1 leu2Δ0 ura3Δ0 HSF1-EGFP-hphMX SSA2-HA-kanMXThis work
AMY41MATa his3Δ1 leu2Δ0 ura3Δ0 msn2::hphMX4 msn4::natMX4 fes1Δ::LEU2This work
AMY46MATa his3Δ1 leu2Δ0 ura3Δ0 msn2::hphMX4 msn4::natMX4This work
AMY62MATa his3Δ1 leu2Δ0 ura3Δ0 trp1Δ::natMX Hsf1-13*Myc-kanMXThis work
BY4741MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0(Brachmann et al., 1998)
CAY1005MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 sse1Δ::kanMX4EUROSCARF
CAY1015MATa his3Δ1 leu2Δ0 ura3Δ0(Gowda et al., 2013)
CAY1038MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 hsp104Δ::kanMX4EUROSCARF
CAY1057MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 ssa2Δ::kanMX4EUROSCARF
CAY1140MATα his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 fes1Δ::LEU2This work
CAY1221MATa his3Δ1 leu2Δ0 ura3Δ0 fes1Δ::ura3(Gowda et al., 2016)
CAY1255MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 HSP104::-GFP-his3M × 6This work
CAY1267MATa his3Δ1 leu2Δ0 ura3Δ0 fes1-1 (A79R, R195A)(Gowda et al., 2013)
NY137MATa leu2Δ0 ura3Δ0 trp1Δ::natMX Hsf1-13*Myc-kanMX his3Δ1::[SSE1-NLS HIS3]This work
Table 2
Plasmids.
https://doi.org/10.7554/eLife.47791.021
PlasmidDescriptionTypeReference/source
pAM14URA3 PCYC1-4xSTRE-yNlucPESTCEN/ARSThis work
pAM17URA3 PCYC1-3xHSE-yNlucPESTCEN/ARSThis work
pAM23URA3 PTHD3-yNlucPESTCEN/ARSThis work
pCA502HIS3 VCCEN/ARS(Andréasson et al., 2008)
pCA503HIS3 SSE1CEN/ARS(Andréasson et al., 2008)
pCA901HIS3 SSE1*-NLSCEN/ARSThis work
pCA926HIS3 SSE1-NLSYIPThis work
pCA955URA3 PCYC1-HSE-yNlucPESTCEN/ARS(Masser et al., 2016)
pCA970HIS3 SSE1-NESCEN/ARS(Kaimal et al., 2017)
pCA1026PT7-lacO-6xHis-SUMO-Ssa1-S/D-Hsf1-StrepTag II PT7-Sis1 lacIE. coliThis work
pJK001HIS3 ysfGFP-SSE1CEN/ARS(Kaimal et al., 2017)
pJK010HIS3 SSE1-NLSCEN/ARS(Kaimal et al., 2017)
pJK011HIS3 ysfGFP-Sse1-NLSCEN/ARSThis work
pJK070URA3 SSA1E423TAG-HA2 μ(Gowda et al., 2018)
ECYRS-BpATRP1 BPa system2 μ(Chen et al., 2007)
Table 3
qPCR primers.
https://doi.org/10.7554/eLife.47791.022
GeneSequence 5’−3’Reference/source
CUP1GTGCCAATGCCAATGTGGTAG
CATTTCCCAGAGCAGCATGAC
This work
HSC82 HCTCGTTTTCTCGAACTTC
CAAATCTCCTCCCTCATTAC
This work
HSC82 OGAGAGTTGATGAGGGTGGTG
GTTAGTCAAATCTTTGACGGTC
This work
TAF10ATATTCCAGGATCAGGTCTTCCGTAGC
GTAGTCTTCTCATTCTGTTGATGTTGTTGTTG
(Teste et al., 2009)
SSA4CCAAGAGGCGTACCACAAAT
GCTTCTTGTTCATCTTCGGC
This work
HSP104GTCGCTGAACCAAGTGTGAG
CTCTTGCGACGGCGACACCA
This work
Table 4
EMSA oligos.
https://doi.org/10.7554/eLife.47791.023
NameSequence 5’−3’Reference/source
HSE-DY682TCGATTTTCCAGAACGTTCCATCGGC
GCCGATGGAACGTTCTGGAAAATCGA
This work
HSETCGATTTTCCAGAACGTTCCATCGGC
GCCGATGGAACGTTCTGGAAAATCGA
This work
HSE*TCGATGTGCCAGTACGTAGCATCGGC
GCCGATGCTACGTACTGGCACATCGA
This work

Additional files

Download links