Age-dependent deterioration of nuclear pore assembly in mitotic cells decreases transport dynamics
- University of Groningen, University Medical Center Groningen, Netherlands
- University of Washington, United States
- Yale School of Medicine, United States
- University of Groningen, Netherlands
Figures
Figure 1 with 3 supplements
The cellular abundance of some NPC components changes in replicative aging.
(a) Cartoon representation of the NPC illustrates different structural regions of the NPC, all FG-Nups are shown in green independently of their localization, the membrane rings in light brown, the …
Figure 1—figure supplement 1
Cellular protein and mRNA abundance of Nups, NTRs and assembly factors in replicative aging.
(a) mRNA abundance of NPC components in replicative aging; a zoom-in of Figure 1A. Changes in abundance are plotted as fold change. Replicative age increases in time. Transcriptome data from Janssens…
Figure 1—figure supplement 2
The abundance and localization of NPC components in replicative aging.
(a) The experimental timeline where young cells are trapped in the microfluidic device and bright-field images are taken every 20 min to define the cell’s age and fluorescent images are taken once …
Figure 1—figure supplement 3
Models of NPCs with altered stoichiometry.
(a) The time averaged radial density distribution of the 24 constructed models (gray) (see Table 1) based on the FG-Nup abundance data from Figure 1c with the average of the 24 models plotted in …
Figure 2 with 2 supplements
Mitotic aging is associated with problems in NPC assembly rather than oxidative damage.
(a) Time-averaged radial density distribution of FG-Nups for different positions along the z-axis separated by 1 nm, in the range −15.4 < z < 15.4 nm, plotted for the wild type (black), the …
Figure 2—figure supplement 1
In vitro oxidation and models of NPCs with oxidative damage.
(a) Anti-GFP western blot of Nsp1-GFP immunoprecipitated from extracts of exponentially growing BY4741 cell expressing Nsp1-GFP from the native promoter and treated without or with 1 mM menadione …
Figure 2—figure supplement 2
Heh2-GFP and Apq12-GFP abundance at the NE as a function of remaining lifespan.
Additional independent replicates (coming from a different microscope) for Apq12-GFP and Heh2-GFP abundance at the NE, relative to Nup49-mCh, as a function of remaining lifespan. The dotted lines …
Figure 3
NE herniations are more prevalent in aged cells.
(a) Examples of NE herniations found in replicatively aged cells. NPCs are indicated by an arrowhead, asterisks indicate herniation lumens and the nucleus is marked with N. Scale bars are 200 nm. (b)…
Figure 4 with 4 supplements
Increased steady state nuclear compartmentalization in aging is mimicked in NPC assembly mutants.
(a) Heatmaps showing single-cell changes in localization (N/C ratios) of GFP (N = 49), GFP-NES (N = 75) and GFP-NLS (N = 66) reporter proteins during replicative aging. (b) N/C ratios of GFP-tcNLS, …
Figure 4—figure supplement 1
Efflux rate constants in aging.
(a), (b) Singe-cell measurements of the kinetics of loss of nuclear accumulation of GFP-NLS from young cell and cell with median replicative age 8. Time zero is the time point at which the red …
Figure 4—figure supplement 2
The abundance of transport factors and NTR cargos does not change in aging.
(a) Protein abundance of Crm1, Kap95, Kap60, Kap104 and Kap121 as measured in whole cell extracts of yeast cells of increasing replicative age. Data from Janssens et al. (2015). (b) (c) Localization …
Figure 4—figure supplement 3
Replicative lifespan curves.
Replicative lifespan curves of strains expressing reporter proteins, in comparison to BY4741; all grown on medium supplemented with raffinose and galactose. The overexpression of GFP alone did not …
Figure 4—figure supplement 4
Apq12 is an essential gene in BY4741, but not in W303.
(a) PCR analysis of apq12 mutants confirming the genotype of the heterozygous diploid BY4743 apq12Δ/APQ12 and the haploid W303 apq12Δ. Strains were generated using the PCR toolbox (Janke et al., 2004…
Figure 5 with 1 supplement
Alterations of nuclear envelope permeability during aging affects transcription factor dynamics.
(a) Schematic showing pulses of Msn2 translocation to the nucleus and movement back to the cytoplasm. (b) Five randomly selected single cell traces showing Msn2 dynamics. Low values indicate the …
Figure 5—figure supplement 1
Msn2 pulse prominence and width correlate to remaining lifespan.
(a) The Msn2 pulse prominence is positively correlated with remaining lifespan. (b) The remaining lifespan is negatively correlated with increasing Msn2 pulse width. N value cells = 48, N value for …
Figure 6
Graphical summary.
(a) Summary of the measured changes. (b) Schematic representation of NPC assembly and nuclear transport dynamics in young cells. (c) Model: In old cells, the decrease in abundance of several …
Tables
Table 1
Details of the FG-Nup stoichiometry for the 24 constructed models to represent the aged NPC. 0 and 1 represent absence and presence, respectively, of the FG-Nup in 8-fold symmetry.
https://doi.org/10.7554/eLife.48186.018| NSP1 | NSP1 | NSP1 | NSP1 | Nup1 | Nup42 | Nup49 | Nup49 | Nup57 | Nup57 | Nup60 | Nup100 | Nup145 | Nup145 | Nup159 | Nup116 | |
| Model 1 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 |
| Model 2 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 0 |
| Model 3 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 |
| Model 4 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 1 | 1 | 1 | 0 |
| Model 5 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 |
| Model 6 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 0 |
| Model 7 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 |
| Model 8 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 1 | 1 | 1 | 0 |
| Model 9 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 0 |
| Model 10 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 1 | 1 | 0 |
| Model 11 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 0 |
| Model 12 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 1 | 1 | 0 |
| Model 13 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 1 | 0 |
| Model 14 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 1 | 1 | 0 |
| Model 15 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 0 |
| Model 16 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 1 | 1 | 1 | 0 |
| Model 17 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 0 |
| Model 18 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 0 |
| Model 19 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 1 | 1 | 1 | 1 | 0 |
| Model 20 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 |
| Model 21 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 0 |
| Model 22 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 1 | 0 | 1 | 1 | 1 | 0 |
| Model 23 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 1 | 1 | 1 | 1 | 0 |
| Model 24 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 1 | 0 |
Table 2
Force field parameters for carbonylated amino acids.
Here, and represent the hydrophobicity of amino acids in their native condition according to Ghavami et al. (2014) and the weighted average scheme, respectively. denotes the hydrophobicity …
| AA | ||||
|---|---|---|---|---|
| T | 0.51 | 0.52 | 0.34 | 0 −>0 |
| K | 0.00 | 0.00 | 0.59 | 1 −>0 |
| P | 0.65 | 0.63 | 0.43 | 0 −>0 |
| R | 0.00 | 0.07 | 0.43 | 1 −>0 |
Table 3
Physical properties of the wild type, carbonylated and carbonylated_HP NPCs.
In the carbonylated_HP NPC only the effect of carbonylation on the hydrophobicity is accounted for. For the net hydrophobicity, we added the hydrophobicity values ε of all the residues inside the NPC.
| Force field | +ve Charged AA | -ve Charged AA | Net charge | Net hydrophobicity |
|---|---|---|---|---|
| Wild type | 8072 | 7560 | +512 | 43373.7 |
| Carbonylated | 0 | 7560 | −7560 | 45549.7 |
| Carbonylated_HP | 8072 | 7560 | +512 | 45549.7 |
Table 4
Strains and plasmids
https://doi.org/10.7554/eLife.48186.021| Yeast strains | Source |
|---|---|
| BY4741 yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) | Invitrogen |
| BY4742 yeast (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0) | Invitrogen |
| Apq12Δ; Y01433 (MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; YIL040w::kanMX4) | This study |
| W303 Apq12Δ apq12::hphNTI leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15 | This study |
| Nup116-GFPboundary MKY227 (W303, ADE2+) | Mattheyses et al., 2010 |
| Nup116-GFPboundary BY4741 | This study |
| Apq12-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Apq12-GFP::His3M × 6) | ThermoFisher (Huh et al., 2003) |
| Nup2-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup2-GFP::His3M × 6) | ThermoFisher |
| Nup49-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup49-GFP::His3M × 6) | ThermoFisher |
| Nup100-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup100-GFP::His3M × 6) | ThermoFisher |
| Nup133-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup133-GFP::His3M × 6) | ThermoFisher |
| Heh2-GFP yeast (MATa his3 leu2 met15 ura3Δ0 Heh2-GFP::His3M × 6) | ThermoFisher |
| Srm1-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Srm1-GFP::His3M × 6) | ThermoFisher |
| Kap95-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Kap95-GFP::His3M × 6) | ThermoFisher |
| Crm1-GFP yeast (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Crm1-GFP::His3M × 6) | ThermoFisher |
| Msn2-GFP yeast (MATa his3 leu2 met15 ura3Δ0 Msn2-GFP::His3M × 6) | ThermoFisher |
| JTY7; Nup49-mCh (MATα Nup49-mCh::CaURA3 can1Δ::STE2pr-LEU2 ura3Δ0 lyp1Δ leu2Δ0 his3Δ1 met15Δ0) | Tkach et al., 2012 |
| yIS010; Nup2-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup2-GFP::His3M × 6 Nup49-mCh::URA) | This study |
| yIS011; Nup100-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup100-GFP::Hi3M × 6 s Nup49-mCh::URA) | This study |
| yIS012; Nup116-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup116-GFPboundary Nup49-mCh::URA) | This study |
| yIS013; Nup133-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup133-GFP::His Nup49-mCh::URA) | This study |
| yIS014; Nup49-GFP Nup133-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Nup49-GFP::His3M × 6 Nup133-mCh::URA) | This study |
| yIS018; Apq12-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Apq12-GFP::His3M × 6 Nup49-mCh::URA) | This study |
| yIS021; Srm1-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Srm1-GFP::His3M × 6 Nup49-mCh::URA) | This study |
| yIS022; Kap95-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Kap95-GFP::His3M × 6 Nup49-mCh::URA) | This study |
| yIS023; Crm1-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Crm1-GFP::His3M × 6 Nup49-mCh::URA) | This study |
| yIS027; Apq12Δ Nup49-mCh GFP-NLS (MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; YIL040wΔ::kanMX4; GFP-tcNLS(pGal1)::His Nup49-mCH::URA) | This study |
| yIS028; Apq12Δ Nup49-mCh GFP-NES (MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; YIL040wΔ::kanMX4; GFP-NES(pGal1)::His Nup49-mCH::URA) | This study |
| yIS032; Chm7-yeGFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Chm7-yeGFP::His Nup49-mCh::URA) | This study |
| yIS035; Heh2-GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 Heh2-GFP::His3M × 6 Nup49-mCh::URA) | This study |
| yPP008; GFP-tcNLS Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 GFP-tcNLS(pGal1)::His Nup49-mCh::URA) | This study |
| yPP009; GFP Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 GFP(pGal1)::His Nup49-mCh::URA) | This study |
| yPP011; GFP-NES Nup49-mCh (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 GFP-NES(pGal1)::His Nup49-mCh::URA) | This study |
| yAA001; Nab2NLS-GFP Nup49-mCh (MATα Nup49-mCh::CaURA3 can1Δ::STE2pr-LEU2 ura3Δ0 lyp1Δ leu2Δ0 his3Δ1:: Nab2NLS(pTpi1)::His met15Δ0) | This study |
| yAA002; Pho4NLS-GFP Nup49-mCh (MATα Nup49-mCh::CaURA3 can1Δ::STE2pr-LEU2 ura3Δ0 lyp1Δ leu2Δ0 his3Δ1:: Pho4NLS(pTpi1)::His met15Δ0) | This study |
| Oligonucleotides | |
| Chm7-GFP-S3 fw (GAAAACCACGATAATGAGATAAGAAAAATCATGATGGAAGAACAACCACGTCGTACGCTGCAGGTCGAC) | This study |
| Chm7-GFP-S2 rv (CATATTTATTTTTTATTTATACATATATATTTATTTATTAGTCACTCAGTTCGATCGATGAATTCGAGCTCG) | This study |
| Plasmids | |
| Plasmid: pYM44 yeGFP-tag | Janke et al., 2004 |
| Plasmid: pYM28 EGFP-tag | Janke et al., 2004 |
| Plasmid: pNZ-h2NLS-L-GFP (ID-GFP) | Meinema et al., 2011 |
| Plasmid: pBT016 pYX242-NAB2NLS-GFP-PRA | Timney et al., 2006 |
| Plasmid: pBT018 pYX242-PHO4NLS-GFP-PRA | Timney et al., 2006 |
| Plasmid: pPP014 mCh-Ura-Cassette | This study |
| Plasmid: pPP042 pRS303-GFP-tcNLS | This study |
| Plasmid: pPP043 pRS303-GFP | This study |
| Plasmid: pPP046 pRS303-GFP-NES | This study |
| Plasmid: pAA8 pRS303-Nab2NLS-GFP | This study |
| Plasmid: pAA9 pRS303-Pho4NLS-GFP | This study |
Additional files
-
Transparent reporting form
- https://doi.org/10.7554/eLife.48186.022
