RNA from a simple-tandem repeat is required for sperm maturation and male fertility in Drosophila melanogaster
- University of California, Berkeley, United States
- Lawrence Berkeley National Laboratory, United States
- University of California, Irvine, United States
- National University of Ireland, Ireland
Figures
Figure 1 with 6 supplements
AAGAG(n) RNA localizations in embryos and larvae.
(a) AAGAG RNA distributions (magenta) throughout embryonic and larval development in Oregon R flies. DNA/DAPI = blue; all images are confocal sections. White box indicates location of enlarged nucleus (right column). (b) Distributions of AAGAG RNA in intact larval L3 brain (left) and salivary gland (SG) tissue (right) (confocal sections). (c) Salivary gland squash projection indicating presence of AAGAG RNA (magenta, see arrows) at the chromocenter (marked with H3K9me2), and not the euchromatic arms. (d) Brain cell sections show that there are one or two AAGAG RNA foci per nucleus that are located in or near the pericentromeric heterochromatin (H3K9me2 antibody IF, green). Specifically, 100% of nuclei (N = 5) with AAGAG foci contain foci that completely or partially co-localize with H3K9me2 (left panel). Of these nuclei, (20%) have an additional AAGAG focus that generally does not co-localize with H3K9me2. (e) Projections of representative nuclei probed for AAGAG RNA (magenta) and AAGAG DNA (yellow) and stained for H3K9me3 (gray) and DNA (DAPI = blue). Left = cycle 12 nuclei prior to stable heterochromatin formation; right = early cycle 14 nucleus during heterochromatin formation. Note that in cycle 12, the few AAGAG RNA foci do not co-localize with AAGAG DNA. In cycle 14, AAGAG RNA foci co-localize with AAGAG DNA and H3K9me3.
Figure 1—figure supplement 1
RNA-FISH analysis of satellite RNAs in cycle 14 embryos.
(a) ND = Not detected, *repeats tested for expression from both strands. For more details about AAGAG RNA in cycle 14, see Figure 1, A and E and Figure 1—figure supplement 2D. (b) Projections of cycle 14 nuclei (dashed circle = nuclear periphery); DNA (DAPI) = blue, indicated satellite RNAs in magenta.
Figure 1—figure supplement 2
AAGAG RNA is present throughout development and forms foci.
(a) Northern blot analyzing RNA from Oregon R embryos and third instar larva hybridized with a probe complementary to AAGAG(n). Note that signal intensity is not a representation of relative AAGAG RNA levels since different exposure times were used. (b-d) Examples of AAGAG RNA distributions in cycle 12, 13 and 14 embryos. Projections through embryo nuclei stained with DAPI (Blue). AAGAG RNA foci are shown in magenta and marked with arrows. (b) One of the 33% of cycle 12 embryos with AAGAG RNA foci. (c) One of the 67% of cycle 13 embryos with one or more foci (d) Cycle 14 embryo in which 100% of embryos contain AAGAG(n) RNA.
Figure 1—figure supplement 3
AAGAG RNA foci contain single-stranded RNA and are not associated with R-loops.
Confocal sections of embryonic nuclei in cycle 14 (with exception of left panel in ‘b’), nuclear periphery outlined in dotted circles. (a) No RNase control. (b) Treated with RNaseIII (left nucleus is cycle 12) (c) RNaseH (d) RNase1 and (e) RNaseA.
Figure 1—figure supplement 4
AAGAG RNA transcripts originate from 2R, X and 3R heterochromatin loci and are transcribed in embryos and larval brain.
(a) Unique regions adjacent to AAGAG(n), or AAGAG(n) within AG rich regions, were identified as potential sources of satellite transcripts, as described in Materials and methods. (+) indicates transcript containing AAGAG(n) or AG(n) blocks, while (-) indicates transcript containing CUCUU(n) or CU(n) blocks. Note that this designation of (+) and (-) strand does not preclude the possibility of rearrangements, that is conversion or flipping of satellite units within an array. (b) Northern blots of L3 RNA using probes to satellite (AAGAG or CUCUU), or adjacent unique regions. Unique regions shown are those containing at least one similar band size as AAGAG RNA. (-) strand regions for chrX 22,453,019–22,453,076 and the chr3R region did not exhibit any bands with a similar size as AAGAG RNA. (c—h) Confocal sections of embryo ventral ganglia or L3 brain lobe nuclei stained with DAPI (blue), and RNA-FISH to AAGAG (yellow) and unique region locations (magenta). ‘Unique Region’ (single copy sequence) RNA-FISH required Tyramide Signal Amplification (TSA), and therefore displays poorer resolution compared to AAGAG RNA (detected without TSA). Images labeled (+) used probes complementary to the strand containing AAGAG(n) or AG(n) blocks, while those labeled (-) recognize the strand containing CUCUU(n) or CU(n) blocks. Note that ‘unique region’ probe binds to regions adjacent to AAGAG(n) or AG(n), and not AAGAG(n) or AG(n) sequences themselves. Also note that the chr3R region indicated in ‘b’ was not analyzed in larvae. Only regions that co-localized with AAGAG RNA are shown. (c) Nuclei from late embryo ventral ganglia, RNA-FISH to AAGAG and probe from genomic coordinates chr2R:1,825,641–1,825,699 (top) or chrX:12,660,096–12,660,145 (bottom). (d-h) Confocal sections from L3 brain lobe nuclei, RNA-FISH to AAGAG and the following: (d) Unique region chr2R:1,825,641–1825699 (e) chr2R:1,826,691–1,826,740 f, chrX:11,830,844–11,830,910 g, chrX:12,660,096–12,660,145 hr, chrX:22,453,019–22,453,076.
Figure 1—figure supplement 5
AAGAG RNA-FISH localizes RNA and not DNA.
Confocal sections of cycle 14 nuclei treated with either (a) RNAseH or (b) RNAseIII after AAGAG RNA probe (magenta) hybridization. A higher laser intensity for the AAGAG probe channel was used in b to demonstrate abolishment of AAGAG signal.
Figure 1—figure supplement 6
AAGAG RNA is decreased and foci abolished in L3 with actin-GAL4-driven RNAi to AAGAG, without affecting levels of genes whose mRNAs contain short runs of AAGAG.
Also, AAGAG RNAi results in lethality. (a-c) Left column- section of brain lobes stained with DAPI (blue) and RNA-FISH to AAGAG RNA (magenta) imaged with the same intensity. Arrows point to AAGAG RNA foci. Right column- expanded images of left column indicated by dashed square. (a) Brain lobe from AAGAG RNAi (b) Brain lobe from scrambled RNAi. (c) Brain lobe from mCherry RNAi d, Northern blot with probes to AAGAG RNA or actin-5c in L3 RNAi. The AAGAG RNAi L3 AAGAG RNA top band signal is approximately 86% and 75% reduced compared to either scrambled or mCherry controls, respectively, when normalized to the actin-5c loading control. (e) RNA transcript levels (qRT-PCR) for euchromatic genes whose mRNAs contain short runs of AAGAG (pip5k59B, peb, CG33080). Numbers are means (from three biological replicates) ± standard deviation, after normalization to either (e) actin-5c loading control, or (f) rpl32 loading control. t-tests were performed in comparison to Oregon R or scrambled RNAi controls. This demonstrates that RNA levels of the few mRNAs containing an AAGAG sequence are not affected by AAGAG RNAi, ruling out the possibility that the observed lethality is due to off-target effects. (g) Ratio of pupae containing RNAi (driven by ubiquitous actin-GAL4 driver) or Tubby control, demonstrating lethality in AAGAG RNAi prior to the adult stage. (h) For embryos that hatch, death rates in larval and pupal stages differ after RNAi depletion of AAGAG, scrambled and mCherry controls (driven by ubiquitous actin-GAL4 driver). Note that death rate per stage is a measure of death only for those that survive to the indicated stage. **p<0.01, *p<0.05; error bars = SD; two tailed, type three t test.
Figure 2 with 3 supplements
AAGAG RNA is enriched in primary spermatocytes and necessary for male fertility.
(a) Confocal section of a larval testis. RNA-FISH to AAGAG = magenta, H2Av (chromatin) IF = gray, DNA (DAPI) = blue. S3, S5, and S6 refer to primary spermatocyte stages. (b) Enlarged confocal sections (representative boxes in a) of spermatocyte stages in larvae testes; scale bars = 5 µm. (c) Schematic summary of AAGAG RNA (magenta) localization in adult testes (see Figure 2—figure supplement 1 for a detailed description of spermatogenesis stages and events). AAGAG RNAs are visible in 16 cell primary spermatocytes (dark pink), and potentially 16 cell spermatogonial cysts (light pink); no AAGAG RNA was detected at earlier stages (hub, 2–8 cell spermatogonial cysts) or after the primary spermatocyte stage (meiosis I and II, sperm elongation- which includes leaf, canoe, individualization steps, and maturation). Post-round spermatid stages are indicated as spermatid nuclei. (d) Fertility after depletion of AAGAG(n) RNA in male primary spermatocytes or female ovaries using the Bam-GAL4 driver. An ~72% reduction in AAGAG RNA levels in testes (see Figure 2—figure supplement 3, B and C) results in complete male sterility but has no effect on female fertility. Expression of AAGAG(37) RNA simultaneously with AAGAG RNAi (both driven by Bam-Gal4) partially rescues male sterility (46% fertile). Expression of AAGAG RNA alone, without depletion of endogenous AAGAG RNAs, has no impact on male fertility. Statistically significant differences based on T-tests (two tailed, type three) are indicated by horizontal lines; ***p<0.001, **p<0.01; variation is represented by stdev.
Figure 2—figure supplement 1
Overview of normal spermatogenesis and defects observed after AAGAG RNA depletion.
(a) Spermatogenesis in Drosophila melanogaster initiates at the apical end of the testes (Hub), where GSCs divide asymmetrically, producing gonialblasts (GBs) that begin cell-differentiation. GB cells then undergo four mitotic divisions with incomplete cytokinesis to produce a cyst of 16 primary spermatocytes. Spermatocytes then undergo pre-meiotic S phase, mature during a prolonged G2 phase, and increase substantially in volume. The majority of testes-specific gene expression occurs at the primary spermatocyte stage, while genes not required until later stages are translationally repressed (reviewed in White-Cooper, 2010). Mature spermatocytes then undergo two rounds of meiosis to produce round spermatids (McKee et al., 2012), which are then processed into independent, condensed sperm nuclei in two stages (Rathke et al., 2014; Eren-Ghiani et al., 2015; Steinhauer, 2015). First, round spermatids undergo chromatin compaction, acrosome formation and flagellar elongation (Rathke et al., 2014; Eren-Ghiani et al., 2015). During chromatin compaction, a wave of histone H4 acetylation occurs, followed by deposition of the transition protein Mst77f, (Kost et al., 2015). Next, transition proteins are removed followed by the incorporation of protamines and prtl99c (histone:protamine exchange, indicated by tan to deep orange gradient) (Rathke et al., 2014; Eren-Ghiani et al., 2015). Finally, spermatid individualization involves removal of cytoplasm and tight condensing and coiling of chromatin (Steinhauer, 2015). Mature sperm are then stored in the seminal vesicle. (b) Summary of defects in late stages of spermatogenesis observed after depletion of AAGAG RNA by RNAi, using the Bam-Gal4 driver (data in Figure 3). Although AAGAG RNA is not visible in normal testes after the S6 spermatocyte stage (see a), RNAi depletion of AAGAG RNA only produces visible defects after the round spermatid stage. Aberrant elongation, sperm bundles, and defective histone:protamine exchange likely cause the observed complete absence of mature sperm in the SV.
Figure 2—figure supplement 2
Heterochromatic regions adjacent to AAGAG(n) or AG(n)-rich blocks are transcribed in primary spermatocytes, co-localize with AAGAG(n) RNA foci and do not come from the Y.
(a) Projections of Oregon R S5 spermatocytes probed for unique regions of RNA (green) adjacent to AAGAG(n) (magenta) or AAGAG(n) containing AG rich blocks. DAPI (DNA) is indicated in blue. (b) Projections of S5 spermatocyte probed to AAGAG RNA (magenta) imaged at same laser intensities in XY and XO genotypes. DNA is stained with DAPI (blue).
Figure 2—figure supplement 3
AAGAG RNA and not CUCUU RNA is substantially decreased in Bam-GAL4- driven AAGAG RNAi, and AAGAG RNA levels are increased in rescue experiments.
(a) Although visibly absent in embryos and somatic larval tissues, CUCUU RNA (green) is expressed in adult spermatocytes. Note that CUCUU RNA is localized to the S5 lumen, internal to the chromatin (DAPI), in contrast to the peripheral localization of AAGAG RNA (see Figure 3b); DNA = DAPI (blue). (b) Projections of AAGAG foci (magenta) in S5 spermatocytes after Bam-GAL4-driven Scrambled control or AAGAG RNAi. Signal was imaged with the same laser intensities for each genotype. (c) Average median intensities (arbitrary units, ± st. dev.) of AAGAG RNA, p=2×10−5 and CUCUU RNA in S5 spermatocytes in AAGAG and Scrambled RNAi testes (not significant). This represents a 72% reduction of AAGAG RNA in S5 spermatocytes after AAGAG RNAi, compared to scrambled controls, with little to no decrease in CUCUU RNA. (d) Average intensity of AAGAG RNA in S5 spermatocytes after AAGAG RNAi increases significantly (p=0.03) upon co-expression of AAGAG(37) RNA (also induced by the Bam-Gal4 driver). two tailed, type three t test used for all.
Figure 3 with 1 supplement
AAGAG RNAi depletion in mitotic germline cysts and spermatocytes (Bam-GAL4 driver) results in severe defects in sperm maturation and protamine deposition.
(a) Seminal vesicles (SVs) in testes from 0 to 6 hr old adults; DAPI (DNA) = cyan. Mature sperm nuclei visible as thin, elongated DAPI signals in the scrambled control (top, white arrow) are absent after AAGAG RNAi. Individualized mature sperm (white arrow) are visible in SVs from AAGAG RNAi males that also express AAGAG(37) RNA (partial rescue, 4–7 day old adults). (b) Bundles of elongating sperm nuclei visible in the scrambled RNAi control (top). Defective ‘decondensed’ (middle, white arrowheads), ‘knotted,’ ‘kinked ‘needle eyed’ and ‘lagging’ (bottom, white arrowheads) sperm phenotypes are visible in the AAGAG RNAi but are much less frequent or absent in controls (see e). (c) Transition Protein Mst77F (red) is present on sperm DNA in control RNAi but is largely absent and/or disorganized after AAGAG RNAi (dashed boxes indicate regions in the zoomed images to the right). (d) Protamine A/B (purple) is present on sperm DNA in the scrambled control RNAi but is absent after AAGAG RNAi. Scale bars = 10 µm except for zoomed images in c and d = 8 µm. (e) Quantitation of sperm defects (4–6 day adult testes) associated with AAGAG RNAi depletion, along with AAGAG RNA rescue, compared to scrambled RNAi control.
Figure 3—figure supplement 1
Histones are retained and DNA morphology is altered in late canoe stage AAGAG RNAi testes.
(a) Histones are retained until late canoe stage with AAGAG RNAi in primary spermatocytes but removed by early canoe stage in scrambled RNAi. (b) Canoe stage nuclei exhibit abnormal morphology with AAGAG RNAi, and this morphology is partially restored with AAGAG(37) rescue.
Figure 4
Model for AAGAG RNA function during spermatogenesis.
AAGAG RNA (magenta) present only in primary spermatocytes (light blue = chromosome territories) acts directly or indirectly to promote important processes later in sperm maturation, including the histone-protamine transition and individualization. AAGAG RNA could ensure normal completion of later events by mediating: (a) proper localization of factors (RNA and/or protein) through sequestration (green) or exclusion (orange), (b) formation of molecular complexes or modifications (e.g. PTMs) (green blobs plus blue ovals), (c) regulation of global DNA/chromatin organization (e.g. condensation, Y loops, Higher Order Structures (HOS)) which for example could impact expression of critical spermatogenesis genes, or (d) local DNA/chromatin organization of cognate AAGAG loci, as observed for heterochromatin recruitment by siRNAs. Although direct experiments are required to test these models, we favor d) because it can accommodate both fast turnover of satellite sequences during evolution and sequence-independent roles in ensuring fertility (see text).
Tables
Table 1
Male fertility in AAGAG RNAi with GAL4 drivers expressed at earlier testes stages than Bam.
| GAL4 RNAi driver | Expression location (Demarco et al., 2014) | % fertile | + /- stdev. | Minimum number of males per set |
|---|---|---|---|---|
| Fascillin | Hub | 94 | 16 | 15 |
| PTC | Soma- CySCs and cyst cells | 90 | 5 | 18 |
| Traffic Jam | Soma- Hub and CySCs | 97 | 4 | 12 |
| Dpp1 | Soma- CySCs and early cyst cells | 96 | 6 | 17 |
| Nanos | Germline- GSCs and early germline cysts | 83 | 5 | 13 |
Table 2
Oligos for RNA probes.
| Repeat or region | Oligo with T3 antisense promoter |
|---|---|
| CAGC(n) | CAGCCAGCCAGCCAGCCAGCCAGCTCTCCCTTTAGTGAGGGTTAATT |
| CCCA(n) | CCCACCCACCCACCCACCCACCCACCCATCTCCCTTTAGTGAGGGTTAATT |
| CATTA(n) | CATTACATTACATTACATTACATTATCTCCCTTTAGTGAGGGTTAATT |
| CGGAG(n) | CGGAGCGGAGCGGAGCGGAGCGGAGTCTCCCTTTAGTGAGGGTTAATT |
| CGA(n) | CGACGACGACGACGACGACGACGATCTCCCTTTAGTGAGGGTTAATT |
| CAACT(n) | CAACTCAACTCAACTCAACTCAACTTCTCCCTTTAGTGAGGGTTAATT |
| CGAAG(n) | CGAAGCGAAGCGAAGCGAAGCGAAGTCTCCCTTTAGTGAGGGTTAATT |
| CCCCAG(n) | CCCCAGCCCCAGCCCCAGCCCCAGTCTCCCTTTAGTGAGGGTTAATT |
| CCGAG(n) | CCGAGCCGAGCCGAGCCGAGCCGAGTCTCCCTTTAGTGAGGGTTAATT |
| CGGAA(n) | CGGAACGGAACGGAACGGAACGGAATCTCCCTTTAGTGAGGGTTAATT |
| CACCC(n) | CACCCCACCCCACCCCACCCCACCCTCTCCCTTTAGTGAGGGTTAATT |
| CTAGT(n) | CTAGTCTAGTCTAGTCTAGTCTAGTTCTCCCTTTAGTGAGGGTTAATT |
| CATCG(n) | CATCGCATCGCATCGCATCGCATCGTCTCCCTTTAGTGAGGGTTAATT |
| CAT(n) | CATCATCATCATCATCATCATCATTCTCCCTTTAGTGAGGGTTAATT |
| CAAAC(n) | CAAACCAAACCAAACCAAACCAAACTCTCCCTTTAGTGAGGGTTAATT |
| CGAAA(n) | CGAAACGAAACGAAACGAAACGAAATCTCCCTTTAGTGAGGGTTAATT |
| CATAT(n) | CATATCATATCATATCATATCATATTCTCCCTTTAGTGAGGGTTAATT |
| GAAA(n) | GAAAGAAAGAAAGAAAGAAAGAAATCTCCCTTTAGTGAGGGTTAATT |
| CAGAA(n) | CAGAACAGAACAGAACAGAACAGAATCTCCCTTTAGTGAGGGTTAATT |
| AAGGAG(n) | AAGGAGAAGGAGAAGGAGAAGGAGAAGGAGTCTCCCTTTAGTGAGGGTTAATT |
| AAGAGG(n) | AAGAGGAAGAGGAAGAGGAAGAGGAAGAGGTCTCCCTTTAGTGAGGGTTAATT |
| AATAC(n) | AATACAATACAATACAATACAATACAATACTCTCCCTTTAGTGAGGGTTAATT |
| AATAG(n) | AATAGAATAGAATAGAATAGAATAGAATAGTCTCCCTTTAGTGAGGGTTAATT |
| AATAGAC(n) | AATAGACAATAGACAATAGACAATAGACTCTCCCTTTAGTGAGGGTTAATT |
| AATAACATAG(n) | AATAACATAGAATAACATAGAATAACATAGTCTCCCTTTAGTGAGGGTTAATT |
| AACAC(n) | AACACAACACAACACAACACAACACAACACTCTCCCTTTAGTGAGGGTTAATT |
| dodeca(n) | ACCGAGTACGGGACCGAGTACGGGTCTCCCTTTAGTGAGGGTTAATT |
| GTGTT(n) | GTGTTGTGTTGTGTTGTGTTGTGTTGTGTTTCTCCCTTTAGTGAGGGTTAATT |
| GTAAT(n) | GTAATGTAATGTAATGTAATGTAATGTAATTCTCCCTTTAGTGAGGGTTAATT |
| GTATT(n) | GTATTGTATTGTATTGTATTGTATTGTATTTCTCCCTTTAGTGAGGGTTAATT |
| TTAA (n) | TTAATTAATTAATTAATTAATTAATTAATTAATCTCCCTTTAGTGAGGGTTAATT |
| CAAT (n) | CAATCAATCAATCAATCAATCAATCAATCAATTCTCCCTTTAGTGAGGGTTAATT |
| AAGAG(n) | GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAATCTCCCTTTAGTGAGGGTTAATT |
| CTCTT(n) | CTCTTCTCTTCTCTTCTCTTCTCTTCTCTTTCTCCCTTTAGTGAGGGTTAATT |
| 359 Forward | AATTAACCCTCACTAAAGGGAGAAATGGAAATTAAATTTTTTGG |
| 359 Reverse | TTAATACGACTCACTATAGGGAGAGTTTTGAGCAGCTAATTACC |
| chr2R:1,825,641–1825699 sense | GGCAGTTTATGTGCGTACAACAACAACAGGACTGCAAACAAAACACGAAACAGATATTTTTCTCCCTTTAGTGAGGGTTAATT |
| chr2R:1,825,641–1825699 anti-sense | AAAATATCTGTTTCGTGTTTTGTTTGCAGTCCTGTTGTTGTTGTACGCACATAAACTGCCTCTCCCTTTAGTGAGGGTTAATT |
| chr2R:1,826,691–1,826,740 sense | TAGACACATCTACGAAGACACAATTCTACAAGAACTAAACAACAAAAAGTTCTCCCTTTAGTGAGGGTTAATT |
| chr2R:1,826,691–1,826,740 anti-sense | ACTTTTTGTTGTTTAGTTCTTGTAGAATTGTGTCTTCGTAGATGTGTCTATCTCCCTTTAGTGAGGGTTAATT |
| chrX:11,830,844–11,830,910 sense | CCAAGCTTCAGGAGAAAGAGAAAGAAGAAAGCTTTAAACTTAAGGAAAGAGAAGAGAGCCTTAGGATTCTCCCTTTAGTGAGGGTTAATT |
| chrX:11,830,844–11,830,910 antisense | CTAAGGCTCTCTTCTCTTTCCTTAAGTTTAAAGCTTTCTTCTTTCTCTTTCTCCTGAAGCTTGGCTTTCTCCCTTTAGTGAGGGTTAATT |
| chrX:12,660,096–12,660,145 sense | TCGCACACACACACGCAACACTTAGGCACACATAGGAGATAGAGTGAGATCTCCCTTTAGTGAGGGTTAATT |
| chrX:12,660,096–12,660,145 anti-sense | TCTCACTCTATCTCCTATGTGTGCCTAAGTGTTGCGTGTGTGTGTGCGATCTCCCTTTAGTGAGGGTTAA TT |
| chrX:22,453,019–22,453,076 sense | CGACAGACAGTAAAATTAAACAAACTGCGGACGCGTGTGACAGAACTAATCCAACTTTCTCCCTTTAGTGAGGGTTAATT |
| chrX:22,453,019–22,453,076 anti-sense | AAGTTGGATTAGTTCTGTCACACGCGTCCGCAGTTTGTTTAATTTTACTGTCTGTCGTCTCCCTTTAGTGAGGGTTAATT |
| chr3R:3,169,758–3,169,820 antisense | TCGGAAGAGACTAAACTTGTGCATTCGATATAGCTCTTTGTCGGCCCTAGCTGCTGTAAACAATCTCCCTTTAGTGAGGGTTAATT |
| chr3R:3,169,758–3,169,820 sense | TTGTTTACAGCAGCTAGGGCCGACAAAGAGCTATATCGAATGCACAAGTTTAGTCTCTTCCGATCTCCCTTTAGTGAGGGTTAATT |
| chr3R:3,170,372–3,170,441 antisense | TTAAACTATATTAAACATTGTATATAAGTATAATAGCGAATACTATTTACGTATATGTTCT TTCATAAATTCTCCCTTTAGTGAGGGTTAATT |
| chr3R:3,170,372–3,170,441 sense | ATTTATGAAAGAACATATACGTAAATAGTATTCGCTATTATACTTATATACAATGTTTAATATAGTTTAATCTCCCTTTAGTGAGGGTTAATT |
Table 3
Antibodies used for Immuno-Fluorescence.
| Antibody | Supplier; Cat. number | Working concentration |
|---|---|---|
| Rabbit-anti H3K9me3 | Abcam; 8898 | 1/250 |
| Mouse-anti H3K9me2 | Active Motif; 39753 | 1/250 |
| Rabbit-anti-H2AV | Lake placid AM318; 9751 | 1/100 |
| Goat anti-GFP | Rockland 121600-101-215 | 1/500 |
| Rabbit anti-H4acetyl | Millipore 06–598 | 1/200 |
| Rat anti-Mst77F | Elaine Dunleavy, PhD; NUI Galway, Ireland | 1/200 |
| Guinea pig anti-Mst35Ba/Bb (Protamine A/B) | Elaine Dunleavy, PhD; NUI Galway, Ireland | 1/200 |
| Mouse anti pan-histone | Millipore MAB 3422 | 1/200 |
Table 4
Uniquely mapped RNA identified via phrap adjacent AAGAG(>10) containing blocks
| Chr | e0-2hr | e2-4hr | e4-8hr | e8-12hr | e12-14hr | e14-16hr | e16-20hr | e20-24hr |
|---|---|---|---|---|---|---|---|---|
| 2R | NA | NA | NA | NA | NA | NA | chr2R.1825640.1825699 | NA |
| X | NA | NA | NA | NA | NA | NA | NA | chrX.12660077.12660134 |
| X | NA | NA | NA | NA | NA | NA | chrX.11830795.11830858 | NA |
| X | chrX.22453019.22453120 | NA | chrX.22453019.22453182 | NA | chrX.22453019.22453163 | chrX.22453019.22453177 | chrX.22453019.22453093 | chrX. 22453019.22453196 |
Table 5
shRNA and overexpression oligos.
| Description | Sequence 5’−3’ |
|---|---|
| shRNA to AAGAG(n) | ctagcagtGAAGAGAAGAGAAGAGAAGAGtagttatattcaagcataCTCTTCTCTTCTCTTCTCTTCgcg |
| shRNA to AAGAG(n) complement | aattcgcGAAGAGAAGAGAAGAGAAGAGtatgcttgaatataactaCTCTTCTCTTCTCTTCTCTTCactg |
| shRNA to scrambled | ctagcagtGAGAGAAAAAGGGAAAGAAGGtagttatattcaagcataCCTTCTTTCCCTTTTTCTCTCgcg |
| shRNA to scrambled complement | aattcgcGAGAGAAAAAGGGAAAGAAGGtatgcttgaatataactaCCTTCTTTCCCTTTTTCTCTCactg |
| AAGAG(37) for over-expression | ATCAAGACTGCTAGCAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAG |
| AAGAG(37) over-expression complement | CCATTGACTGAATTCCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTT |
Table 6
Fly lines.
| Stock name or genotype | Obtained from: stock number | Description | |
|---|---|---|---|
| y[1] v[1]; P{y[+t7.7]=CaryP}attP40 | Bloomington: 36304 | Background strain for insertion of pValium20 vector containing shRNA | |
| y[1] v[1]; P{y[+t7.7]=CaryP}attP2 | Bloomington: 36303 | Background strain for insertion of pValium vector containing AAGAG expression construct. | |
| y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=VALIUM20-mCherry}attP2 | Bloomington: 35785 | Control strain for RNAi. Expresses dsRNA to mCherry | |
| y[1] v[1]:UAS-AAGAG shRNA:: | Rainbow Transgenic Flies, Inc | Expresses shRNA under UAS promoter targeting AAGAG(n) | |
| y[1] v[1]:UAS-scramble shRNA:: | Rainbow Transgenic Flies, Inc | Expresses shRNA under UAS promoter targeting random AG containing sequences | |
| y[1] w[67c23]; P{w[+mC]=dpp-GAL4.PS}6A/TM3, Ser[1] | Bloomington: 7007 | Dpp-GAL4 | |
| y[1] v[1]::UAS-AAGAG(37) | Rainbow Transgenic Flies, Inc | Expresses a 187 base repeat of AAGAG RNA under a UAS promoter | |
| C(1;Y)1, y[1] w[A738]: y[+]/0 and C(1)RM, y[1] v[1]/0 | Bloomington:2494 | XO (Y chromosome deficient males) | |
| y[*] w[*]; P{w[+mW.hs]=GawB}NP1233/CyO, P{w[-]=UAS lacZ.UW14}UW14 | Kyoto: 103948 | Fascillin-GAL4 | |
| y[*] w[*]; P{w[+mW.hs]=GawB}NP1624/CyO, P{w[-]=UAS lacZ.UW14}UW14 | Kyoto:104055 | Traffic Jam-GAL4 | |
| w[*]; P{w[+mW.hs]=GawB}ptc[559.1] | Kyoto: 103948 | PTC-GAL4 | |
| :: nanos-Gal4, dcr2-UAS/TM3 sb | Unknown | Nanos-GAL4 | |
| w;;bamGAL4, UAS-dicer2 | Unknown | Bam-GAL4 | |
| y[1] w[*]::P{w[+mC]=Act5 C-GAL4}17bFO1/TM6B, Tb[1] | Bloomington: stock 3954 | Expresses GAL4 ubiquitously under control of Act5C promoter |
Table 7
Quantification of post-canoe stage sperm DNA morphological defects in 4–7 day old testes.
| N | Normal bundle | Lagging bundle | Kinked | Knotted | Needle eyed | Decondensed | |
|---|---|---|---|---|---|---|---|
| Scrambled RNAi | 1 | 2 | 2 | 4 | 0 | 0 | 0 |
| 2 | 9 | 7 | 6 | 0 | 0 | 0 | |
| 3 | 21 | 5 | 0 | 0 | 0 | 0 | |
| 4 | 5 | 1 | 0 | 0 | 0 | 0 | |
| 5 | 29 | 1 | 0 | 0 | 0 | 0 | |
| 6 | 6 | 2 | 0 | 0 | 0 | 0 | |
| AAGAG RNAi | 1 | 0 | 8 | 2 | 0 | 0 | 2 |
| 2 | 1 | 8 | 0 | 2 | 2 | 0 | |
| 3 | 0 | 1 | 5 | 2 | 1 | 0 | |
| 4 | 0 | 0 | 1 | 0 | 0 | 0 | |
| 5 | 0 | 1 | 2 | 1 | 1 | 0 | |
| 6 | 0 | 1 | 5 | 1 | 0 | 0 | |
| 7 | 0 | 0 | 3 | 3 | 0 | 0 | |
| 8 | 0 | 0 | 0 | 0 | 1 | 0 | |
| 9 | 1 | 2 | 4 | 1 | 1 | 0 | |
| 10 | 3 | 5 | 2 | 4 | 2 | 0 | |
| 11 | 2 | 2 | 14 | 0 | 1 | 0 | |
| 12 | 1 | 4 | 9 | 1 | 1 | 0 | |
| AAGAG RNA (Rescue) | 1 | 0 | 1 | 2 | 0 | 0 | 0 |
| 2 | 5 | 2 | 2 | 0 | 0 | 0 | |
| 3 | 7 | 1 | 1 | 0 | 0 | 0 | |
| 4 | 8 | 3 | 6 | 3 | 0 | 0 | |
| 5 | 0 | 0 | 9 | 0 | 0 | 0 | |
| 6 | 4 | 4 | 6 | 0 | 0 | 0 | |
| 7 | 8 | 4 | 3 | 0 | 0 | 0 | |
| 8 | 9 | 6 | 7 | 0 | 0 | 0 | |
| 9 | 11 | 1 | 5 | 0 | 0 | 0 | |
| 10 | 8 | 2 | 4 | 0 | 0 | 0 | |
| 11 | 3 | 0 | 2 | 0 | 0 | 0 | |
| 12 | 3 | 0 | 6 | 1 | 0 | 0 | |
| 13 | 2 | 2 | 8 | 0 | 0 | 0 | |
| 14 | 5 | 7 | 5 | 0 | 1 | 0 | |
| 15 | 5 | 0 | 3 | 0 | 0 | 0 | |
| 16 | 5 | 5 | 5 | 1 | 0 | 0 | |
| 17 | 3 | 4 | 3 | 0 | 0 | 0 | |
| 18 | 5 | 1 | 6 | 0 | 0 | 0 | |
| 19 | 3 | 11 | 5 | 1 | 0 | 0 | |
| 20 | 3 | 2 | 1 | 0 | 1 | 0 |
Table 8
Quantification of canoe stage DNA morphological defects, in 4–7 day old testes
| N | Normal canoe | Abnormal canoe | |
|---|---|---|---|
| Scrambled RNAi | 1 | 2 | 0 |
| 2 | 7 | 1 | |
| 3 | 6 | 1 | |
| 4 | 3 | 5 | |
| 5 | 9 | 1 | |
| 6 | 5 | 1 | |
| AAGAG RNAi | 1 | 1 | 0 |
| 2 | 0 | 1 | |
| 3 | 0 | 1 | |
| 4 | 1 | 1 | |
| 5 | 0 | 0 | |
| 6 | 0 | 1 | |
| 7 | 0 | 0 | |
| 8 | 2 | 4 | |
| 9 | 1 | 2 | |
| 10 | 0 | 2 | |
| 11 | 1 | 2 | |
| 12 | 3 | 6 | |
| 13 | 2 | 7 | |
| 14 | 1 | 5 | |
| AAGAG RNA (Rescue) | 1 | 7 | 4 |
| 2 | 3 | 2 | |
| 3 | 0 | 3 | |
| 4 | 0 | 4 | |
| 5 | 0 | 3 | |
| 6 | 0 | 0 | |
| 7 | 1 | 4 | |
| 8 | 3 | 4 | |
| 9 | 6 | 8 | |
| 10 | 3 | 3 | |
| 11 | 1 | 0 | |
| 12 | 2 | 2 | |
| 13 | 8 | 9 | |
| 14 | 1 | 6 | |
| 15 | 0 | 2 | |
| 16 | 7 | 9 | |
| 17 | 0 | 1 | |
| 18 | 3 | 2 | |
| 19 | 2 | 4 | |
| 20 | 1 | 1 |
Table 9
qPCR oligos.
| mRNA target | Sequence 5’−3’ |
|---|---|
| Actin-5c Forward | CAGCCAGCAGTCGTCTAATC |
| Actin-5c Reverse | ACAACCAGAGCAGCAACTTC |
| Rpl32 Forward | CGATGTTGG GCATCAGATAC |
| Rpl32 Reverse | CCCAAGATCGTGAAGAAGC |
| pip5K59B Forward | CTCCTGCTCTGCTATCGTATTC |
| pip5K59B Reverse | AGAGGAGCCATCAACATCAC |
| Peb Forward | TGGTTGGACCGCTTAACATAG |
| Peb Reverse | GCGACACCAAGAGCCATAA |
| CG33080 Forward | ATTACGATCGCGGGCTTATC |
| CG33080 Reverse | CGGTTCTAGGAGCACTGATATAAA |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
RNA from a simple-tandem repeat is required for sperm maturation and male fertility in Drosophila melanogaster
eLife 8:e48940.
https://doi.org/10.7554/eLife.48940
