1. Cell Biology
  2. Chromosomes and Gene Expression
Download icon

RNA from a simple-tandem repeat is required for sperm maturation and male fertility in Drosophila melanogaster

  1. Wilbur Kyle Mills
  2. Yuh Chwen G Lee
  3. Antje M Kochendoerfer
  4. Elaine M Dunleavy
  5. Gary H Karpen  Is a corresponding author
  1. University of California, Berkeley, United States
  2. Lawrence Berkeley National Laboratory, United States
  3. University of California, Irvine, United States
  4. National University of Ireland, Ireland
Short Report
Cite this article as: eLife 2019;8:e48940 doi: 10.7554/eLife.48940
4 figures, 9 tables and 1 additional file

Figures

Figure 1 with 6 supplements
AAGAG(n) RNA localizations in embryos and larvae.

(a) AAGAG RNA distributions (magenta) throughout embryonic and larval development in Oregon R flies. DNA/DAPI = blue; all images are confocal sections. White box indicates location of enlarged nucleus (right column). (b) Distributions of AAGAG RNA in intact larval L3 brain (left) and salivary gland (SG) tissue (right) (confocal sections). (c) Salivary gland squash projection indicating presence of AAGAG RNA (magenta, see arrows) at the chromocenter (marked with H3K9me2), and not the euchromatic arms. (d) Brain cell sections show that there are one or two AAGAG RNA foci per nucleus that are located in or near the pericentromeric heterochromatin (H3K9me2 antibody IF, green). Specifically, 100% of nuclei (N = 5) with AAGAG foci contain foci that completely or partially co-localize with H3K9me2 (left panel). Of these nuclei, (20%) have an additional AAGAG focus that generally does not co-localize with H3K9me2. (e) Projections of representative nuclei probed for AAGAG RNA (magenta) and AAGAG DNA (yellow) and stained for H3K9me3 (gray) and DNA (DAPI = blue). Left = cycle 12 nuclei prior to stable heterochromatin formation; right = early cycle 14 nucleus during heterochromatin formation. Note that in cycle 12, the few AAGAG RNA foci do not co-localize with AAGAG DNA. In cycle 14, AAGAG RNA foci co-localize with AAGAG DNA and H3K9me3.

Figure 1—figure supplement 1
RNA-FISH analysis of satellite RNAs in cycle 14 embryos.

(a) ND = Not detected, *repeats tested for expression from both strands. For more details about AAGAG RNA in cycle 14, see Figure 1, A and E and Figure 1—figure supplement 2D. (b) Projections of cycle 14 nuclei (dashed circle = nuclear periphery); DNA (DAPI) = blue, indicated satellite RNAs in magenta.

Figure 1—figure supplement 2
AAGAG RNA is present throughout development and forms foci.

(a) Northern blot analyzing RNA from Oregon R embryos and third instar larva hybridized with a probe complementary to AAGAG(n). Note that signal intensity is not a representation of relative AAGAG RNA levels since different exposure times were used. (b-d) Examples of AAGAG RNA distributions in cycle 12, 13 and 14 embryos. Projections through embryo nuclei stained with DAPI (Blue). AAGAG RNA foci are shown in magenta and marked with arrows. (b) One of the 33% of cycle 12 embryos with AAGAG RNA foci. (c) One of the 67% of cycle 13 embryos with one or more foci (d) Cycle 14 embryo in which 100% of embryos contain AAGAG(n) RNA.

Figure 1—figure supplement 3
AAGAG RNA foci contain single-stranded RNA and are not associated with R-loops.

Confocal sections of embryonic nuclei in cycle 14 (with exception of left panel in ‘b’), nuclear periphery outlined in dotted circles. (a) No RNase control. (b) Treated with RNaseIII (left nucleus is cycle 12) (c) RNaseH (d) RNase1 and (e) RNaseA.

Figure 1—figure supplement 4
AAGAG RNA transcripts originate from 2R, X and 3R heterochromatin loci and are transcribed in embryos and larval brain.

(a) Unique regions adjacent to AAGAG(n), or AAGAG(n) within AG rich regions, were identified as potential sources of satellite transcripts, as described in Materials and methods. (+) indicates transcript containing AAGAG(n) or AG(n) blocks, while (-) indicates transcript containing CUCUU(n) or CU(n) blocks. Note that this designation of (+) and (-) strand does not preclude the possibility of rearrangements, that is conversion or flipping of satellite units within an array. (b) Northern blots of L3 RNA using probes to satellite (AAGAG or CUCUU), or adjacent unique regions. Unique regions shown are those containing at least one similar band size as AAGAG RNA. (-) strand regions for chrX 22,453,019–22,453,076 and the chr3R region did not exhibit any bands with a similar size as AAGAG RNA. (c—h) Confocal sections of embryo ventral ganglia or L3 brain lobe nuclei stained with DAPI (blue), and RNA-FISH to AAGAG (yellow) and unique region locations (magenta). ‘Unique Region’ (single copy sequence) RNA-FISH required Tyramide Signal Amplification (TSA), and therefore displays poorer resolution compared to AAGAG RNA (detected without TSA). Images labeled (+) used probes complementary to the strand containing AAGAG(n) or AG(n) blocks, while those labeled (-) recognize the strand containing CUCUU(n) or CU(n) blocks. Note that ‘unique region’ probe binds to regions adjacent to AAGAG(n) or AG(n), and not AAGAG(n) or AG(n) sequences themselves. Also note that the chr3R region indicated in ‘b’ was not analyzed in larvae. Only regions that co-localized with AAGAG RNA are shown. (c) Nuclei from late embryo ventral ganglia, RNA-FISH to AAGAG and probe from genomic coordinates chr2R:1,825,641–1,825,699 (top) or chrX:12,660,096–12,660,145 (bottom). (d-h) Confocal sections from L3 brain lobe nuclei, RNA-FISH to AAGAG and the following: (d) Unique region chr2R:1,825,641–1825699 (e) chr2R:1,826,691–1,826,740 f, chrX:11,830,844–11,830,910 g, chrX:12,660,096–12,660,145 hr, chrX:22,453,019–22,453,076.

Figure 1—figure supplement 5
AAGAG RNA-FISH localizes RNA and not DNA.

Confocal sections of cycle 14 nuclei treated with either (a) RNAseH or (b) RNAseIII after AAGAG RNA probe (magenta) hybridization. A higher laser intensity for the AAGAG probe channel was used in b to demonstrate abolishment of AAGAG signal.

Figure 1—figure supplement 6
AAGAG RNA is decreased and foci abolished in L3 with actin-GAL4-driven RNAi to AAGAG, without affecting levels of genes whose mRNAs contain short runs of AAGAG.

Also, AAGAG RNAi results in lethality. (a-c) Left column- section of brain lobes stained with DAPI (blue) and RNA-FISH to AAGAG RNA (magenta) imaged with the same intensity. Arrows point to AAGAG RNA foci. Right column- expanded images of left column indicated by dashed square. (a) Brain lobe from AAGAG RNAi (b) Brain lobe from scrambled RNAi. (c) Brain lobe from mCherry RNAi d, Northern blot with probes to AAGAG RNA or actin-5c in L3 RNAi. The AAGAG RNAi L3 AAGAG RNA top band signal is approximately 86% and 75% reduced compared to either scrambled or mCherry controls, respectively, when normalized to the actin-5c loading control. (e) RNA transcript levels (qRT-PCR) for euchromatic genes whose mRNAs contain short runs of AAGAG (pip5k59B, peb, CG33080). Numbers are means (from three biological replicates) ± standard deviation, after normalization to either (e) actin-5c loading control, or (f) rpl32 loading control. t-tests were performed in comparison to Oregon R or scrambled RNAi controls. This demonstrates that RNA levels of the few mRNAs containing an AAGAG sequence are not affected by AAGAG RNAi, ruling out the possibility that the observed lethality is due to off-target effects. (g) Ratio of pupae containing RNAi (driven by ubiquitous actin-GAL4 driver) or Tubby control, demonstrating lethality in AAGAG RNAi prior to the adult stage. (h) For embryos that hatch, death rates in larval and pupal stages differ after RNAi depletion of AAGAG, scrambled and mCherry controls (driven by ubiquitous actin-GAL4 driver). Note that death rate per stage is a measure of death only for those that survive to the indicated stage. **p<0.01, *p<0.05; error bars = SD; two tailed, type three t test.

Figure 2 with 3 supplements
AAGAG RNA is enriched in primary spermatocytes and necessary for male fertility.

(a) Confocal section of a larval testis. RNA-FISH to AAGAG = magenta, H2Av (chromatin) IF = gray, DNA (DAPI) = blue. S3, S5, and S6 refer to primary spermatocyte stages. (b) Enlarged confocal sections (representative boxes in a) of spermatocyte stages in larvae testes; scale bars = 5 µm. (c) Schematic summary of AAGAG RNA (magenta) localization in adult testes (see Figure 2—figure supplement 1 for a detailed description of spermatogenesis stages and events). AAGAG RNAs are visible in 16 cell primary spermatocytes (dark pink), and potentially 16 cell spermatogonial cysts (light pink); no AAGAG RNA was detected at earlier stages (hub, 2–8 cell spermatogonial cysts) or after the primary spermatocyte stage (meiosis I and II, sperm elongation- which includes leaf, canoe, individualization steps, and maturation). Post-round spermatid stages are indicated as spermatid nuclei. (d) Fertility after depletion of AAGAG(n) RNA in male primary spermatocytes or female ovaries using the Bam-GAL4 driver. An ~72% reduction in AAGAG RNA levels in testes (see Figure 2—figure supplement 3, B and C) results in complete male sterility but has no effect on female fertility. Expression of AAGAG(37) RNA simultaneously with AAGAG RNAi (both driven by Bam-Gal4) partially rescues male sterility (46% fertile). Expression of AAGAG RNA alone, without depletion of endogenous AAGAG RNAs, has no impact on male fertility. Statistically significant differences based on T-tests (two tailed, type three) are indicated by horizontal lines; ***p<0.001, **p<0.01; variation is represented by stdev.

Figure 2—figure supplement 1
Overview of normal spermatogenesis and defects observed after AAGAG RNA depletion.

(a) Spermatogenesis in Drosophila melanogaster initiates at the apical end of the testes (Hub), where GSCs divide asymmetrically, producing gonialblasts (GBs) that begin cell-differentiation. GB cells then undergo four mitotic divisions with incomplete cytokinesis to produce a cyst of 16 primary spermatocytes. Spermatocytes then undergo pre-meiotic S phase, mature during a prolonged G2 phase, and increase substantially in volume. The majority of testes-specific gene expression occurs at the primary spermatocyte stage, while genes not required until later stages are translationally repressed (reviewed in White-Cooper, 2010). Mature spermatocytes then undergo two rounds of meiosis to produce round spermatids (McKee et al., 2012), which are then processed into independent, condensed sperm nuclei in two stages (Rathke et al., 2014; Eren-Ghiani et al., 2015; Steinhauer, 2015). First, round spermatids undergo chromatin compaction, acrosome formation and flagellar elongation (Rathke et al., 2014; Eren-Ghiani et al., 2015). During chromatin compaction, a wave of histone H4 acetylation occurs, followed by deposition of the transition protein Mst77f, (Kost et al., 2015). Next, transition proteins are removed followed by the incorporation of protamines and prtl99c (histone:protamine exchange, indicated by tan to deep orange gradient) (Rathke et al., 2014; Eren-Ghiani et al., 2015). Finally, spermatid individualization involves removal of cytoplasm and tight condensing and coiling of chromatin (Steinhauer, 2015). Mature sperm are then stored in the seminal vesicle. (b) Summary of defects in late stages of spermatogenesis observed after depletion of AAGAG RNA by RNAi, using the Bam-Gal4 driver (data in Figure 3). Although AAGAG RNA is not visible in normal testes after the S6 spermatocyte stage (see a), RNAi depletion of AAGAG RNA only produces visible defects after the round spermatid stage. Aberrant elongation, sperm bundles, and defective histone:protamine exchange likely cause the observed complete absence of mature sperm in the SV.

Figure 2—figure supplement 2
Heterochromatic regions adjacent to AAGAG(n) or AG(n)-rich blocks are transcribed in primary spermatocytes, co-localize with AAGAG(n) RNA foci and do not come from the Y.

(a) Projections of Oregon R S5 spermatocytes probed for unique regions of RNA (green) adjacent to AAGAG(n) (magenta) or AAGAG(n) containing AG rich blocks. DAPI (DNA) is indicated in blue. (b) Projections of S5 spermatocyte probed to AAGAG RNA (magenta) imaged at same laser intensities in XY and XO genotypes. DNA is stained with DAPI (blue).

Figure 2—figure supplement 3
AAGAG RNA and not CUCUU RNA is substantially decreased in Bam-GAL4- driven AAGAG RNAi, and AAGAG RNA levels are increased in rescue experiments.

(a) Although visibly absent in embryos and somatic larval tissues, CUCUU RNA (green) is expressed in adult spermatocytes. Note that CUCUU RNA is localized to the S5 lumen, internal to the chromatin (DAPI), in contrast to the peripheral localization of AAGAG RNA (see Figure 3b); DNA = DAPI (blue). (b) Projections of AAGAG foci (magenta) in S5 spermatocytes after Bam-GAL4-driven Scrambled control or AAGAG RNAi. Signal was imaged with the same laser intensities for each genotype. (c) Average median intensities (arbitrary units, ± st. dev.) of AAGAG RNA, p=2×10−5 and CUCUU RNA in S5 spermatocytes in AAGAG and Scrambled RNAi testes (not significant). This represents a 72% reduction of AAGAG RNA in S5 spermatocytes after AAGAG RNAi, compared to scrambled controls, with little to no decrease in CUCUU RNA. (d) Average intensity of AAGAG RNA in S5 spermatocytes after AAGAG RNAi increases significantly (p=0.03) upon co-expression of AAGAG(37) RNA (also induced by the Bam-Gal4 driver). two tailed, type three t test used for all.

Figure 3 with 1 supplement
AAGAG RNAi depletion in mitotic germline cysts and spermatocytes (Bam-GAL4 driver) results in severe defects in sperm maturation and protamine deposition.

(a) Seminal vesicles (SVs) in testes from 0 to 6 hr old adults; DAPI (DNA) = cyan. Mature sperm nuclei visible as thin, elongated DAPI signals in the scrambled control (top, white arrow) are absent after AAGAG RNAi. Individualized mature sperm (white arrow) are visible in SVs from AAGAG RNAi males that also express AAGAG(37) RNA (partial rescue, 4–7 day old adults). (b) Bundles of elongating sperm nuclei visible in the scrambled RNAi control (top). Defective ‘decondensed’ (middle, white arrowheads), ‘knotted,’ ‘kinked ‘needle eyed’ and ‘lagging’ (bottom, white arrowheads) sperm phenotypes are visible in the AAGAG RNAi but are much less frequent or absent in controls (see e). (c) Transition Protein Mst77F (red) is present on sperm DNA in control RNAi but is largely absent and/or disorganized after AAGAG RNAi (dashed boxes indicate regions in the zoomed images to the right). (d) Protamine A/B (purple) is present on sperm DNA in the scrambled control RNAi but is absent after AAGAG RNAi. Scale bars = 10 µm except for zoomed images in c and d = 8 µm. (e) Quantitation of sperm defects (4–6 day adult testes) associated with AAGAG RNAi depletion, along with AAGAG RNA rescue, compared to scrambled RNAi control.

Figure 3—figure supplement 1
Histones are retained and DNA morphology is altered in late canoe stage AAGAG RNAi testes.

(a) Histones are retained until late canoe stage with AAGAG RNAi in primary spermatocytes but removed by early canoe stage in scrambled RNAi. (b) Canoe stage nuclei exhibit abnormal morphology with AAGAG RNAi, and this morphology is partially restored with AAGAG(37) rescue.

Model for AAGAG RNA function during spermatogenesis.

AAGAG RNA (magenta) present only in primary spermatocytes (light blue = chromosome territories) acts directly or indirectly to promote important processes later in sperm maturation, including the histone-protamine transition and individualization. AAGAG RNA could ensure normal completion of later events by mediating: (a) proper localization of factors (RNA and/or protein) through sequestration (green) or exclusion (orange), (b) formation of molecular complexes or modifications (e.g. PTMs) (green blobs plus blue ovals), (c) regulation of global DNA/chromatin organization (e.g. condensation, Y loops, Higher Order Structures (HOS)) which for example could impact expression of critical spermatogenesis genes, or (d) local DNA/chromatin organization of cognate AAGAG loci, as observed for heterochromatin recruitment by siRNAs. Although direct experiments are required to test these models, we favor d) because it can accommodate both fast turnover of satellite sequences during evolution and sequence-independent roles in ensuring fertility (see text).

Tables

Table 1
Male fertility in AAGAG RNAi with GAL4 drivers expressed at earlier testes stages than Bam.
GAL4 RNAi driverExpression location
(Demarco et al., 2014)
% fertile+ /- stdev.Minimum number of males per set
FascillinHub941615
PTCSoma- CySCs and cyst cells90518
Traffic JamSoma- Hub and CySCs97412
Dpp1Soma- CySCs and early cyst cells96617
NanosGermline- GSCs and early germline cysts83513
Table 2
Oligos for RNA probes.
Repeat or regionOligo with T3 antisense promoter
CAGC(n)CAGCCAGCCAGCCAGCCAGCCAGCTCTCCCTTTAGTGAGGGTTAATT
CCCA(n)CCCACCCACCCACCCACCCACCCACCCATCTCCCTTTAGTGAGGGTTAATT
CATTA(n)CATTACATTACATTACATTACATTATCTCCCTTTAGTGAGGGTTAATT
CGGAG(n)CGGAGCGGAGCGGAGCGGAGCGGAGTCTCCCTTTAGTGAGGGTTAATT
CGA(n)CGACGACGACGACGACGACGACGATCTCCCTTTAGTGAGGGTTAATT
CAACT(n)CAACTCAACTCAACTCAACTCAACTTCTCCCTTTAGTGAGGGTTAATT
CGAAG(n)CGAAGCGAAGCGAAGCGAAGCGAAGTCTCCCTTTAGTGAGGGTTAATT
CCCCAG(n)CCCCAGCCCCAGCCCCAGCCCCAGTCTCCCTTTAGTGAGGGTTAATT
CCGAG(n)CCGAGCCGAGCCGAGCCGAGCCGAGTCTCCCTTTAGTGAGGGTTAATT
CGGAA(n)CGGAACGGAACGGAACGGAACGGAATCTCCCTTTAGTGAGGGTTAATT
CACCC(n)CACCCCACCCCACCCCACCCCACCCTCTCCCTTTAGTGAGGGTTAATT
CTAGT(n)CTAGTCTAGTCTAGTCTAGTCTAGTTCTCCCTTTAGTGAGGGTTAATT
CATCG(n)CATCGCATCGCATCGCATCGCATCGTCTCCCTTTAGTGAGGGTTAATT
CAT(n)CATCATCATCATCATCATCATCATTCTCCCTTTAGTGAGGGTTAATT
CAAAC(n)CAAACCAAACCAAACCAAACCAAACTCTCCCTTTAGTGAGGGTTAATT
CGAAA(n)CGAAACGAAACGAAACGAAACGAAATCTCCCTTTAGTGAGGGTTAATT
CATAT(n)CATATCATATCATATCATATCATATTCTCCCTTTAGTGAGGGTTAATT
GAAA(n)GAAAGAAAGAAAGAAAGAAAGAAATCTCCCTTTAGTGAGGGTTAATT
CAGAA(n)CAGAACAGAACAGAACAGAACAGAATCTCCCTTTAGTGAGGGTTAATT
AAGGAG(n)AAGGAGAAGGAGAAGGAGAAGGAGAAGGAGTCTCCCTTTAGTGAGGGTTAATT
AAGAGG(n)AAGAGGAAGAGGAAGAGGAAGAGGAAGAGGTCTCCCTTTAGTGAGGGTTAATT
AATAC(n)AATACAATACAATACAATACAATACAATACTCTCCCTTTAGTGAGGGTTAATT
AATAG(n)AATAGAATAGAATAGAATAGAATAGAATAGTCTCCCTTTAGTGAGGGTTAATT
AATAGAC(n)AATAGACAATAGACAATAGACAATAGACTCTCCCTTTAGTGAGGGTTAATT
AATAACATAG(n)AATAACATAGAATAACATAGAATAACATAGTCTCCCTTTAGTGAGGGTTAATT
AACAC(n)AACACAACACAACACAACACAACACAACACTCTCCCTTTAGTGAGGGTTAATT
dodeca(n)ACCGAGTACGGGACCGAGTACGGGTCTCCCTTTAGTGAGGGTTAATT
GTGTT(n)GTGTTGTGTTGTGTTGTGTTGTGTTGTGTTTCTCCCTTTAGTGAGGGTTAATT
GTAAT(n)GTAATGTAATGTAATGTAATGTAATGTAATTCTCCCTTTAGTGAGGGTTAATT
GTATT(n)GTATTGTATTGTATTGTATTGTATTGTATTTCTCCCTTTAGTGAGGGTTAATT
TTAA (n)TTAATTAATTAATTAATTAATTAATTAATTAATCTCCCTTTAGTGAGGGTTAATT
CAAT (n)CAATCAATCAATCAATCAATCAATCAATCAATTCTCCCTTTAGTGAGGGTTAATT
AAGAG(n)GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAATCTCCCTTTAGTGAGGGTTAATT
CTCTT(n)CTCTTCTCTTCTCTTCTCTTCTCTTCTCTTTCTCCCTTTAGTGAGGGTTAATT
359 ForwardAATTAACCCTCACTAAAGGGAGAAATGGAAATTAAATTTTTTGG
359 ReverseTTAATACGACTCACTATAGGGAGAGTTTTGAGCAGCTAATTACC
chr2R:1,825,641–1825699 senseGGCAGTTTATGTGCGTACAACAACAACAGGACTGCAAACAAAACACGAAACAGATATTTTTCTCCCTTTAGTGAGGGTTAATT
chr2R:1,825,641–1825699 anti-senseAAAATATCTGTTTCGTGTTTTGTTTGCAGTCCTGTTGTTGTTGTACGCACATAAACTGCCTCTCCCTTTAGTGAGGGTTAATT
chr2R:1,826,691–1,826,740 senseTAGACACATCTACGAAGACACAATTCTACAAGAACTAAACAACAAAAAGTTCTCCCTTTAGTGAGGGTTAATT
chr2R:1,826,691–1,826,740 anti-senseACTTTTTGTTGTTTAGTTCTTGTAGAATTGTGTCTTCGTAGATGTGTCTATCTCCCTTTAGTGAGGGTTAATT
chrX:11,830,844–11,830,910 senseCCAAGCTTCAGGAGAAAGAGAAAGAAGAAAGCTTTAAACTTAAGGAAAGAGAAGAGAGCCTTAGGATTCTCCCTTTAGTGAGGGTTAATT
chrX:11,830,844–11,830,910 antisenseCTAAGGCTCTCTTCTCTTTCCTTAAGTTTAAAGCTTTCTTCTTTCTCTTTCTCCTGAAGCTTGGCTTTCTCCCTTTAGTGAGGGTTAATT
chrX:12,660,096–12,660,145 senseTCGCACACACACACGCAACACTTAGGCACACATAGGAGATAGAGTGAGATCTCCCTTTAGTGAGGGTTAATT
chrX:12,660,096–12,660,145 anti-senseTCTCACTCTATCTCCTATGTGTGCCTAAGTGTTGCGTGTGTGTGTGCGATCTCCCTTTAGTGAGGGTTAA TT
chrX:22,453,019–22,453,076 senseCGACAGACAGTAAAATTAAACAAACTGCGGACGCGTGTGACAGAACTAATCCAACTTTCTCCCTTTAGTGAGGGTTAATT
chrX:22,453,019–22,453,076 anti-senseAAGTTGGATTAGTTCTGTCACACGCGTCCGCAGTTTGTTTAATTTTACTGTCTGTCGTCTCCCTTTAGTGAGGGTTAATT
chr3R:3,169,758–3,169,820 antisenseTCGGAAGAGACTAAACTTGTGCATTCGATATAGCTCTTTGTCGGCCCTAGCTGCTGTAAACAATCTCCCTTTAGTGAGGGTTAATT
chr3R:3,169,758–3,169,820 senseTTGTTTACAGCAGCTAGGGCCGACAAAGAGCTATATCGAATGCACAAGTTTAGTCTCTTCCGATCTCCCTTTAGTGAGGGTTAATT
chr3R:3,170,372–3,170,441 antisenseTTAAACTATATTAAACATTGTATATAAGTATAATAGCGAATACTATTTACGTATATGTTCT
TTCATAAATTCTCCCTTTAGTGAGGGTTAATT
chr3R:3,170,372–3,170,441 senseATTTATGAAAGAACATATACGTAAATAGTATTCGCTATTATACTTATATACAATGTTTAATATAGTTTAATCTCCCTTTAGTGAGGGTTAATT
Table 3
Antibodies used for Immuno-Fluorescence.
AntibodySupplier; Cat. numberWorking concentration
Rabbit-anti H3K9me3Abcam; 88981/250
Mouse-anti H3K9me2Active Motif; 397531/250
Rabbit-anti-H2AVLake placid AM318; 97511/100
Goat anti-GFPRockland 121600-101-2151/500
Rabbit anti-H4acetylMillipore 06–5981/200
Rat anti-Mst77FElaine Dunleavy, PhD; NUI Galway, Ireland1/200
Guinea pig anti-Mst35Ba/Bb (Protamine A/B)Elaine Dunleavy, PhD; NUI Galway, Ireland1/200
Mouse anti pan-histoneMillipore MAB 34221/200
Table 4
Uniquely mapped RNA identified via phrap adjacent AAGAG(>10) containing blocks
Chre0-2hre2-4hre4-8hre8-12hre12-14hre14-16hre16-20hre20-24hr
2RNANANANANANAchr2R.1825640.1825699NA
XNANANANANANANAchrX.12660077.12660134
XNANANANANANAchrX.11830795.11830858NA
XchrX.22453019.22453120NAchrX.22453019.22453182NAchrX.22453019.22453163chrX.22453019.22453177chrX.22453019.22453093chrX.
22453019.22453196
Table 5
shRNA and overexpression oligos.
DescriptionSequence 5’−3’
shRNA to AAGAG(n)ctagcagtGAAGAGAAGAGAAGAGAAGAGtagttatattcaagcataCTCTTCTCTTCTCTTCTCTTCgcg
shRNA to AAGAG(n) complementaattcgcGAAGAGAAGAGAAGAGAAGAGtatgcttgaatataactaCTCTTCTCTTCTCTTCTCTTCactg
shRNA to scrambledctagcagtGAGAGAAAAAGGGAAAGAAGGtagttatattcaagcataCCTTCTTTCCCTTTTTCTCTCgcg
shRNA to scrambled complementaattcgcGAGAGAAAAAGGGAAAGAAGGtatgcttgaatataactaCCTTCTTTCCCTTTTTCTCTCactg
AAGAG(37) for over-expressionATCAAGACTGCTAGCAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAG
AAGAG(37) over-expression complementCCATTGACTGAATTCCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTT
Table 6
Fly lines.
Stock name or genotypeObtained from: stock numberDescription
y[1] v[1]; P{y[+t7.7]=CaryP}attP40Bloomington: 36304Background strain for insertion of pValium20 vector containing shRNA
y[1] v[1]; P{y[+t7.7]=CaryP}attP2Bloomington: 36303Background strain for
insertion of pValium vector containing AAGAG expression construct.
y[1] sc[*] v[1]; P{y[+t7.7] v[+t1.8]=VALIUM20-mCherry}attP2Bloomington: 35785Control strain for RNAi. Expresses dsRNA to mCherry
y[1] v[1]:UAS-AAGAG shRNA::Rainbow Transgenic Flies, IncExpresses shRNA under UAS promoter targeting AAGAG(n)
y[1] v[1]:UAS-scramble shRNA::Rainbow Transgenic Flies, IncExpresses shRNA under UAS promoter targeting random AG containing sequences
y[1] w[67c23]; P{w[+mC]=dpp-GAL4.PS}6A/TM3, Ser[1]Bloomington: 7007Dpp-GAL4
y[1] v[1]::UAS-AAGAG(37)Rainbow Transgenic Flies, IncExpresses a 187 base repeat of AAGAG RNA under a UAS promoter
C(1;Y)1, y[1] w[A738]: y[+]/0 and C(1)RM, y[1] v[1]/0Bloomington:2494XO (Y chromosome deficient males)
y[*] w[*]; P{w[+mW.hs]=GawB}NP1233/CyO,
P{w[-]=UAS lacZ.UW14}UW14
Kyoto: 103948Fascillin-GAL4
y[*] w[*]; P{w[+mW.hs]=GawB}NP1624/CyO,
P{w[-]=UAS lacZ.UW14}UW14
Kyoto:104055Traffic Jam-GAL4
w[*]; P{w[+mW.hs]=GawB}ptc[559.1]Kyoto: 103948PTC-GAL4
:: nanos-Gal4, dcr2-UAS/TM3 sbUnknownNanos-GAL4
w;;bamGAL4, UAS-dicer2UnknownBam-GAL4
y[1] w[*]::P{w[+mC]=Act5 C-GAL4}17bFO1/TM6B, Tb[1]Bloomington: stock 3954Expresses GAL4 ubiquitously
under control of Act5C promoter
Table 7
Quantification of post-canoe stage sperm DNA morphological defects in 4–7 day old testes.
NNormal bundleLagging bundleKinkedKnottedNeedle
eyed
Decondensed
Scrambled RNAi1224000
2976000
32150000
4510000
52910000
6620000
AAGAG RNAi1082002
2180220
3015210
4001000
5012110
6015100
7003300
8000010
9124110
10352420
112214010
12149110
AAGAG RNA (Rescue)1012000
2522000
3711000
4836300
5009000
6446000
7843000
8967000
91115000
10824000
11302000
12306100
13228000
14575010
15503000
16555100
17343000
18516000
193115100
20321010
Table 8
Quantification of canoe stage DNA morphological defects, in 4–7 day old testes
NNormal canoeAbnormal canoe
Scrambled RNAi120
271
361
435
591
651
AAGAG RNAi110
201
301
411
500
601
700
824
912
1002
1112
1236
1327
1415
AAGAG RNA (Rescue)174
232
303
404
503
600
714
834
968
1033
1110
1222
1389
1416
1502
1679
1701
1832
1924
2011
Table 9
qPCR oligos.
mRNA targetSequence 5’−3’
Actin-5c ForwardCAGCCAGCAGTCGTCTAATC
Actin-5c ReverseACAACCAGAGCAGCAACTTC
Rpl32 ForwardCGATGTTGG GCATCAGATAC
Rpl32 ReverseCCCAAGATCGTGAAGAAGC
pip5K59B ForwardCTCCTGCTCTGCTATCGTATTC
pip5K59B ReverseAGAGGAGCCATCAACATCAC
Peb ForwardTGGTTGGACCGCTTAACATAG
Peb ReverseGCGACACCAAGAGCCATAA
CG33080 ForwardATTACGATCGCGGGCTTATC
CG33080 ReverseCGGTTCTAGGAGCACTGATATAAA

Data availability

All generated data are included within the article.

Additional files

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)