Figures and data in ON selectivity in the Drosophila visual system is a multisynaptic process involving both glutamatergic and GABAergic inhibition

Figures
Tables
Additional files

9 figures, 1 table and 2 additional files

Figures

Figure 1

Download asset Open asset

ON pathway medulla neurons that receive graded, glutamatergic input.

(A) Schematic of the fly visual system, highlighting major neurons of the ON (colored) and OFF (gray) pathways. Visual information travels from the photoreceptors (R1–R6) through the lamina, medulla and lobula complex (lobula + lobula plate). In the ON pathway, the L1 input and its two major postsynaptic targets Mi1 and Tm3 are highlighted, as well as their common target, the T4 ON-direction-selective cell. (B) Top: Schematic representation of the signal transformations that occur at the lamina-to-medulla neuron synapse. In the ON pathway, a sign inversion is required downstream of linear lamina neuron inputs. Bottom: In vivo calcium signals in response to 5 s full-field flashes. L1 calcium signals (dark blue, n = 6 [99]) are of the opposite sign to the calcium signal in its major postsynaptic partners Mi1 (light blue, n = 5 [89]) and Tm3 (green, n = 7 [84]). (**C,D**) In vivo iGluSnFR signals in response to 5 s long full-field flashes at the dendrites of Mi1 (C, n = 9[278] in layer M1, n = 9[250] in M5) and Tm3 (D, n = 6[137] in layer M1, n = 6[141] in M5), or at the output region of these neuron types in medulla layers M9/10 (n = 9[326] for Mi1 in C, n = 6[161] for Tm3 in D). All traces show mean ± SEM. Sample sizes are given as number of flies [number of cells].

https://doi.org/10.7554/eLife.49373.003

Figure 2 with 3 supplements

Download asset Open asset

ON responses are abolished by PTX concentrations affecting GABA_ARs and GluCls.

(A) In vivo calcium signals recorded in layer M9/10 of Mi1 neurons, before (blue) and after (light red) PTX application. (B) Bar plot showing the quantification of the effect of PTX at various concentrations. A two-tailed Student t test was performed for each concentration against the sham control. Sample sizes were as follows: sham, n = 5 (89); 1 µM PTX, n = 5 (68); 2.5 µM PTX, n = 8 (102); 5 µM PTX, n = 5 (64); 25 µM PTX, n = 4 (30); 50 µM PTX, n = 5 (87); 100 µM PTX, n = 5 (89). (C) In vivo calcium signals recorded in layer M9/10 of Tm3 neurons, before (green) and after (light red) PTX application. (D) Bar plots showing the quantification of the effect of PTX at various concentrations. A two-tailed Student t test was performed for each concentration against the sham control. Sample sizes were as follows: sham, n = 7 (84); 1 µM PTX, n = 8 (108); 2.5 µM PTX, n = 9 (127); 5 µM PTX, n = 7 (74); 25 µM PTX, n = 5 (64); 50 µM PTX, n = 5 (51); 100 µM PTX, n = 6 (92). (E) In vivo calcium signals in response to full-field flashes recorded in the axon terminals of T4/T5 neurons (n = 9 [229]), before (gray) and after (red) PTX application. (F) Bar plots showing the quantification of the results in (E). (G) In vivo calcium signals recorded in layer M1 (n = 6 [99]) and M5 (n = 6 [103]) of L1 neurons, before (dark blue) and after (red) 100 µM PTX application. (H) Bar plot showing the quantification of the data shown in (G). All traces show mean ± SEM. Sample sizes are given as number of flies (number of cells). *p<0.05, **p<0.01, ***p<0.001, tested with a one-way ANOVA and a post-hoc unpaired t-test with Bonferroni-Holm correction for multiple comparisons in (**B,D,F**), and a paired Student t test in (H).

https://doi.org/10.7554/eLife.49373.004

Figure 2—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 2, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.011
Download elife-49373-fig2-data1-v2.docx

Figure 2—figure supplement 1

Download asset Open asset

Blocking metabotropic glutamate receptors does not abolish ON responses.

(**A,C**) GCaMP6f signals in response to 5 s full-field flashes in layer M9/10 before (blue for Mi1, green for Tm3) and after (orange) application of 100 µM MPEP. The same cells were imaged before and after drug application. Sample sizes were n = 5 (58)±MPEP for Mi1, and n = 5 (40)±MPEP for Tm3. (**B,D**) Bar plots showing the quantification of the ON step. *p<0.05, **p<0.01, ***p<0.001, tested with paired Student t test. All traces and bar plots show mean ± SEM. Sample sizes are given as n = number of flies (number of cells).

https://doi.org/10.7554/eLife.49373.005

Figure 2—figure supplement 1—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 2—figure supplement 1, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.006
Download elife-49373-fig2-figsupp1-data1-v2.docx

Figure 2—figure supplement 2

Download asset Open asset

ON responses are abolished by PTX concentrations affecting GABA_ARs and GluCls.

(**A,B**) In vivo GCaMP6f signals recorded in layers M1, M5 and M9/10 of Mi1 (A) and Tm3 (B) neurons, before (blue, green) and after (gray, red) application of 0 (sham), 1, 5 or 100 µM PTX. (**C,D**) Bar plot showing the quantification of the ON step in (**A,B**). Sample sizes: sham, n = 5 (89); 1 µM, n = 5 (68); 5 µM, n = 5 (64); 100 µM, n = 5 (89). All traces show mean ± SEM. All sample sizes are given as number of flies (number of cells). *: p<0.05, **: p<0.01, ***: p<0.001, tested with a one-way ANOVA and a post-hoc unpaired t-test with Bonferroni-Holm correction for multiple comparisons.

https://doi.org/10.7554/eLife.49373.007

Figure 2—figure supplement 2—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 2—figure supplement 2, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.008
Download elife-49373-fig2-figsupp2-data1-v2.docx

Figure 2—figure supplement 3

Download asset Open asset

The glutamatergic input onto Mi1 and Tm3 dendrites is still present upon PTX application.

(**A,B**) In vivo iGluSnFR signals recorded in layers M1 and M5 of Mi1 (A) or Tm3 (B) neurons, before (blue) and after application of either 5 or 100 µM PTX (light red/red). Bar plots showing the quantification of the ON and OFF response. **p<0.01, ***p<0.001, tested with paired Student t test. Sample sizes were N = 5 (64/67) for Mi1 in 5 µM PTX, N = 6 (72/72) for Mi1 in 100 µM PTX, N = 5 (62/60) for Tm3 in 5 µM PTX, and N = 5 (60/63) for Tm3 in 100 µM PTX, given as N = number of flies (number of cells in M1/M5). All traces show mean ± SEM.

https://doi.org/10.7554/eLife.49373.009

Figure 2—figure supplement 3—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 2—figure supplement 3, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.010
Download elife-49373-fig2-figsupp3-data1-v2.docx

Figure 3 with 1 supplement

Download asset Open asset

*GluClα* and *Rdl* are broadly expressed in the visual system.

(A) Confocal cross-section of the visual system of a fly carrying a GFP exon trap within the *GluClα* locus (GluClα^{MI02890.GFSTF.2}). The neuropil is marked with nc82 (magenta) and endogenous GFP is in green/gray. Scale bar is 20 µm. (B) Expression levels shown as TPM (transcripts per kilobase million) values of inhibitory glutamate, GABA and histamine receptors. RNAseq data are from Davis et al. (2018) (GEO accession number: GSE 116969). Expression in the four most prominent medulla interneurons of the ON and OFF pathways are depicted.

https://doi.org/10.7554/eLife.49373.012

Figure 3—figure supplement 1

Download asset Open asset

*GluClα* and *Rdl* are broadly expressed in the visual system.

(A) Expression levels shown as TPM (transcripts per kilobase million) values of candidate glutamate, GABA and histamine receptors. RNAseq data are from Konstantinides et al. (2018) (GEO accession number: GSE103772). Expression in all available medulla interneurons in the data set of the major ON and OFF pathways components is depicted.

https://doi.org/10.7554/eLife.49373.013

Figure 4 with 2 supplements

Download asset Open asset

Pharmacogenetics shows that ON responses are partially mediated by the GABA_AR Rdl.

(**A,B**) In vivo calcium signals in response to full-field flashes recorded in layer M1 of Mi1 neurons. Figure shows traces before (blue) and after (red) 2.5 µM PTX application in heterozygous *Rdl¹/+* controls (A, n = 7 (58)), or flies only expressing the PTX-insensitive *Rdl^MDRR* allele (*Rdl¹/Rdl^MDRR*) (B, n = 8 (77)). (C) Bar plots showing the quantification of the normalized ON step, ON plateau and ON integral of the data shown in (**A,B**). *p<0.05, **p<0.01, ***p<0.001, tested with an unbalanced two-way ANOVA, corrected for multiple comparisons. (**D,E**) In vivo calcium signals in response to full-field flashes recorded in the layer M1 of Tm3 neurons. Genotypes: ctrl = *Rdl¹/+* and 1 = *Rdl¹/Rdl^MDRR*. Figure shows traces before (green) and after (red) PTX application +/+ controls (D, 1 = 5[34]), or flies only expressing the PTX-insensitive *Rdl^MDRR* allele (*Rdl^MDRR/Rdl^MDRR*) (E, n = 5[46]). (F) Bar plots showing the quantification of the traces shown in (**D,E**). All traces show mean ± SEM. Sample sizes are given as number of flies (number of cells). *p<0.05, **p<0.01, ***p<0.001, tested with an unbalanced two-way ANOVA, corrected for multiple comparisons. (G) Schematic summarizing the results. Our results suggest that ON-selectivity does not arise solely through glutamate-gated chloride channels as initially thought (i). The GABA_AR Rdl is required for ON-responses in a pathway parallel to the monosynaptic L1-Mi1/Tm3 connection (ii).

https://doi.org/10.7554/eLife.49373.014

Figure 4—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 4, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.018
Download elife-49373-fig4-data1-v2.docx

Figure 4—figure supplement 1

Download asset Open asset

Pharmacogenetics shows that ON responses are partially mediated by the GABA_AR Rdl.

(A) Schematics showing the quantification of the step response, the plateau response and the integrated response. (**B,C**) In vivo calcium signals in response to full-field stimulation recorded in layers M5 and M9/10 of Mi1 neurons. Figure shows traces before (blue) and after (red) application of 2.5 µM PTX in heterozygous *Rdl¹/+* controls (A, n = 7[55]/[78]), or flies only expressing the PTX-insensitive *Rdl^MDRR* allele (*Rdl¹/Rdl^MDRR*) (B, n = 8[76]/[90]). (D) Bar plots showing the quantification of the data from (**A, B**). (**E,F**) In vivo calcium signals in response to full-field flashes recorded in the layers M5 and M9/10 of Tm3 neurons. Figure shows traces before (green) and after (red) PTX application in wild type (+/+) (D, n = 5[36]/[47]), or flies only expressing the PTX-insensitive *Rdl^MDRR* allele (*Rdl^MDRR/Rdl^MDRR*) (E, n = 5[57]/[57]). (G) Bar plots showing the quantification of data from (**D,E**). All traces show mean ± SEM. Sample sizes are given as number of flies [number of cells in M5/M9/10], *p<0.05, ***p<0.001, tested with an unbalanced two-way ANOVA, corrected for multiple comparisons.

https://doi.org/10.7554/eLife.49373.015

Figure 4—figure supplement 1—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 4—figure supplement 1, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.016
Download elife-49373-fig4-figsupp1-data1-v2.docx

Figure 4—figure supplement 2

Download asset Open asset

L1 neurons are not GABAergic.

(A) Expression levels shown as TPM values of genes related to the synthesis, transport and release of the neurotransmitters glutamate and GABA. RNAseq data are from Davis et al. (2018) (GEO accession number: GSE 116969). Expression in the lamina neurons L1, L2, L3, L4, L5, C2 and C3. (**B,C**) Confocal images of the fly visual system of a fly expressing C2/C3 >> GFP (B) or L1 >>GFP (C) and marked with anti-GFP (green/gray) and anti-GABA (magenta/gray). C2/C3 are known GABAergic cell types and serve as positive controls. (B) The GABA staining shows GABA-positive signal in medulla cell bodies and C2/C3 cell bodies (filled arrowheads), as well as in C2/C3 axon terminals in the lamina (open arrowheads), but not in the lamina cortex (asterisk). (C) L1 cell bodies and medulla layers M1 and M5 housing the L1 axon terminals do not show specific anti-GABA signal whereas some medulla neuron cell bodies are GABA-positive (filled arrowheads). White boxes mark approximate location of the individual images to the left. Note that the medulla image in (C) is from a different brain. Scale bars are 20 µm.

https://doi.org/10.7554/eLife.49373.017

Figure 5

Download asset Open asset

A *GluClα* allele insensitive to picrotoxin.

(A) 3D protein structure of *Drosophila melanogaster* GluClα binding PTX, obtained by homology modeling with its *C. elegans* homolog GluClα using the Protein Homology/analogY Recognition Engine Phyre 2. (Kelley et al., 2015). The PTX structure was obtained from DrugBank, identification number DB00466. Structures were edited using Chimera 1.13, (Pettersen et al., 2004). (B) Alignment of the M2 helix of different ligand-gated chloride channel. The histamine-gated chloride channel *ort* (Zheng et al., 2002), the glutamate-gated chloride channels *glc-1, glc-2, glc-3, GluClα,* (Cully et al., 1996; Cully et al., 1994; Horoszok et al., 2001), and the GABA_AR *Rdl.* PTX sensitivities are indicated as shades of red. *D.mel* = *Drosophila melanogaster*, *C.ele* = *Caenorhabditis elegans*, *M.dom = Musca domestica*. (**C,D**) Two-electrode voltage-clamp recordings at a holding potential of −70 mV from *X. laevis* oocytes expressing wild type (C) or S278T (D) *GluClα*. Currents were evoked by glutamate wash in (lower bars) in the absence or presence of 10 µM or 100 µM picrotoxin (upper bars). (E) Mean peak-current amplitudes of the glutamate-evoked response in the presence (red) and absence (gray) of picrotoxin, normalized to the peak-current amplitude evoked by glutamate after picrotoxin wash out. Bars show mean ± SEM. *p<0.05, **p<0.01, tested with a one-way ANOVA and a post-hoc unpaired t-test with Bonferroni-Holm correction for multiple comparisons. Sample sizes: WT n = 6 and S278T n = 4 for 10 µM, and WT n = 6 and S278T n = 6 for 100 µM PTX.

https://doi.org/10.7554/eLife.49373.019

Figure 5—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 5, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.020
Download elife-49373-fig5-data1-v2.docx

Figure 6 with 1 supplement

Download asset Open asset

Pharmacogenetics shows that ON responses are mediated by *GluClα*.

(**A,B**) In vivo calcium signals in response to full-field flashes recorded in layer M1 of Mi1 neurons. Figure shows traces before (blue) and after (red) 2.5 µM PTX application in heterozygous *GluClα^Df/+* deficient controls (A, n = 5 [63]), as well as flies only expressing the PTX-insensitive *GluClα^S278T* allele (*GluClα^S278T/GluClα^Df*).(B, n = 5 [47]). (C) Bar plots showing the quantification of the data from (**A,B**). *p<0.05, **p<0.01, ***p<0.001, tested with an unbalanced two-way ANOVA, corrected for multiple comparisons. (**D,E**) In vivo calcium signals in response to full-field flashes recorded in the layer M1 of Tm3 neurons. Figure shows traces before (green) and after (red) PTX application in heterozygous *GluClα ^Df/+* deficient controls (D, n = 5 [30]), as well as flies only expressing the PTX-insensitive *GluClα^S278T* allele (*GluClα^S278T/GluClα^Df*) (E, n = 5 [40]). (F) Bar plots showing the quantification of the data shown in (**D,E**). *p<0.05, **p<0.01, ***p<0.001, tested with an unbalanced two-way ANOVA, corrected for multiple comparisons. (**G,H**) In vivo calcium signals in response to full-field flashes recorded in T4/T5 axon terminals. Figure shows traces before (gray) and after (red) 100 µM PTX application in heterozygous *GluClα ^Df/+* deficient controls (G, n = 10[440]), as well as flies only expressing the PTX-insensitive *GluClα^S278T* allele (*GluClα^S278T/GluClα^Df*) (H, n = 5[192]). The pink dotted line shows responses after the application of 5 µM PTX. (I) Bar plots showing the quantification of the data shown in (**G,H**). *p<0.05, **p<0.01, ***p<0.001. Statistics was done using an unbalanced two-way ANOVA, corrected for multiple comparisons. All traces show mean ± SEM. Sample sizes are given as number of flies (number of cells). (J) Schematic summarizing the results. Our results provide support for a combinatorial role of glutamatergic and GABAergic inhibition in mediating ON responses. Since GluClα is likely to be the receptor on all neurons postsynaptic to L1, Rdl could function downstream of GluClα.

https://doi.org/10.7554/eLife.49373.021

Figure 6—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 6, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.024
Download elife-49373-fig6-data1-v2.docx

Figure 6—figure supplement 1

Download asset Open asset

Figure 6—figure supplement 1—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 6—figure supplement 1, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.023
Download elife-49373-fig6-figsupp1-data1-v2.docx

Figure 7

Download asset Open asset

ON selectivity is a multisynaptic computation mediated by *GluClα.*

(A) Schematic illustrating inversion of the *GluClα* FlpStop exon in all neurons by panneuronal expression of Flp recombinase using elav-Gal4. qRT-PCR results show *GluClα* mRNA levels relative to the GAPDH housekeeping gene, normalized to controls. (B) The FlpStop exon in the non-disrupting (ND) orientation was inverted specifically in Mi1 neurons by cell-type-specific expression of Flp recombinase. This is visualized via expression of tdTom signal, and is specific to and broad in Mi1. (C) In vivo calcium signals recorded in a cell-type-specific Mi1 *GluClα* loss-of-function. Calcium signals were recorded in layer M1 of *GluClα* mutant Mi1 neurons (n = 5 (136)) (red), and heterozygous controls (n = 5[166], n = 5[139]) (blue, gray). The bar plot shows quantification of the ON step. (D) qRT PCR results quantifying pan neuronal knockdown of *UAS-GluClα^RNAi* using elav-Gal4, normalized to control. (**E,F**) In vivo calcium signals upon cell-type-specific *GluClα* knockdown. Calcium signals in response to full-field flashes were recorded in layer M1 of (E) Mi1 control (n = 8[229]) or *Mi1 >>GluClα^RNAi* (n = 6[215]) or of (F) Tm3 control (n = 8[150]) and *Tm3 >>GluClα^RNAi* (n = 6[146]). Bar plot show quantification. (G) qRT PCR results quantifying *GluClα* mRNA levels in heterozygous *GluClα^Flp.Stop.D/+* and *GluClα^Df/+*, as well as the homozygous mutant *GluClα^{Flp.Stop.D/Df}.* (**H,I**) In vivo calcium signals recorded in a full *GluClα^FlpStop.D* mutant background (red). Heterozygous *GluClα^FlpStop.D* controls are in blue (Mi1, n = 5 (117)) or green (Tm3, n = 8 (275)), heterozygous Df controls are in gray (Mi1, n = 5[142]; Tm3, n = 5[198]) and the experimental condition is in red (Mi1, n = 9 [134]; Tm3, n = 5[96]). Bar plots show quantification of the ON step response. All traces show mean ± SEM. All sample sizes are shown as number of flies (number of cells). Statistics was done using an unpaired Student t test for comparison in (**A,D,E,F**), and a one-way ANOVA and a post-hoc unpaired t-test with Bonferroni-Holm correction for multiple comparisons in (**C,G,H,I**). *p<0.05, **p<0.01, ***p<0.001.

https://doi.org/10.7554/eLife.49373.025

Figure 7—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 7, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.026
Download elife-49373-fig7-data1-v2.docx

Figure 8

Download asset Open asset

*GluClα* mediates ON but not OFF direction-selective responses.

(**A–D**) In vivo calcium signals recorded in direction-selective T4/T5 neurons. (**A,B**) Schematic of T4 and T5 axon terminal innervating the four anatomical layers in the lobula plate (left). Visually evoked calcium signals recorded from all four layers in response to OFF and ON moving edges in eight different directions in heterozygous controls (A, n = 8 [62/60/59/50]) and a full *GluClα* mutant background, *GluClα^FlpStop.D*/Df (B, n = 9 [69/73/70/64]). (**C,D**) Polar plots showing the calcium signals in response to moving ON (C) or OFF (D) edges. Genotypes are as indicated. Bar plots show the quantification of the preferred direction (PD) response and the direction selectivity index (DSI) for each layer. Sample size shows number of flies (number of cells in layers A/B/C/D) (**E,F**) Calcium signals in response to full-field flashes recorded in T4/T5 axon terminals in the lobula plate (E) or T4 dendrites in the medulla (F). (**G,H**) Bar plots show the quantification of the ON or OFF response in T4/T5 axon terminals (G) or T4 dendrites (H). Heterozygous *GluClα^FlpStop.D* (n = 8 (225/40)) and *GluClα^Df* (n = 8 [141/36]) controls are in gray and the *GluClα^FlpStop.D*/Df mutant (n = 5 [198/22]) is in red in (**E–H**). All traces show mean ± SEM. Sample size are given as number of number of flies (number of ROIs). Statistical comparisons were done using an unpaired Student t test in (**C,D**), and a one-way ANOVA and a post-hoc unpaired t-test with Bonferroni-Holm correction for multiple comparisons in (**G,H**), ***p<0.001.

https://doi.org/10.7554/eLife.49373.027

Figure 8—source data 1 Table 1 contains all mean ± s.e.m. Data related to quantifications shown in main Figure 8, sorted by genotype and experimental condition.: https://doi.org/10.7554/eLife.49373.028
Download elife-49373-fig8-data1-v2.docx

Author response image 1

Download asset Open asset

Extraction of PD and ND responses from T4/T5 calcium imaging data.

(A) Expression of GCaMP6f in T4/T5 neurons. ROIs are manually drawn and assigned to different lobula plate (LP) or medulla (Me) layers. (B) Single ROI responses to ON (bright background) and OFF (grey background) moving into different directions of motion. (C) Upon averaging across trials and ROIs, the preferred direction (PD) is determined as the direction of motion that was eliciting the strongest response. The null direction (ND) is set as the direction of motion that is 180° relative to the PD.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f	Bloomington Drosophila Stock Center	w+; R19F01-p65ADZp^attP40 / +; R71D01-ZpGdbd^attP2/UAS-GCaMP6f	Figures 1, 2 and 7 Figure 2—figure supplement 1
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f	Bloomington Drosophila Stock Center	w+; R38C11-p65ADZp^attP40 / +; R59C10-ZpGdbd^attP2/UAS- GCaMP6f	Figures 1, 2 and 7 Figure 2—figure supplement 1
Strain, strain background (Drosophila melanogaster)	L1 >> GCaMP6f	Bloomington Drosophila Stock Center	w⁺; L1[c202]-Gal4 / +; UAS-GCaMP6f / +	Figure 1, 2
Strain, strain background (Drosophila melanogaster)	Mi1 >> iGluSnFR	Bloomington Drosophila Stock Center	w+; R19F01-p65ADZp^attP40 / +; R71D01-ZpGdbd^attP2/UAS iGluSnFR A184A ^attP2	Figure 1, Figure 2—figure supplement 3
Strain, strain background (Drosophila melanogaster)	Tm3 >> iGluSnFR	Bloomington Drosophila Stock Center	w+; R38C11-p65ADZp[attP40] / +; R59C10-ZpGdbd^attP2/UAS iGluSnFR A184A^attP2	Figure 1, Figure 2—figure supplement 3
Strain, strain background (Drosophila melanogaster)	T4/T5 >> GCaMP6f	Bloomington Drosophila Stock Center	w⁺; R64G09-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; + / +	Figure 2, Figure 8
Strain, strain background (Drosophila melanogaster)	GluClα ^{MI02890-GFSTF.2}	Bloomington Drosophila Stock Center	y¹ w; Mi{PT-GFSTF.2} GluClα ^{MI02890-GFSTF.2}/TM6C, Sb¹ Tb¹*	Figure 3
Antibody	Anti-GFP (chicken polyclonal)	Abcam	Cat# ab13970, RRID:AB_300798	IF (1:2000) Figure 3, Figure 4—figure supplement 2
Antibody	Anti-Bruchpilot (mouse monoclonal nc82)	DSHB	Cat# nc82, RRID:AB_2314866	IF (1:25) Figure 3
Antibody	Alexa Fluor 488-conjugates AffinityPure Goat Anti-Chicken IgG	Jackson ImmunoResearch Labs	Cat# 103-545-155, RRID:AB_2337390	IF (1:200) Figure 3
Antibody	Alexa Fluor 594-conjugates AffinityPure Goat Anti-Mouse IgG	Jackson ImmunoResearch Labs	Cat# 115-585-206, RRID:AB_2338886	IF (1:200) Figure 3
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, Rdl¹/+ control	Bloomington Drosophila Stock Center	w ⁺; R19F01-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; Rdl¹ / +	Figure 4, Figure 4—figure supplement 1
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f, +/+ control	Bloomington Drosophila Stock Center	w ⁺; R13E12-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; + / +	Figure 4, Figure 4—figure supplement 1
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, Rdl¹/RdlMD^{MD-RR }*	Bloomington Drosophila Stock Center	w ⁺; R19F01-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; Rdl¹/RdlMD^MD-RR	Figure 4, Figure 4—figure supplement 1
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f,Rdl^MD-RR/RdlMD^{MD-RR }*	Bloomington Drosophila Stock Center	w ⁺; R13E12-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; Rdl^MD-RR/RdlMD^MD-RR	Figure 4, Figure 4—figure supplement 1
Strain, strain background (Drosophila melanogaster)	C2,C3 >> GFP	Bloomington Drosophila Stock Center	w+/UAS-CD8::GFP; R20C11 -p65ADZp^attP40/UAS-2xEGFP; R48D11-ZpGdbd^attP2/+	Figure 4—figure supplement 2
Strain, strain background (Drosophila melanogaster)	L1 >> GFP	Bloomington Drosophila Stock Center	w⁺/UAS-CD8::GFP; L1[c202]-Gal4/UAS-2xEGFP; + / +	Figure 4—figure supplement 2
Antibody	Anti-GABA (rabbit polyclonal)	Sigma-Aldrich	Cat# A2052, RRID:AB_477652	IF (1:200) Figure 4—figure supplement 2
Antibody	Alexa Fluor 594-conjugates AffiniPure Goat Anti-Rabbit IgG	Jackson ImmunoResearch Labs	Cat# 111-585-003, RRID:AB_2338059	IF (1:200) Figure 6
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, GluClα^Df/+ control	Bloomington Drosophila Stock Center	w ⁺; R19F01-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; Df(3R)ED6025/ +	Figure 6, Figure 6—figure supplement 1
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f, GluClα^Df/+ control	Bloomington Drosophila Stock Center	w ⁺; R13E12-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; Df(3R)ED6025/ +	Figure 6, Figure 6—figure supplement 1
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, GluClα^S278T/GluClα^Df	This paper	w ⁺; R19F01-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; Df(3R)ED6025/GluClα^S278T	Figure 6, Figure 6—figure supplement 1 More information in the Materials and methods section under ‘Molecular biology’
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f, GluClα^S278T/GluClα^Df	This paper	w ⁺; R13E12-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025/GluClα^S278T	Figure 6, Figure 6—figure supplement 1 More information in the Materials and methods section under ‘Molecular biology’
Strain, strain background (Drosophila melanogaster)	T4/T5 >> GCaMP6f, GluClα^Df/+ control	Bloomington Drosophila Stock Center	w⁺; R64G09-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025 / +	Figure 6, Figure 6—figure supplement 1
Strain, strain background (Drosophila melanogaster)	T4/T5 >> GCaMP6f, GluClα^S278T/GluClα^Df	This paper	w⁺; R64G09-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / + ; Df(3R)ED6025/GluClα^{S278T CRISPR}	Figure 6, Figure 6—figure supplement 1 More information in the Materials and methods section under ‘Molecular biology’
Strain, strain background (Drosophila melanogaster)	Mi1 >> Flp,GCaMP6f; GluClα^FlpStop.ND/GluClα^Df	This paper	w+; R19F01-p65ADZp^attP40/UAS-GCaMP6f, UAS-Flp; R71D01-ZpGdbd^attP2, GluClα^Df/GluClα^FlpStop.ND	Figure 7 More information in the Materials and methods section under ‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	Mi1 >> Flp,GCaMP6f; GluClα^FlpStop.ND / +(Heterozygous control)	This paper	w+; R19F01-p65ADZp^attP40/UAS-GCaMP6f, UAS-Flp; R71D01-ZpGdbd^attP2/GluClα^FlpStop.ND	Figure 7 More information in the Materials and methods section under‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f; GluClα^FlpStop.ND/GluClα^Df(No Flp control)	This paper	w+; R19F01-p65ADZp^attP40/UAS-GCaMP6f; R71D01-ZpGdbd^attP2, GluClα^Df / ; GluClα^FlpStop.ND	Figure 7 More information in the Materials and methods section under‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, GluClα^dsRNA	Bloomington Drosophila Stock Center	w+; R19F01-p65ADZp^attP40/P{y[+t7.7] v[+t1.8]=TRiP.HMC03585}^attP40; R71D01-ZpGdbd^attP2/UAS-GCaMP6f	Figure 7
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f, GluClα^dsRNA	Bloomington Drosophila Stock Center	w+; R38C11-p65ADZp^attP40/P{y[+t7.7] v[+t1.8]=TRiP.HMC03585}^attP40; R59C10-ZpGdbd^attP2/UAS-GCaMP6f	Figure 7
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, GluClα^FlpStop.D / +	This paper	w ⁺; R19F01-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; GluClα^FlpStop.D / +	Figure 7 More information in the Materials and methods section under‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, GluClα^Df / +	Bloomington Drosophila Stock Center	w ⁺; R19F01-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025/GluClα^WT	Figure 7
Strain, strain background (Drosophila melanogaster)	Mi1 >> GCaMP6f, GluClα^FlpStop.D/GluClα^{Df }	This paper	w ⁺; R19F01-LexA}^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025/GluClα^FlpStop.D	Figure 7 More information in the Materials and methods section under‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f, GluClα^FlpStop.D / +	This paper	w ⁺; R13E12-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; GluClα^FlpStop.D / +^T	Figure 7 More information in the Materials and methods section under‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f, GluClα^Df / +	Bloomington Drosophila Stock Center	w ⁺; R13E12-lexA}^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025/ +	Figure 7
Strain, strain background (Drosophila melanogaster)	Tm3 >> GCaMP6f, GluClα^FlpStop.D/GluClα^{Df }	This paper	w ⁺; R13E12-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025/GluClα^FlpStop.D	Figure 7 More information in the Materials and methods section under‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	T4/T5 >> GCaMP6f, GluClα^FlpStop.D / +	This paper	w⁺; R64G09-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; GluClα^FlpStop.D / +	Figure 8 More information in the Materials and methods section under ‘Generation of transgenic lines’
Strain, strain background (Drosophila melanogaster)	T4/T5 >> GCaMP6f, GluClα^Df / +	Bloomington Drosophila Stock Center	w⁺; R64G09-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025/ +	Figure 8
Strain, strain background (Drosophila melanogaster)	T4/T5 >> GCaMP6f, GluClα^FlpStop.D/GluClα^{Df }	This paper	w⁺; R64G09-LexA^attP40, lexAop2-IVS-GCaMP6f-p10^su(Hw)attP5 / +; ; Df(3R)ED6025/GluClα^FlpStop.D	Figure 8 More information in the Materials and methods section under ‘Generation of transgenic lines’
Chemical compound, drug	Picrotoxin	Sigma Aldrich	P1675 _SIGMA	Figures 2, 4, 5 and 6 Figure 2—figure supplements 2 and 3, Figure 4—figure supplement 1, Figure 6—figure supplement 1
Chemical compound, drug	MPEP	Abcam	Ab120008	Figure 2—figure supplement 1
Sequence-based reagent	GluCla_forward	This paper	ACCAAACTGCTGCAAGAC	qRT-PCR Figure 7 More information in the Materials and methods section under ‘Molecular biology’
Sequence-based reagent	GluCla_reverse	This paper	GATATGTGCTCCAGTAGACC	qRT-PCR Figure 7 More information in the Materials and methods section under ‘Molecular biology’
Sequence-based reagent	GAPDH2_forward	This paper	GATGAGGAGGTCGTTTCTAC	qRT-PCR Figure 7 More information in the Materials and methods section under ‘Molecular biology’
Sequence-based reagent	GAPDH2_reverse	This paper	GTACTTGATCAGGTCGATG	qRT-PCR Figure 7 More information in the Materials and methods section under ‘Molecular biology’
Software, algorithm	MATLAB R2017a	The MathWorks Inc.50 Natick, MA	Custom scripts	Codes are available in the Source code 1

*We used different allelic combinations for the Rdl^MDRR insensitive allele when imaging Mi1 (Rdl^MD-RR/Rdl¹) or Tm3 (Rdl^MD-RR/RdlMD^MD-RR). While the use of the Rdl¹ null mutant is genetically cleaner, application of low concentrations of PTX has weaker phenotypes in genetic backgrounds carrying the Rdl¹ allele than in wild type, possibly due to homeostatic mechanisms (Figure 2A,B, Figure 4A). The 2.5 µM PTX phenotype was even weaker in Tm3, and did not leave a margin to look for rescue by Rdl^MDRR, which is why we instead used two copies of the Rdl^MDRR allele, which has a PTX phenotype similar to wild type in heterozygosity.

**GluClα^FlpStop.D/Df mutant larvae failed to crawl out of the food, but adult flies could be obtained after saving pupae from the food.