Hemozoin produced by mammals confers heme tolerance
- University of Maryland, United States
- University of Utah School of Medicine, United States
- University of Tsukuba, Japan
- University of Tsukaba, Japan
- National Human Genome Research Institute, National Institutes of Health, United States
- Sayo, Japan
- Perelman School of Medicine at the University of Pennsylvania, United States
- Oregon Health and Science University, United States
Figures
Figure 1 with 1 supplement
Reticuloendothelial tissues accumulate dark pigments in the absence of SLC48A1.
(A) Structure of the SLC48A1 gene (which encodes SLC48A1) indicating the CRISPR target site in exon 1. (B) Predicted topology of SLC48A1 protein; arrow indicates the site of the two basepair …
Figure 1—figure supplement 1
Genetic lesion in SLC48A1, genotypic segregation and loss of SLC48A1 IHC by alkaline-phosphatase.
(A) Chromatogram of genomic DNA sequencing from mice indicating two basepair deletion. (B) Mendelian distribution of P21 pups derived from SLC48A1 HET intercrosses. (C) SLC48A1 immunohistochemistry …
Figure 2 with 1 supplement
KO mice exhibit extramedullary erythropoiesis with fewer mature RPMs Gating strategy of Ter-119+ cells in the (A) bone marrow and (D) spleen.
Quantifications of total Ter-119+ cells in the (B) bone marrow and (E) spleen. The %single cells* on the y-axis denote single cells that are negative for CD4/8/41, B220 and Gr-1. (C) Quantification …
Figure 2—figure supplement 1
Representative flow cytometry plots of bone marrow and splenic cells.
(A) Gating of bone marrow Ter-119+ subpopulations. (B) Gating of splenic Ter-119+ population II+III. (C–D) Gating of splenic RPMs and monocytes. Individual plots shown are representative of all mice …
Figure 3 with 1 supplement
Heme accumulates within RES macrophages of KO mice Histochemical staining of spleen, liver and bone marrow tissue sections of WT and KO mice with H and E (A) or Perl’s Prussian blue (B).
Arrows indicate dark pigments in KO tissues. Images shown are representative of at least three mice. Quantification of tissue iron (C) and heme (D) by ICP-MS and UPLC, respectively in tissues of …
Figure 3—figure supplement 1
Quantification of tissue metals and F4/80 IHC controls.
(A–E) Quantification of tissue iron (Fe), copper (Cu), zinc (Zn), manganese (Mn) and heme (n = 6–17). Heme was undetectable in brain tissue. F4/80 immunohistochemistry of spleen (F), liver (G) and …
Figure 4 with 1 supplement
Dietary iron deficiency disrupts iron metabolism gene expression in KO mice and results in lethality.
(A) Kaplan-Meier survival curve of WT and KO mice placed on a low-iron (2ppm) diet (n = 15–17, both males and females). (B–C) Hematocrits of WT and KO mice placed on a standard or low-iron (2ppm) …
Figure 4—figure supplement 1
Representative flow cytometry plots and iron metabolism gene expression levels.
(A) Quantification of tissue iron (Fe) (n = 6–17). (B) Quantification of total Ter-119+ cells represented as a percentage of all single cells analyzed in the bone marrow. The %single cells* on the …
Figure 5 with 1 supplement
Loss of SLC48A1 produces hemozoin biocrystals within enlarged lysosomes due to impaired erythrophagocytosis.
(A) Experimental design of 59Fe labeling and in vivo recycling. (B) Quantification of 59Fe retained in tissues, represented as the ratio of the amount of radioactivity within an organ to that of the …
Figure 5—figure supplement 1
Supporting data for hemozoin in WT and KO mice.
(A) 59Fe retained in differentially extracted fractions of the liver at 96 hr, represented as counts per min. Total homogenate: homogenized and proteinase-treated whole spleen; Organic: ethyl …
Figure 6 with 1 supplement
SLC48A1 deficiency confers cellular heme tolerance during erythrophagocytosis and haploinsufficiency of HMOX1 in SLC48A1-deficient animals causes perinatal lethality.
(A) Images of cell lysates and quantification of heme content in WT and KO BMDMs at basal (no treatment), 24 hr, 48 hr and 72 hr post-EP (erythrophagocytosis). Results are representative of at least …
Figure 6—figure supplement 1
Extended characterization of HMOX1; SLC48A1 mice.
(A) Representative images of WT and KO BMDMs post-EP. (B) Representative images of intracellular reactive oxygen species (ROS) in WT and KO BMDMs at the indicated timepoints post-treatments. (C) …
Author response image 1
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, 129/SvJ/C57BL/6J) | SLC48A1, HMOX1 | This paper, Materials and methods subsection animals | Mouse strain | |
| Biological sample (Mus musculus) | Primary bone marrow-derived macrophages | SLC48A1/HMOX1 mice | ||
| Biological sample (Plasmodium falciparum) | Hemozoin | Plasmodium falciparum | Gift from Dr. Paul Sigala | |
| Antibody | SLC48A1 (Rabbit, polyclonal) | PMID: 30248094 | 1:500 | |
| Antibody | F4/80 (Rat, polyclonal) | Invitrogen | MF48000 RRID:AB_10376289 | 1:1000 |
| Antibody | HMOX1 (rabbit, polyclonal) | Enzo | ADI-SPA-896 RRID:AB_10614948 | 1:1000 |
| Antibody | LAMP1 (rat, polyclonal) | Developmental Studies Hybridoma Bank | 1D4B RRID:AB_2134500 | 1:100 |
| Antibody | Anti-F4/80 microbeads | Miltenyi Biotech | 130-110-443 | Beads |
| Recombinant DNA reagent | guide RNA | Sage Laboratories | TAGGGACGGTGGTCTACCGACAACCGG | |
| Recombinant DNA reagent | Cas9 RNA | Trilink Biotechnologies | ||
| Sequence-based reagent | HMOX1 KO F | PMID: 24963040 | GCTTGGGTGGAGAGGCTATTC | |
| Sequence-based reagent | HMOX1 KO R | PMID: 24963040 | CAAGGTGAGATGACAGGAGATC | |
| Sequence-based reagent | HMOX1 WT F | PMID: 24963040 | GTACACTGACTGTGGGTGGGGGAG | |
| Sequence-based reagent | HMOX1 WT R | PMID: 24963040 | AGGGCCGAGTAGATATGGTAC | |
| Sequence-based reagent | Custom qPCR array | Qiagen; this paper | CLAM25204D | |
| Commercial assay or kit | Stanbio Iron and TIBC kit | VWR | 10152–550 | |
| Commercial assay or kit | mouse ferritin ELISA kit | Abcam | ab157713 | |
| Commercial assay or kit | LDH kit | Sigma | TOX7 | |
| Commercial assay or kit | ROS kit | Sigma | MAK142 | |
| Commercial assay or kit | GSH assay kit | Abcam | ab138881 | |
| Chemical compound, drug | Clodronate liposomes | Clodronate liposomes | C-005 | |
| Software, algorithm | Heatmapper software | PMID: 27190236 | ||
| Software, algorithm | PRISM seven software | Graphpad | ||
| Other | 59FeCl3 | Perkin Elmer | NEZ037001MC | Radioactive material |
Additional files
-
Supplementary file 1
Table 1: SLC48A1/HRG1 Mutant alleles produced by CRISPR/Cas9.
Table 2: Serum iron panel for WT and KO animals fed standard or 2ppm iron diet. Table 3: qRT-PCR analyses for iron/heme metabolism genes.
- https://cdn.elifesciences.org/articles/49503/elife-49503-supp1-v1.docx
-
Supplementary file 2
Contains tables of statistical analyses not included in the Transparent Reporting File.
- https://cdn.elifesciences.org/articles/49503/elife-49503-supp2-v1.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/49503/elife-49503-transrepform-v1.pdf
