Selective clearance of the inner nuclear membrane protein emerin by vesicular transport during ER stress

  1. Abigail Buchwalter  Is a corresponding author
  2. Roberta Schulte
  3. Hsiao Tsai
  4. Juliana Capitanio
  5. Martin Hetzer  Is a corresponding author
  1. University of California, San Francisco, United States
  2. Chan Zuckerberg Biohub, United States
  3. The Salk Institute for Biological Studies, United States

Abstract

The inner nuclear membrane (INM) is a subdomain of the endoplasmic reticulum (ER) that is gated by the nuclear pore complex. It is unknown whether proteins of the INM and ER are degraded through shared or distinct pathways in mammalian cells. We applied dynamic proteomics to profile protein half-lives and report that INM and ER residents turn over at similar rates, indicating that the INM’s unique topology is not a barrier to turnover. Using a microscopy approach, we observed that the proteasome can degrade INM proteins in situ. However, we also uncovered evidence for selective, vesicular transport-mediated turnover of a single INM protein, emerin, that is potentiated by ER stress. Emerin is rapidly cleared from the INM by a mechanism that requires emerin’s LEM domain to mediate vesicular trafficking to lysosomes. This work demonstrates that the INM can be dynamically remodeled in response to environmental inputs.

https://doi.org/10.7554/eLife.49796.001

Introduction

The biogenesis of roughly one-third of the cell’s proteome takes place within the endoplasmic reticulum (ER) network. The ER is contiguous with the nuclear envelope (NE) membrane, a double bilayer membrane that defines the boundary of the nucleus. The NE is punctuated by nuclear pore complexes (NPCs) which control transport between the nuclear and cytoplasmic compartments. The outer nuclear membrane (ONM) and the bulk ER membrane network have a similar protein composition, including ribosomes that can be seen associated with the ONM. The inner nuclear membrane (INM), in contrast, is cloistered away from the bulk ER network by the NPC (Figure 1A). Proteomic analyses suggest that hundreds of proteins are selectively concentrated at the INM (Schirmer et al., 2003), and mutations to these proteins cause a broad array of rare pathologies (Schreiber and Kennedy, 2013).

Figure 1 with 1 supplement see all
Dynamic proteomic analysis of inner nuclear membrane protein turnover.

(A) Diagram of the ER with associated ribosomes, the NE composed of the ONM and INM, the NPCs, and the underlying nuclear lamina. INM proteins are synthesized in the ER, pass through the NPC, and enrich at the INM. (B) Overview of dynamic SILAC labeling experimental design. C2C12 mouse myoblasts were cultured for five population doublings in medium containing 13C6-lysine and 13C6, 15N4-arginine to completely label the proteome. After 3 days of culturing under differentiating conditions to generate non-dividing myotubes, cultures were switched to chase medium containing 12C-lysine and 12C, 14N-arginine for 1 to 3 days. Nuclear extracts were prepared at day 0, day 1, day 2, and day three for proteomic identification. (C,D) Representative peptide scans for a slowly degraded protein (Nup160) and (D) for a rapidly degraded protein (Topo2α) at the starting and ending points of the experiment outlined in (B). (E) Histogram of calculated half-lives for 1677 proteins with a median half-life of 2.4 days. (F) Features of nuclear proteome turnover. Median turnover behavior of 1677 proteins detected in at least three timepoints with at least one peptide (black line) with one standard deviation (gray); compared to turnover of the slowly exchanged protein Nup160 (black) and the rapidly exchanged protein Topo2α (blue). Error bars indicate SEM. (G) Calculated half-lives of 10 bona fide INM proteins, ranging from slowly degraded (nurim, purple) to rapidly degraded (emerin, green); 12 nuclear envelope transmembrane proteins (NETs) identified as NE residents by subtractive proteomics (see Schirmer et al., 2003); and 112 ER membrane proteins. ns indicates lack of statistical significance by Mann-Whitney test. Error bars indicate SEM. (H) There is no significant correlation between extraluminal domain size of INM proteins and their half-lives. See also Source Data 1–2, Supplementary files 13, and Figure 1—figure supplement 1.

https://doi.org/10.7554/eLife.49796.002

As the INM is devoid of ribosomes and translocation machinery, INM proteins must be synthesized in the ONM/ER and transported into the INM. Proteins concentrate at the INM by mechanisms including diffusion followed by stable binding to a nuclear structure, such as chromatin or the nuclear lamina, or signal-mediated import through the NPC (Katta et al., 2014). Transport across the NPC is a major kinetic barrier to accumulation of proteins at the INM (Boni et al., 2015; Ungricht et al., 2015). While mechanisms of INM targeting have been extensively studied, it is less clear how INM proteins are targeted for degradation if misfolded, damaged, or mistargeted.

Protein folding is inefficient, and newly synthesized proteins often become terminally misfolded and require degradation (Hegde and Zavodszky, 2019). Mature proteins also become damaged or misfolded over time and require selective degradation and replacement. Within the ER membrane network, the major degradation pathway is ER-associated degradation, or ERAD. ERAD is initiated by poly-ubiquitination of a target protein by an E3 ubiquitin ligase, followed by extraction from the membrane and proteolysis by proteasomes in the cytosol (Hegde and Zavodszky, 2019). Flux through ERAD helps to maintain organelle homeostasis and cell function by clearing damaged, misfolded, or mislocalized proteins.

Recent work in S. cerevisiae has identified a small number of ubiquitin ligases that target INM-localized proteins for degradation by ERAD, but the mammalian homologs remain elusive, perhaps because of the massive expansion of the E3 ubiquitin ligase family in recent evolution (Deshaies and Joazeiro, 2009). Degradation of mammalian INM proteins also appears to rely on activity of the proteasome and on the ERAD ATPase p97 (Tsai et al., 2016), suggesting that mammalian INM proteins may be subject to ERAD. However, we lack a broad understanding of the lifetimes of INM proteins in this compartment and the pathways used for their degradation within mammalian cells.

We sought to understand features of INM protein turnover in mammalian cells, and applied both proteome-wide and targeted candidate approaches to address this question. Here we show that the LEM domain protein emerin (EMD) is a rapidly degraded constituent of the INM. We use EMD as a model for dissecting INM protein turnover pathways and demonstrate that EMD is subject to both proteasome-dependent and lysosome-dependent modes of degradation. We report that both misfolded and normally folded variants of EMD are selectively exported from the INM and ER during acute ER stress by vesicular transport through the secretory pathway and delivery to the lysosome. These findings indicate that the INM sub-compartment senses and responds to ER stress.

Results

Trends in protein turnover across the NE/ER membrane network

We first used a dynamic proteomic approach to understand trends in protein turnover across ER sub-compartments. Since the nucleus is entirely disassembled during mitosis in mammalian cells, we chose a system that would allow us to profile protein turnover in the absence of cell division. We made use of the C2C12 myoblast culture system, which can be induced to irreversibly differentiate into myotubes by serum withdrawal (D'Angelo et al., 2009). We subjected these non-dividing mouse muscle myotubes to a pulse-chase timecourse using stable isotope labeling in cell culture (SILAC) (Ong and Mann, 2006) for timepoints ranging from 1 to 3 days (Figure 1B, see Materials and methods). Crude nuclear extracts were prepared and analyzed by mass spectrometry, and the ratio of ‘old’ (13C6-Lys, 15N4 + 13C6-Arg-labeled) to ‘new’ (12C6-Lys, 14N4 + 12C6-Arg-labeled) protein was quantified at the peptide level over time; peptides that passed stringent quality control filters were retained for estimation of half-lives by a linear regression fitting method (Dörrbaum et al., 2018)(see Materials and methods). We evaluated 1677 proteins and predicted half-lives over a wide range, from less than a day to greater than 15 days (Figure 1E, Table S3). Linear regression performs well when a line can be fitted with high fidelity and a non-zero slope is detectable; these conditions were generally met for proteins with predicted half-lives ranging from 1 to 8 days. We observed more frequent deviations in linearity at the low extreme (predicted t1/2 <1 day) and slopes approaching zero at the high extreme (predicted t1/2 > 8 days) (Figure 1—figure supplement 1). We expect that these factors limit the precision of half-life determination below 1 day and above 8 days from our 3 day timecourse. The median turnover rate that we observed (2.4 days) corresponds well with previous analyses in non-dividing mammalian cell cultures (Cambridge et al., 2011).

We observed some extremes in protein stability that are consistent with previous reports; for example, the long-lived nuclear pore complex component Nup160 (Toyama et al., 2013) was in the top 10% of predicted half-lives, with a calculated half-life of approximately 18 days (Figure 1C,F, Table S1). Near the other extreme, we observed that the enzyme topoisomerase 2α (Topo2α) had a predicted half-life in the bottom 10%, of less than 1 day (Figure 1D,F). This is consistent with this enzyme’s known regulation by ubiquitination and proteolysis (Gao et al., 2014).

Having established this framework, we then quantified the turnover kinetics of known inner nuclear membrane (INM) proteins. For this analysis, we focused on proteins whose preferential enrichment in this membrane compartment had been experimentally verified; we identified ten such proteins in our dataset (see Table S1) and determined their half-lives (see Materials and methods). We observed half-lives for these proteins ranging from 8.8 days (nurim) to 1.5 days (emerin) (Figure 1G). While very little is known about nurim’s function, its intrinsic biophysical properties may contribute to its long half-life: nurim contains six transmembrane domains, is extremely insoluble (Hofemeister and O'Hare, 2005), and diffuses very slowly within the INM (Rolls et al., 1999). Emerin (EMD) is a founding member of the LEM domain family of INM proteins with essential functions in muscle development (Brachner and Foisner, 2011). Unlike nurim, EMD is a small (~25 kDa), single-pass, tail-anchored transmembrane protein that diffuses freely through the NPC and enriches at the INM by virtue of its affinity for lamin A (Vaughan et al., 2001).

Given the INM’s status as a restricted sub-compartment of the ER, we reasoned that it might be possible that INM proteins would be generally less accessible to protein turnover than ER membrane proteins. Alternatively, similarly effective turnover in both compartments might support the possibility that turnover can occur in situ at the INM. ER membrane proteins were well represented in our dataset, as a significant proportion of ER membranes remain attached to and co-purify with nuclei (Schirmer et al., 2003). We could thus query whether INM proteins exhibited distinct turnover kinetics from membrane proteins of the bulk ER by comparing INM and ER transmembrane protein half-lives. We also compared bona fide INM proteins to proteins that had been identified as preferentially associated with either the inner or outer bilayer of the nuclear envelope (NE) membrane by comparative proteomics (Schirmer et al., 2003), termed NE transmembrane proteins (NETs). Altogether, these analyses indicate that INM proteins do not exhibit unique turnover kinetics as a protein class, compared to ER membrane proteins in general or to the overlapping designation of NETs (Figure 1G).

The size of INM proteins determines whether a protein must rely on signal-mediated transport through the NPC (Katta et al., 2014), and live imaging assays indicate that INM proteins with larger nucleoplasm-facing domains move more slowly across the NPC barrier (Boni et al., 2015; Ungricht et al., 2015). If transit across the NPC and out of the INM were a prerequisite for turnover in the bulk ER, we reasoned that turnover efficiency would also exhibit some dependence on protein size, because of the relationship between protein size and transport efficiency between the two compartments. The short half-life and small size of EMD is in line with this possibility. Our dataset of INM proteins included four single-pass INM and six multi-pass INM proteins, with total size of extraluminal domains ranging from 40 amino acids to 733 amino acids (Table S5). If export out of the NPC were a prerequisite for INM protein turnover, we reasoned that half-life should increase as the bulk of nucleoplasm-facing domains increases. We found no evidence for such a correlation (Figure 1H). We infer from this analysis that other factors distinct from monomeric protein size regulate protein turnover rate. This indicates that for INM proteins, export out of the INM is not a rate-limiting step for protein turnover. Rather, this is consistent with evidence in S. cerevisiae (Foresti et al., 2013; Khmelinskii et al., 2014) and in mammalian cells (Tsai et al., 2016) that turnover of INM proteins can take place in situ at the INM.

Recombination-induced tag exchange confirms INM protein lifetimes

We observed a wide range of half-lives for INM proteins in our proteomic analyses (Figure 1G), with the polytopic INM protein nurim turning over most slowly and the single-pass INM protein EMD turning over most rapidly. To directly visualize these relative differences in protein stability, we used recombination-induced tag exchange (RITE) (Toyama et al., 2019; Verzijlbergen et al., 2010) (Figure 2A) to perform a microscopy-based pulse-chase experiment. We expressed either nurim or EMD in a cassette encoding two C-terminal epitope tags separated by LoxP sites and by a stop codon, such that the resulting transcript will encode a protein that will be C-terminally tagged with the first tag. Upon adenoviral introduction of Cre recombinase, the RITE cassette is recombined to remove the first tag and position the second tag downstream of the open reading frame, so that all newly synthesized mRNA encodes a protein marked with the second tag. This enables simultaneous tracking of older and newer pools of protein that were synthesized before and after Cre addition, respectively (Toyama et al., 2019; Verzijlbergen et al., 2010). Using this approach, we visualized the rate of decline in the fluorescence intensity of ‘old’ myc-tagged nurim or EMD over several days in quiescent C2C12 cells. Consistent with our proteomic observations, we observed that RITE-tagged nurim decayed significantly more slowly than RITE-tagged EMD at the NE (Figure 2B–C,H).

The RITE system allows unambiguous dissection of the fates of maturely folded protein as well as nascent, newly synthesized protein. Recent work in yeast (Foresti et al., 2013; Khmelinskii et al., 2014) and in mammalian cells (Tsai et al., 2016) strongly suggests that INM proteins are subject to proteasome-mediated degradation via the ERAD pathway. The RITE system provides a means to distinguish the effects of proteasome inhibition on maturely folded proteins by inhibiting the proteasome after RITE tag switching, and monitoring the effects on maturely folded proteins. Mature nurim-RITE decreases only modestly within 2 days of tag switching, but co-incubation with the proteasome inhibitor MG132 for 1 day causes accumulation of nurim-RITE through the NE and ER (Figure 2E,H). Maturely folded EMD-RITE diminishes significantly at the NE within 2 days of tag switching but is partially stabilized at the NE in the presence of MG132 (Figure 2F,H). This indicates that mature, INM-localized proteins can be degraded in a proteasome-dependent pathway in situ at the INM. Notably, abundant proteasomes have been observed along the INM in cryo-EM studies and could possibly engage with substrate there (Albert et al., 2017). This is also consistent with a recent report that an unstable INM protein mutant accumulates within the nucleus of mammalian cells when the proteasome is inhibited (Tsai et al., 2016).

Identification of a model substrate for dissecting INM protein turnover

In order to gain more insight into the pathways that control INM protein turnover in mammalian cells, we chose to focus on EMD for its relatively fast turnover rate (Figure 1G, Table S1) and for the variety of disease-linked mutations to EMD that appear to influence protein stability (Fairley et al., 1999). Loss-of-function mutations to EMD cause Emery-Dreifuss muscular dystrophy (EDMD) (Bonne and Quijano-Roy, 2013). In some cases, EDMD-linked mutations cause loss of detectable EMD protein without affecting mRNA levels, suggesting that these mutations might cause misfolding and degradation of EMD (Fairley et al., 1999). We sought to identify such an EDMD-linked EMD variant for use as a model substrate for dissecting INM protein turnover. We selected a small in-frame deletion (Δ95–99) within EMD’s lamin-binding domain (Figure 2D) that had been previously shown to localize to the NE when ectopically expressed (Fairley et al., 1999). Consistently, when we expressed either EMD-GFP or EMDΔ95–99-GFP in C2C12 cells, we observed similar enrichment at the NE (Figure 2—figure supplement 1). Further, both protein variants exhibited identical residence times at the NE as assayed by fluorescence recovery after photobleaching (FRAP) analysis (Figure 2—figure supplement 1). Directly monitoring the stability of EMDΔ95–99 by RITE tagging indicates that it disappears from the NE faster than wild type EMD (Figure 2G), but is also stabilized at the NE by proteasome inhibition (Figure 2G–H). These observations indicate that EMDΔ95–99 is an unstable EMD variant that resides within the INM. We next moved to dissect that pathway(s) involved in EMDΔ95–99 degradation.

Figure 2 with 1 supplement see all
RITE analysis of INM proteins enables visualization of proteasome-dependent turnover.

RITE analysis of INM proteins corroborates protein turnover determined by proteomics. (A) Schematic of recombination-induced tag exchange (RITE) expression cassette for visualizing protein turnover using Cre recombinase-mediated tag switching. (B-C) RITE timecourses of nurim-RITE (B) and EMD-RITE (C) in quiescent C2C12 cells. Maximum intensity projections of confocal z-series shown. (D) Diagram of emerin domain organization and position of EDMD-linked deletion mutant (EMDΔ95-99) within the lamin-binding domain. (E-G) RITE timecourses of nurim-RITE (E), EMD-RITE (F), and EMDΔ-RITE (G) with or without 1 day of cotreatment with the proteasome inhibitor MG132 (right panels). Single confocal z-slices shown. (H) Quantification of normalized intensity of old NE-localized RITE-tagged protein in maximum intensity projections of confocal z series acquired across the conditions shown in (E-G). Bars indicate average values with error bars indicating SEM for N > 42 cells per condition from 2 independent experiments. **** indicates p-value < 0.0001 (by t-test) for comparison between untreated and treated conditions. Scale bar, 10 mm. See also Figure 2—figure supplement 1.

https://doi.org/10.7554/eLife.49796.004

Proteasome-dependent and proteasome-independent modes of emerin clearance

Misfolded ER resident proteins are cleared by the ER-associated degradation (ERAD) pathway. ERAD clients are marked for degradation by ubiquitination, extracted from the ER membrane by the ATPase enzyme p97, and degraded by the proteasome in the cytosol (Ruggiano et al., 2014). INM proteins may also be targeted to an arm of the ERAD pathway in mammalian cells (Tsai et al., 2016), and our data indicate that multiple INM proteins are stabilized in situ by proteasome inhibition. However, ubiquitin ligase(s) that recognize INM-localized substrates in mammalian cells have not been identified.

To sensitively probe factors that influence INM protein stability, we tracked the stability of GFP-tagged EMD variants. When de novo protein synthesis was blocked by cycloheximide (CHX), we observed rapid loss of EMDΔ95–99-GFP within 4–8 hr (Figure 3A–B) while wild type EMD remained stable (Figure 3—figure supplement 1). This loss is blunted by co-treatment with the proteasome inhibitor MG132 (Figure 3A, third panel), consistent with our observations that INM protein turnover is slowed by proteasome inhibition using the RITE system (Figure 2E–G). If EMDΔ95–99-GFP is directed to the proteasome through ERAD, inhibition of earlier steps in this pathway should similarly cause accumulation of EMDΔ95–99-GFP. Indeed, pharmacological inhibition of p97 with the drug eeyarestatin I (Wang et al., 2008) causes modest accumulation of EMDΔ95–99 and of higher molecular weight species, a similar effect to proteasome inhibition itself (Figure 3B). In contrast, the drug kifunensine, which prevents ERAD targeting of misfolded glycosylated proteins (Fagioli and Sitia, 2001), has no effect on EMDΔ95–99-GFP levels as would be expected given the lack of glycosylation sites within EMD’s small luminal domain (Figure 3B).

Figure 3 with 3 supplements see all
Acute stressors destabilize mutant emerin protein levels.

(A) C2C12 cells stably expressing EMDΔ-GFP and treated with DMSO vehicle control, CHX alone, CHX and MG132, or MG132 alone for 8 hours. All images were acquired using the same laser power and detector gain settings. Single confocal z slices shown. (B) Western blot analysis of protein levels in C2C12 cells stably expressing EMDΔ-GFP and treated with DMSO vehicle, the translation inhibitor CHX, the proteasome inhibitor MG132, the p97 ATPase inhibitor eeyarestatin, or the glycosylation trimming inhibitor kifunensine for the time periods shown. a-tubulin shown as loading control. (C) Western blot analysis of U2OS cells stably expressing EMDΔ-GFP and doxycycline-inducible RNAi targeting the E2 ubiquitin ligases UBE2G1 and UBE2G2 and treated with DMSO vehicle control (-) or with doxycycline (+) for 48 hours. Free GFP indicates RNAi induction. a-tubulin shown as loading control. (D) Western blot detection of EMDΔ-GFP levels in cells treated with DMSO vehicle, or co-treated with CHX and the ER stress inducer THG for the time periods shown. a-tubulin shown as loading control. (E) C2C12 cells stably expressing EMDΔ-GFP and treated with vehicle control or with THG for the time periods shown. Insets show nuclei in the same ~50 µm field of view stained with Hoechst. All images acquired using the same laser power and detector gain settings; single confocal z slices shown. (F) Quantification of total NE-localized GFP fluorescence in maximum intensity projections of confocal z slices acquired across the conditions shown in (E) for N > 410 cells per condition. (G) Diagram of emerin domain organization and the sequence of an inserted C-terminal glycosylation sequence derived from the opsin protein, with glycosylation acceptor site marked (*). (H) Analysis of EMDΔ-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or CHX and THG cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMDΔ-GFP*; orange arrowhead indicates EndoH-resistant states of EMDΔ-GFP*; black arrowhead indicates deglycosylated EMDΔ-GFP*. a-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 mm. See also Figure 3 – figure supplement 1, 2, and 3.

https://doi.org/10.7554/eLife.49796.006

E3 ubiquitin ligases transfer ubiquitin to ERAD substrates, and each E3 ligase exhibits preference for a small number of substrates. A few E3 ligases have been implicated in ERAD of INM-localized substrates in yeast, including Doa10 and Asi1 (Khmelinskii et al., 2014). MARCH6 is a mammalian ortholog of Doa10 (Zattas et al., 2016). Mammalian orthologs of Asi1 have not been identified. Based on iterative sequence homology analysis through the MetaPhORs database (Pryszcz et al., 2011) we identified two possible Asi1 homologs: Rnf26 and CGRRF1. We depleted MARCH6, Rnf26, and CGRRF1 with short interfering RNA (siRNA), but observed no effect on EMDΔ95–99 protein levels (Figure 3—figure supplement 2), suggesting that these ligases do not catalyze EMD turnover, or alternatively that multiple E3 ligases are redundant in this process. Importantly, the broad group of ERAD-implicated E3 ligases rely on a handful of E2 ubiquitin conjugating enzymes for ubiquitin transfer. These E2 ligases – four in mammals – thus represent a key control point for ERAD (Christianson et al., 2011; Leto et al., 2019). We targeted these four E2 ubiquitin ligases by siRNA transfection (Figure 3—figure supplement 2) and a subset of these by inducible RNAi using a potent microRNA-based system (Fellmann et al., 2013) and analyzed the effects on EMDΔ95–99-GFP levels. To our surprise, knockdown of UBE2G1, UBE2G2, UBE2J1, and UBE2J2 either did not stabilize or instead decreased EMDΔ95–99-GFP levels (Figure 3C; Figure 3—figure supplement 2). This finding suggests that when ERAD is perturbed, EMD variants can be cleared by an alternative pathway.

Emerin is subject to rapid stress-dependent clearance from the ER and NE

Global inhibition of ERAD places profound protein folding stress on the ER membrane network and induces the unfolded protein response (UPR) (Christianson et al., 2011). We considered whether direct induction of ER stress was sufficient to accelerate the turnover of EMDΔ95–99-GFP. We tested the effect of the ER stressor thapsigargin (THG), which disrupts ER homeostasis by causing release of Ca2+ from the ER lumen, on EMDΔ95–99 protein stability. Compared to CHX treatment alone (Figure 3—figure supplement 1), THG co-treatment further destabilized EMDΔ95–99-GFP (Figure 3D). Strikingly, when we tracked EMDΔ95–99 protein localization by time-lapse microscopy (Figure 3E), it became apparent that NE localization of EMDΔ95–99 significantly decreases within 2 hr of THG treatment, concomitant with accumulation in a perinuclear membrane compartment that morphologically resembles the Golgi apparatus. By 8 hr after THG administration, EMDΔ95–99 was undetectable (Figure 3E–F). These data suggest that under conditions of ER stress, EMDΔ95–99 is cleared from the NE/ER membrane network by transport out of the ER and eventual disposal of the protein in a post-ER compartment.

Acute ER stress reroutes emerin through the secretory pathway

We took several approaches to test the possibility that EMDΔ95–99 leaves the NE/ER network during ER stress. Firstly, we made use of the characteristic sugar modifications that occur as cargoes progress through the secretory pathway to determine whether EMDΔ95–99 accesses post-ER compartments. Since the short lumenal domain of EMD lacks a glycosylation consensus site, we engineered the glycosylation site from the opsin protein (Bulbarelli et al., 2002) (SSNKTVD) onto the lumen-facing C terminus of EMDΔ95–99. If EMDΔ95–99 is retained in the ER, all of its N-linked glycans should remain sensitive to the trimming enzyme Endo H. On the other hand, if EMDΔ95–99 exits the ER, its N-linked glycans will be elaborated with further modifications so that Endo H can no longer trim them. These glycosylation states can be detected as progressive increases in molecular weight, and can be completely removed by incubation with the enzyme PNGase F. This engineered variant, EMDΔ95–99-GFP*, localizes normally to the NE and also disappears from the NE upon ER stress induction (Figure 3—figure supplement 3). In unstressed cells, EMDΔ95–99-GFP* is predominantly observed in an Endo H-sensitive glycosylation state (Figure 3H, red arrowhead), with a minor pool of Endo H-resistant protein (Figure 3H, orange arrowhead). In contrast, EMDΔ95–99-GFP* shifts progressively to a higher molecular weight, Endo H-resistant state over 2 to 4 hr of co-treatment with CHX and THG. This indicates that ER stress induction increases the proportion of EMDΔ95–99 that exits the NE/ER and samples post-ER compartments.

Upon ER stress induction, EMDΔ95–99-GFP accumulates in a perinuclear domain that resembles the Golgi apparatus (Figure 3E). We evaluated the extent of colocalization of EMDΔ95–99-GFP with the medial Golgi resident protein giantin in untreated cells and cells that had been treated with THG for 2–4 hr (Figure 4A–C). In untreated cells, EMDΔ95–99-GFP was not detectable in the Golgi, but THG treatment rapidly induced Golgi colocalization as NE-localized EMDΔ95–99 levels decreased (Figure 4A–C). Comparing GFP fluorescence intensity in the Golgi versus the NE over time revealed that ER stress induces significant enrichment of EMDΔ95–99-GFP in the Golgi accompanied by loss from the NE within 2 hr (Figure 4D).

Figure 4 with 1 supplement see all
Stress-induced clearance of mutant emerin from the ER and NE involves the secretory pathway.

(A-C) Representative confocal slices of cells stably expressing EMDΔ-GFP, treated with DMSO or THG for the indicated times and costained for giantin to mark the Golgi (magenta). All images were acquired using the same laser power and detector gain settings. (A’-C’) Are contrast-adjusted to show relative levels of EMDΔ-GFP in NE and Golgi. Dotted lines mark positions of linescans in (A’’-C’’). (D) Quantification of GFP fluorescence intensity abundance ratio in Golgi versus NE in single, non-contrast-adjusted z slices over THG treatment timecourse. Columns indicate average with error bars indicating SEM for N > 37 cells from two independent experiments. **** indicates p-value<0.0001 compared to untreated (by t-test). (E-F) Representative confocal slices of cells stably expressing EMDΔ-GFP (F) after 16 hr of treatment with DMSO vehicle control, THG, BFA, or co-treatment with THG and BFA. All images were acquired using the same laser power and detector gain settings. Insets show nuclei in the same ~ 50 µm field of view stained with Hoechst. (E) Quantification of GFP fluorescence intensity at the NE in maximum intensity projections of confocal z series acquired across the conditions represented in (F). Columns indicate average with error bars indicating SEM for N > 386 cells from three independent experiments. **** indicates p-value<0.0001 compared to untreated (by t-test). Scale bars in micrographs indicate 10 μm. See also Figure 4—figure supplement 1.

https://doi.org/10.7554/eLife.49796.010

EMDΔ95–99 could be delivered to the Golgi by vesicular transport from the ER. Transport between the ER and the Golgi is mediated by packaging of cargoes into COP-coated vesicles (Barlowe and Miller, 2013), a process which can be inhibited by the drug brefeldin A (BFA). BFA acts by disrupting COPI vesicle formation, leading to the collapse of the Golgi into the ER membrane network (Chardin and McCormick, 1999). To test whether clearance of EMDΔ95–99-GFP from the NE/ER requires vesicle-mediated ER-to-Golgi transport, we co-incubated cells expressing EMDΔ95–99-GFP with THG and BFA. Strikingly, co-treatment with BFA nearly quantitatively reversed loss of EMDΔ95–99-GFP from the NE (Figure 4E–F). Taken together with the time-dependent enrichment of EMD variants in the Golgi apparatus (Figure 4A–C), and the time-dependent accumulation of more complex N-glycosylated variants of EMDΔ95–99-GFP* (Figure 3H), this indicates that under ER stress, EMD variants can be cleared from both the NE and ER by vesicular transport through the Golgi.

While vesicle-mediated transport is the major pathway by which proteins move from the ER and onward through the secretory pathway, alternative modes of removing protein from the ER exist, in particular during ER stress. Recent evidence indicates that the ER can undergo autophagy under various conditions, including acute ER stress (Smith et al., 2018). To evaluate the possibility that EMDΔ95–99-GFP could be engulfed and removed from the NE and ER by autophagosomes, we tested the ability of the PI3K inhibitor KU55933 to reverse EMDΔ95–99-GFP loss. PI3K signaling promotes the formation of isolation membranes that engulf autophagic cargo (Farkas et al., 2011; Klionsky et al., 2016). We observed that cotreatment with KU55933 during acute ER stress could not prevent loss of EMDΔ95–99-GFP from the NE/ER (Figure 5A–C), in contrast to the ability of BFA treatment to rescue EMD loss. This indicates that vesicle-mediated transport to the Golgi and not autophagic engulfment mediates EMDΔ95–99-GFP’s exit from the ER during stress.

Mutant emerin trafficking is dependent on lysosomal but not autophagosomal function.

(A) Representative confocal slices of cells stably expressing EMDΔ-GFP after 8 hr of treatment with DMSO vehicle control, THG, co-treatment with THG and BFA, or co-treatment with THG and KU55933. Insets show nuclei in the same field of view stained with Hoechst. (B) Quantification of NE-localized GFP fluorescence intensity in maximum intensity projections of confocal z series acquired across the conditions shown in (A). Columns indicate average and error bars indicate SEM for N > 56 cells from three independent experiments. **** indicates p-value<0.0001 compared to untreated (by t-test). (C) Diagram of processes perturbed by KU55933, BFA, and Baf A1 treatment. (D-F) Representative confocal slices of C2C12 cells stably expressing EMDΔ-GFP and costained for LAMP1 after treatment with DMSO vehicle control (D), Baf A1 (E), or co-treatment with THG and Baf A1 (F) for the indicated times. (D’-F’) Insets show GFP-LAMP1 colocalization within ~ 15 µm field of view demarcated by dashed rectangles in (D-F). (G) Analysis of EMDΔ-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or THG and Baf A1 cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMDΔ-GFP*; orange arrowhead indicates EndoH-resistant states of EMDΔ-GFP*; black arrowhead indicates deglycosylated EMDΔ-GFP*. α-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 μm.

https://doi.org/10.7554/eLife.49796.012

Proteins in post-ER compartments can be degraded by vesicle-mediated traffic to the lysosome (Saftig and Klumperman, 2009). To investigate whether the lysosome was the eventual destination of EMDΔ95–99-GFP after ER export, we co-incubated cells expressing EMDΔ95–99-GFP with THG and bafilomycin A1 (Baf A1), which impairs lysosome acidification and thus slows protein degradative processes within lysosomes.

Under these conditions, we observed complete translocation of EMDΔ95–99-GFP out of the NE and ER and into numerous vesicles that are decorated with the lysosomal marker LAMP1 (Figure 5F). Notably, bafilomycin A1 alone did not trap EMDΔ95–99-GFP in lysosomes (Figure 5E), indicating that ER stress potentiates exit from the NE/ER and lysosomal accumulation. This indicates that the eventual destination of EMDΔ95–99-GFP after export from the NE/ER network is the lysosome.

If EMDΔ95–99 arrives at the lysosome by trafficking through the secretory pathway, this should be accompanied by the accumulation of Endo H-resistant N-glycosylation modifications on our engineered reporter EMDΔ95–99-GFP*. Indeed, we observe that the majority of EMDΔ95–99-GFP* exists as an Endo H-sensitive species in unperturbed cells (Figure 5G, red arrowhead), but shifts progressively to a higher molecular weight, Endo H-resistant state over 2 to 4 hr of co-treatment with THG and Baf A1 (Figure 5G, orange arrowhead). This indicates that EMDΔ95–99 traverses the secretory pathway before being delivered to the lysosome.

Emerin transiently accesses the plasma membrane during ER stress

A possible route from the early secretory pathway to the lysosome could involve anterograde transport following the ‘bulk flow’ of the secretory pathway, through the Golgi and into vesicles destined for the plasma membrane (PM). There, mislocalized proteins may be selectively endocytosed and trafficked to lysosomes for degradation through retrograde transport (Saftig and Klumperman, 2009). To explore this possibility, we performed antibody uptake assays in cells expressing EMDΔ95–99-GFP under homeostatic or stressed conditions. EMD is a tail-anchored protein with its final C-terminal amino acids facing the ER lumen; the C-terminal GFP tag will thus face the extracellular space if EMDΔ95–99-GFP accesses the PM (Figure 6A). We tested whether EMDΔ95–99’s GFP tag is accessible to an anti-GFP antibody applied to the surface of intact cells. In untreated cells, a small amount of EMDΔ95–99-GFP (Figure 6B–D) is accessible to an anti-GFP antibody, but not to an anti-myc antibody, indicating that EMDΔ95–99 is not completely restricted to intracellular membrane compartments under homeostatic conditions. Importantly, the signal from the anti-GFP antibody is specific to cells that express a GFP fusion protein (Figure 6D–E). Upon induction of ER stress by THG, the amount of PM-accessible EMDΔ95–99-GFP rapidly increases within 2–4 hr, and begins to taper off within 6 hr. This implies that ER stress induces the export of EMDΔ95–99-GFP from the NE/ER to the PM as well as its internalization. Importantly, the GFP antibody signal is visible within intracellular puncta, consistent with EMDΔ95–99-GFP:antibody conjugates being rapidly internalized into vesicles after PM delivery. Based on the timescale when the levels of EMDΔ95–99-GFP begin to significantly decrease at the NE (Figure 3E–F), increase in the Golgi (Figure 4A–D), transit through the PM (Figure 6) and accumulate in lysosomes (Figure 5F), we infer that EMDΔ95–99-GFP is transported through the secretory pathway to the PM, then internalized and delivered to lysosomes for degradation.

Figure 6 with 1 supplement see all
Mutant emerin traffics through the plasma membrane upon ER stress.

(A) Schematic of antibody uptake assay experimental design. If emerin accesses the plasma membrane (PM), it will be detected by anti-GFP antibody (green), which will bind the surface-exposed GFP tag. (B) Uptake of anti-GFP antibody (magenta) by cells stably expressing EMDΔ-GFP and treated with DMSO vehicle control or THG for 2, 4, or 6 hours. Cells were incubated with anti-GFP antibody for the final hour of these treatment periods before fixation and imaging. (C) Control demonstrating lack of uptake of anti-myc antibody by cells stably expressing EMDΔ-GFP and treated with THG for 2 hours. (D) Quantification of internalized antibody signal in EMDΔ-GFP expressing cells. Columns indicate average and error bars indicate SEM for N > 235 cells from 3 independent experiments. **** indicates p-value < 0.0001 (t-test) compared to untreated. (E) Control demonstrating lack of uptake of anti-GFP antibody by untreated C2C12 cells that do not express a GFP fusion protein. WGA is used to define cell boundaries. All images were acquired using the same laser power and detector gain settings. Scale bars in micrographs indicate 10 µm. See also Figure 6—figure supplement 1.

https://doi.org/10.7554/eLife.49796.013

Other INM proteins do not undergo stress-dependent clearance

Our findings indicate that EMDΔ95–99 is subject to proteasome-dependent turnover at the INM (Figure 2G–H; Figure 3A–B), but can also be rapidly removed from the INM and ER membrane network and targeted for degradation during ER stress. This raises the possibility that additional INM proteins are susceptible to stress-dependent degradation. To address this, we tested the response of additional INM proteins to ER stress induction by THG, to ER export blockage by BFA, and to lysosomal maturation blockage by Baf A1. We selected proteins with distinct topologies and half-lives, including the long-lived polytopic INM protein nurim and the less stable single-pass transmembrane protein Sun2 (see Figure 1H, Table S5). Prolonged treatment with THG modestly decreased nurim protein levels and significantly decreased Sun2 protein levels (Figure 7A–B,D), likely as a consequence of translational inhibition caused by ER stress (Harding et al., 1999). Consistent with this interpretation, the sensitivity of these two proteins tracks with the relative differences in their half-lives (Table S5); nurim has a half-life of ~ 9 days, while Sun2 has a half-life of ~ 3 days in non-dividing cells. Importantly, however, co-incubation with THG and BFA had no effect on either the subcellular localization or abundance of nurim or Sun2 (Figure 7A–B,D), indicating that loss of these proteins is not mediated by ER export. Further, neither protein leaves the NE/ER to accumulate in lysosomes when lysosome acidification is blocked by Baf A1 (Figure 7A’, B’).

Figure 7 with 1 supplement see all
Emerin, but not other INM proteins, undergoes stress-dependent clearance from the NE and ER and accesses lysosomes.

(A-C) Representative confocal slices of cells stably expressing NRM-GFP (A), Sun2-GFP (B), or EMD-GFP (C) after 16 hr of treatment with DMSO vehicle control, THG, or co-treatment with THG and BFA. Insets show nuclei in the same ~ 50 µm field of view stained with Hoechst. (A’-C’) Representative confocal slices of cells co-treated with THG and Baf A1. All images were acquired using the same laser power and detector gain settings. (D) Quantification of GFP fluorescence intensity at the NE in maximum intensity projections of confocal z series acquired across conditions represented in (A-C). Columns indicate average and error bars indicate SEM for N > 690 cells from three independent experiments. **** indicates p-value<0.0001 compared to untreated (t-test). (E-F) Analysis of EMD-WT-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or THG and CHX (E) or THG and Baf A1 (F) cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMD-WT-GFP*; orange arrowhead indicates EndoH-resistant states of EMD-WT-GFP*; black arrowhead indicates deglycosylated EMD-WT-GFP*. α-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 μm. See also Figure 7—figure supplement 1.

https://doi.org/10.7554/eLife.49796.015

We next asked whether wild type EMD was also subject to this pathway. Similarly to EMDΔ95–99, NE-localized EMD-GFP decreases when stress is induced by THG, but remains stable when stress induction by THG is accompanied by secretory pathway disruption by BFA (Figure 7C). ER stress also induces EMD-GFP to enrich in the Golgi (Figure 4—figure supplement 1) and access the plasma membrane (Figure 6—figure supplement 1). EMD-GFP also accumulates in perinuclear puncta that are likely lysosomes when cells are co-incubated with THG and Baf A1 (Figure 7C’). We again engineered an opsin glycosylation site onto the C-terminus of EMD-GFP in order to track movement of EMD through membrane compartments. EMD-WT-GFP* localizes to the NE and responds similarly to ER stress and secretory pathway blockage (Figure 7—figure supplement 1). As we observed with EMDΔ95–99, EMD-WT-GFP* exists predominantly in an Endo H-sensitive modification state in unstressed cells (Figure 7E–F, red arrowheads). Higher molecular weight, Endo H-resistant species increase in abundance when cells are coincubated with THG and CHX (Figure 7E, orange arrowhead) or with THG and Baf A1 (Figure 7F, orange arrowhead). We thus conclude that wild type EMD is subject to the same stress-induced lysosomal degradation pathway as EMDΔ95–99. However, when EMD-GFP’s response to THG is tracked over time, it is clear that displacement of wild type EMD from the NE proceeds significantly more slowly than displacement of EMDΔ95–99 (Figure 8B,D). This indicates that stress-dependent trafficking out of the INM is selective to variants of EMD, and that intrinsic features of EMD control its clearance from the NE/ER and targeting into lysosomes.

Figure 8 with 2 supplements see all
A signal within emerin’s.

LEM domain is required for stress-dependent clearance from the NE and ER (A) Diagram of emerin domain organization with N-terminal LEM domain deletion indicated (amino acids 1-45). (B-C) Representative confocal slices of C2C12 cells stably expressing EMD-WT-GFP (B) or EMDΔLEM-GFP (C) after treatment with DMSO vehicle control or THG for the indicated times. Insets show nuclei in the same ~50 µm field of view stained with Hoechst. (D) Quantification of EMDΔ95-99-GFP (as also shown in Figure 3F), EMD-WT-GFP, and EMDΔLEM-GFP fluorescence intensity at the NE in maximum intensity projections of confocal z series acquired across the timecourse shown in (B-C). Columns indicate average and error bars indicate SEM for N > 146 cells from 3 independent experiments. **** indicates p-value < 0.0001 compared to untreated (t-test). (E) Western blot of EMDΔLEM-GFP in cells treated with DMSO vehicle control or co-treated with THG and CHX for the indicated times. (F-G) Representative confocal slices of C2C12 cells stably expressing EMDΔLEM-GFP after treatment with (F) DMSO vehicle control, THG, THG + BFA, or (G) THG + Baf A1. (H) Quantification of GFP fluorescence intensity at the NE across the conditions shown in (F). Columns indicate average and error bars indicate SEM for N > 776 cells from 3 independent experiments. **** indicates p-value < 0.0001 compared to untreated (t-test). (I-J) Analysis of EMD-ΔLEM-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or THG and CHX (I) or THG and Baf A1 (J) cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMDΔLEM-GFP*; black arrowhead indicates deglycosylated EMDΔLEM-GFP*. a-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 mm. See also Figure 8—figure supplements 1 and 2.

https://doi.org/10.7554/eLife.49796.017

A signal within emerin’s LEM domain is required for stress-dependent export

Why are EMD variants selectively targeted for stress-dependent clearance from the INM and ER? We considered functional domains that might be involved in responding to ER stress. EMD is a tail-anchored protein with a ~ 10 amino acid tail that protrudes into the ER lumen (Figure 3A). This short sequence lacks any known motifs for engaging with proteins within the ER lumen. EMD’s nucleoplasmic domain includes an N-terminal LEM domain and an internal lamin A-binding region (Figure 3A). Emerin relies on lamin A for targeting to the INM (Vaughan et al., 2001) but we noted that in lmna - /- MEFs, EMD-GFP remained stably expressed even while mislocalized to the peripheral ER (Figure 8—figure supplement 2). The small deletion within EMDΔ95–99 falls within the lamin A-binding domain, but does not appear to affect the protein’s affinity for the lamina as judged by FRAP (Figure 2—figure supplement 1), even though this variant responds more potently than wild type EMD to ER stress (Figure 8D). Taken together, these observations indicate that dissociation from the lamina is not sufficient to promote clearance of EMD from the NE/ER membrane system.

We next evaluated whether interactions mediated by the LEM domain could contribute to stress-dependent EMD export. The LEM domain (Figure 3A) is a protein fold that binds with high affinity to the soluble nucleoplasmic protein BAF (Lee et al., 2001). We deleted this domain and queried the effects on EMD localization and trafficking. When expressed within unperturbed cells, EMDΔLEM exhibited normal enrichment in the NE (Figure 8C), consistent with its ability to bind the lamina independently of the LEM domain. However, we observed that this mutant was less responsive than other EMD variants to ER stress induction; NE-localized EMDΔLEM was clearly detectable over several hours of THG treatment and was significantly less sensitive than full-length EMD to ER stress (Figure 8C–E). We surmise that the eventual loss of EMDΔLEM results from translational inhibition resulting from ER stress (Harding et al., 1999) and degradation by alternative pathways. Consistent with the interpretation that the LEM domain mediates post-ER trafficking, co-incubation of EMDΔLEM-expressing cells with THG and BFA or Baf A1 each had no effect on protein levels or localization (Figure 8F–H). These results suggest that without the LEM domain, EMD does not access post-ER compartments. To directly evaluate this, we generated a glycosylation-reporting variant, EMDΔLEM-GFP*, with a glycosylation consensus site at the lumenal C terminus. In contrast to variants of EMD with an intact LEM domain, EMDΔLEM-GFP* accumulates only Endo H-sensitive modifications and remains equivalently Endo H-sensitive during ER stress and lysosome blockage (Figure 8I–J, red arrowheads). Altogether, these data indicate that a signal within emerin’s LEM domain enables selective export from the ER under stress conditions.

Discussion

In this work, we applied a dynamic proteomic strategy to define organelle-wide trends in protein turnover across the NE/ER membrane network in mammalian cells. While the INM is separated from the bulk ER by the selective barrier of the NPC, we observe no difference in global protein turnover rates between the ER and INM compartments or any correlation between INM protein size and turnover kinetics. This, along with specific visualization of mature INM proteins by RITE tagging and microscopy (Figure 2) and previous studies (Tsai et al., 2016), suggests that turnover of INM proteins can be effectively achieved in situ.

Moving forward with the rapidly turned over INM protein EMD as a model substrate for dissecting INM protein turnover, we identified an even less stable, EDMD-linked variant of EMD as an ideal substrate for sensitively probing INM protein turnover pathways. We noted that turnover of maturely folded EMD and EMDΔ95–99 exhibits proteasome dependence at the INM (Figure 2F–H; Figure 3A), while nascent EMDΔ95–99 accumulates in multiple cellular compartments when the proteasome is inhibited (Figure 3A, fourth panel). Taken together, these observations lead us to infer that mature EMD variants and potentially other INM proteins can be turned over in situ at the INM by a pathway that terminates in proteasomal degradation, while immature EMD variants (and potentially other INM proteins) are also subject to co-translational quality control that terminates in proteasomal degradation. As proteasomal inhibition and p97 inhibition each stabilize EMDΔ95–99 (Figure 3B), we expect that EMDΔ95–99 is an ERAD client under some conditions.

Surprisingly, however, we also find that EMD can be selectively shunted to an alternative turnover pathway under conditions of acute ER stress. This pathway is rapidly induced by ERAD blockage or by pharmacological induction of acute ER protein folding stress (Figure 3) and requires ER export (Figures 3 and 4). Notably, changes to EMDΔ95–99 localization and levels are apparent at a timescale shorter than the normal half-life of EMDΔ95–99, within 2–4 hr of ER stress induction. Based on the transient appearance of EMDΔ95–99 at the PM (Figure 6) and its accumulation in lysosomes (Figure 5), we conclude that EMD transits through the secretory pathway and is then internalized into lysosomes. While our data indicate that a significant proportion of EMD leaves the NE/ER during ER stress, we cannot rule out the possibility that ERAD-mediated degradation of some proportion of EMD takes place within the NE/ER network in parallel to the lysosome-mediated pathway that we have identified. Nonetheless, this dynamic and selective removal of an INM protein is quite surprising and is inconsistent with models of the INM as a terminal depot for its resident proteins.

Our findings have some intriguing parallels to the fate of a misfolded variant of the GPI-anchored prion protein, PrP, during ER stress (Satpute-Krishnan et al., 2014). PrP is normally targeted to the PM, but a misfolded variant is retained within the ER by persistent association with protein folding chaperones. Similarly to what we observe for an INM protein, ER stress induces the rapid export of misfolded PrP through the secretory pathway, followed by transit through the PM and internalization and delivery to lysosomes for degradation. This mode of clearance has been referred to as rapid ER stress-induced export, or RESET (Satpute-Krishnan et al., 2014).

There are several notable contrasts between PrP’s export from the peripheral ER and EMD’s export from the INM and ER. For instance, the topologies of PrP and EMD are quite disparate. As a GPI-anchored protein, misfolded PrP faces the lumen of the ER, and an interaction between PrP and Tmp21, a sorting adaptor for luminal proteins, controls RESET (Satpute-Krishnan et al., 2014). Misfolded PrP remains associated with additional luminal ER-derived proteins during its transit through the secretory pathway, and these associations appear to enable recognition of misfolded PrP at the cell surface for internalization (Zavodszky and Hegde, 2019). In contrast, EMD is a tail-anchored protein, and interactions mediated by EMD’s nucleoplasmic-facing LEM domain (Figure 8) control its stress-dependent clearance. We do not yet know whether EMD remains associated with other proteins as it transits through the secretory pathway, or what role those associations might play in targeting EMD for degradation.

PrP and EMD also exhibit distinct subcellular localization when not undergoing RESET. Misfolded PrP is retained in the ER network until RESET is initiated, while EMD is enriched in the INM and associated with the nuclear lamina. Importantly, EMD is small enough (~25 kDa) to diffuse freely across the NPC, meaning that it may release INM-localized binding partners and sample the ER with some frequency. This spatial separation between EMD’s normal site of enrichment and its site of ER export may explain the longer timescale of RESET for EMD (2–4 hr) compared to ER-localized misfolded PrP (~1 hr) (Satpute-Krishnan et al., 2014).

Finally, PrP and EMD variants exhibit clear differences in selectivity for the RESET pathway. Only misfolded, ER-retained mutants of PrP are subject to RESET. On the other hand, both wild type EMD (Figure 7) and a less stable disease-linked variant (EMDΔ95–99) are subject to stress-dependent clearance, although EMDΔ95–99 is more rapidly cleared from the NE and ER. Both EMD variants appear functional until ER stress is induced, as judged by their localization and affinity for the INM (Figure 3, Figure 2—figure supplement 1). This suggests that clearance of EMD from the NE/ER is not strictly contingent on protein misfolding.

We find that selective, stress dependent clearance of EMD depends on its 45-amino acid LEM domain. LEM domains bind dynamically to the small soluble protein BAF, which exists in both nuclear and cytoplasmic pools (Shimi et al., 2004). While glycosylation reporters indicate that EMD variants also exit the NE/ER with some frequency under homeostatic conditions (Figure 3H, Figure 7E–F), this is completely abolished by deletion of the LEM domain (Figure 8). One model that could explain the dichotomy between LEM-mediated BAF binding and LEM-mediated ER export is that BAF and ER export-promoting factor(s) bind competitively to the same surface of EMD’s LEM domain (Figure 9). It could be that acute ER stress is relayed to EMD via a structural reorganization or post-translational modification that disrupts the LEM:BAF interface. It is possible that this system could be used to rapidly remove EMD in response to ER stress and potentially other physiological stressors. This could in turn rapidly inhibit the normal functions of EMD at the INM, including participating in mechanosensitive signaling pathways (Guilluy et al., 2014) and contributing to the scaffolding of heterochromatic domains at the nuclear periphery (Demmerle et al., 2013). Overall, our findings indicate that the INM can be rapidly remodeled in response to environmental stimuli, and that the function of the INM protein EMD may be dynamically controlled by integration of environmental inputs via its LEM domain.

Competition model for emerin sorting via its LEM domain competitively binding to BAF or to the ER export machinery.
https://doi.org/10.7554/eLife.49796.020

Notably, muscular dystrophy and cardiomyopathy diseases are caused by loss-of-function mutations to EMD, many of which further destabilize the protein (Bonne and Quijano-Roy, 2013; Fairley et al., 1999). We find evidence that a muscular dystrophy-linked EMD variant (EMDΔ95–99) is more rapidly degraded under acute stress conditions, suggesting that an overzealous response to ER stress could contribute to the pathogenesis of EDMD. EMD is broadly expressed (Uhlen et al., 2015), but mutations predominantly affect muscle tissues. Intriguingly, skeletal muscle undergoes significant ER stress both during development and during normal function (Deldicque et al., 2012). We speculate that these features of muscle physiology may make muscle-localized EMD mutants especially vulnerable to ER stress-induced degradation.

Materials and methods

Key resources table
Reagent
type (species)
or resource
DesignationSource or
reference
IdentifiersAdditional
information
Gene (Mus musculus)emerinNCBI RefSeq NM_007927
Gene (Mus musculus)nurimNCBI RefSeq NM_134122
Gene (Mus musculus)Sun2NCBI RefSeq NM_001205346
Cell line (Mus musculus)C2C12ATCCCRL-1772
Cell line (Homo sapiens)U-2-OSATCCHTB-96
Recombinant DNA reagent (plasmid)pQCXIB vectorCampeau et al. (2009) AddgeneRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)Myc/FLAG RITE vectorToyama et al. (2019)Lentiviral contruct for stable expression of RITE-tagged protein
Recombinant DNA reagent (plasmid)pQCXIB emerin-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-D95-99-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-DLEM-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-GFP-SSNKTVDThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-Δ95–99-GFP-SSNKTVDThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-ΔLEM-GFP-SSNKTVDThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB Sun2-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB nurim-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)Emerin-RITEThis paperLentiviral contruct for stable expression of RITE-tagged protein
Recombinant DNA reagent (plasmid)Nurim-RITEThis paperLentiviral contruct for stable expression of RITE-tagged protein
Recombinant DNA reagent (plasmid)Emerin-Δ95–99-RITEThis paperLentiviral contruct for stable expression of RITE-tagged protein
AntibodyRabbit polyclonal anti-emerinSanta Cruz BiotechnologySc-15378WB (1:1000)
AntibodyGFPAbcamab290Ab uptake (1:500); WB (1:1000)
AntibodyMouse monoclonal anti-FLAGSigma-AldrichF1804IF (1:1000)
AntibodyMouse monoclonal anti-MycCell Signaling2233IF (1:1000); Ab uptake (1:500)
AntibodyMouse monoclonal anti-tubulinSigma-AldrichT5168WB (1:2500)
AntibodygiantinBioLegendPRB-114CIF (1:1000)
AntibodyLAMP1Abcamab24170IF(1:100)
OtherAlexa-647 WGALife TechnologiesW32466IF (5 ug/ml)
Commercial assay or kitPNGase FNEBP0704
Commercial assay or kitEndo HNEBP0702
Chemical compound, drugThapsigarginThermo FisherT7459Used at 100 nM
Chemical compound, drugMG132Cayman Chemical1211877-36-9Used at10 uM
Chemical compound, drugBafilomycin A1BioVioticaBVT-0252Used at100 nM
Chemical compound, drugBrefeldin ATocris1231Used at2.5 uM
Chemical compound, drugLeupeptinSigma-AldrichL5793Used at 125 uM
Chemical compound, drugcycloheximideSigma-AldrichC-7698Used at200 ug/ml
Other13C6-LysineCambridge IsotopesCLM-2247
Other13C6, 15N4-ArginineCambridge IsotopesCNLM-539
OtherLysine/arginine free DMEMThermo Fisher88364
OtherDialyzed fetal bovine serumThermo Fisher26400044
OtherHoechst stainMolecular ProbesH1399Used at 10 ug/ml
Recombinant DNA reagent (plasmid)UBE2G1 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGAAAGACAGCTGGCAGAACTCAATAGTGAAGCCACAGATGTATTGAGTTCTGCCAGCTGTCTTCTGCCTACTGCCTCGGA
Recombinant DNA reagent (plasmid)UBE2G2 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGAACCGGGAGCAGTTCTATAAGATAGTGAAGCCACAGATGTATCTTATAGAACTGCTCCCGGTCTGCCTACTGCCTCGGA
Recombinant DNA reagent (plasmid)UBE2J1 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGAAAGGTTGTCTACTTCACCAGATAGTGAAGCCACAGATGTATCTGGTGAAGTAGACAACCTTCTGCCTACTGCCTCGGA
Recombinant DNA reagent (plasmid)MARCH6 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGACTGGATCTTCATTCTTATTTATAGTGAAGCCACAGATGTATAAATAAGAATGAAGATCCAGCTGCCTACTGCCTCGGA
Software, algorithmFijihttps://fiji.sc/
Software, algorithmRStudiohttps://rstudio.com/

SILAC labeling

Request a detailed protocol

SILAC labeling was performed as a pulse-chase (Ong and Mann, 2006). Proliferating C2C12 mouse myoblasts were subcultured for > 5 population doublings in culture medium containing stable heavy isotopes of lysine and arginine (13C6-Lysine, 13C6, 15N4-Arginine) to completely label the cellular proteome. Cells were grown in SILAC-formulated DMEM lacking lysine and arginine and supplemented with 20% dialyzed FBS, penicillin/streptomycin, and SILAC amino acids. Complete label incorporation was verified by LC-MS/MS. Myoblasts were then grown to confluency and switched to differentiation medium containing heavy isotopes for 5 days to induce myotube differentiation. Differentiation medium contained SILAC DMEM, 2% dialyzed FBS, penicillin/streptomycin, and SILAC amino acids. Media was refreshed every other day. After differentiation, the mature myotube culture was switched to low serum differentiation medium containing the normal isotopes of lysine and arginine: 12C6-Lysine, 12C6, 14N4-Arginine for 1–3 days.

Crude nuclear extracts were prepared similarly to previous work (Buchwalter and Hetzer, 2017; Schirmer et al., 2003). Cells were harvested by scraping into PBS, then swollen in hypotonic lysis buffer (10 mM potassium acetate, 20 mM Tris acetate pH 7.5, 0.5 mM DTT, 1.5 mM MgCl2, and protease inhibitors), followed by mechanical lysis through a 25-gauge needle and syringe. The nuclei were pelleted and the supernatant (containing cytosol) was decanted. Nuclei were then resuspended in buffer containing 10 mM Tris pH 8.0, 10% sucrose, 1 mM DTT, 0.1 mM MgCl2, 20 ug/ml DNase I, and 1 ug/ml RNase I. After nuclease treatment, nuclei were layered on top of a 30% sucrose cushion and pelleted. Crude nuclei were then extracted in 10 mM Tris pH 8, 1% n-octyl glucoside, 400 mM NaCl, and 1 mM DTT, and extracts and pellets were prepared separately for liquid chromatography-mass spectrometry.

Lc-ms/MS

Request a detailed protocol

Samples were denatured in 8M urea/100 mM TEAB, pH 8.5; reduced with TCEP; alkylated with chloroacetamide; and digested overnight with trypsin. Digestion was quenched with 5% formic acid. Detergent was removed from pulse-labeled SILAC samples with SCX tips (EMD Millipore). Samples were run on a Thermo Orbitrap Fusion Tribrid MS/MS with CID fragmentation. The digest was injected directly onto a 30 cm, 75 um ID column packed with BEH 1.7 um C18 resin. Samples were separated at a flow rate of 200 nl/min on a nLC 1000. Buffer A and B were 0.1% formic acid in water and acetonitrile, respectively. A gradient of 1–25% B over 160 min, an increase to 35% B over 60 min, an increase to 90% B over another 10 min and a hold at 90%B for a final 10 min of washing was used for a total run time of 240 min. The column was re-equilibrated with 20 ul of buffer A prior to the injection of sample. Peptides were eluted directly from the tip of the column and nanosprayed into the mass spectrometer by application of 2.5 kV voltage at the back of the column. The Orbitrap Fusion was operated in data dependent mode. Full MS1 scans were collected in the Orbitrap at 120K resolution with a mass range of 400 to 1500 m/z and an AGC target of 4e. The cycle time was set to 3 s, and within this 3 s the most abundant ions per scan were selected for CID MS/MS in the ion trap with an AGC target of 1e and minimum intensity of 5000. Maximum fill times were set to 50 ms and 100 ms for MS and MS/MS scans, respectively. Quadrupole isolation at 1.6 m/z was used, monoisotopic precursor selection was enabled, charge states of 2–7 were selected and dynamic exclusion was used with an exclusion duration of 5 s.

Analysis of proteomic data

Request a detailed protocol

Peptide and protein identification, quantification, and analysis were performed with Integrated Proteomics Pipeline (IP2) (Integrated Proteomics Applications; www.integratedproteomics.com). Tandem mass spectra were extracted from raw files using RawConverter (He et al., 2015) and searched with ProLUCID (Xu et al., 2015) against the mouse UniProt database (ID). The search space included all fully tryptic and half-tryptic peptide candidates. Carbamidomethylation on cysteine was allowed as a static modification. Data were searched with 50 ppm precursor ion tolerance and 600 ppm fragment ion tolerance. Data were filtered to 10 ppm precursor ion tolerance post-search. Identified proteins were filtered using DTASelect (Tabb et al., 2002) and utilizing a target-decoy database strategy to control the false discovery rate to 1% at the protein level.

Census2 (Park et al., 2014) was used for quantitative analysis of SILAC-labeled peptides. Peptides were subjected to stringent quality control criteria before inclusion in half-life determination analyses. Firstly, any peptide with a profile score < 0.8 was discarded. Secondly, peptides were filtered based on the extent of correlation between the heavy and light chromatograms, which is quantified as a regression score in Census. Peptides with extreme area ratios (less than 0.111 or greater than 9) were retained only if their regression score was > 0. Peptides with intermediate area ratios (between 0.111 and 9) were retained only if their regression score was > 0.8.

Half-life calculation

Request a detailed protocol

For estimation of protein half-lives, we restricted our analysis to peptides that were detected in at least three timepoints. 1685 proteins passed this criterion with at least one peptide; individual peptides and protein-level data are reported in Tables S1 and S2, respectively. Area ratio values were transformed into % old values using the following equation:

%old=100(1/(1+AR))

And individual peptides were fit to a line corresponding to the following equation:

Ln(%old)=kt+a

Individual peptide fits with r2 > 0.8 and values of k < 0 were retained for protein-level estimation of half-life. The slope of the fit for all peptides detected were averaged to produce an average value and standard deviation at the protein level. These average slope values were converted to half-life estimates using the equation below.

T1/2=ln(2)/k

These values are reported in Table S3 for 1677 proteins. While calculated half-lives range from ~0.33 days to ~30 days, we note that half-lives at either extreme should be considered rough estimates of protein stability. For illustration, we have included example fits for proteins in Figure S1 with predicted half-lives of 0.5 day, 1 day, 2 days, 4 days, 8 days, and 16 days. Linear regression predicts half-life well under conditions where a line can be fitted with high fidelity and a non-zero slope is detectable. We note the good performance and clear distinctions in slope for proteins with predicted half-lives ranging from 1 to 8 days, and observed more frequent deviations in linearity at the low extreme (predicted T1/2 < 1 day) and slopes approaching zero at the high extreme (predicted T1/2 > 8 days). We expect that these factors limit the precision of half-life determination below 1 day and above 8 days from a 3 day timecourse. Shorter or longer timecourses would be required to investigate turnover at these timescales.

The TMHMM server (Krogh et al., 2001) was used to define the positions of transmembrane domains in INM proteins and infer extraluminal domain sequences.

Plasmid construction

Request a detailed protocol

All emerin constructs are based on the emerin sequence from mouse (Uniprot ID O08579); all nurim constructs based on the nurim sequence from mouse (Uniprot ID Q8VC65); and all Sun2 constructs based on the Sun2 sequence from mouse (Uniprot ID Q8BJS4). Emerin, Sun2, and nurim were each C-terminally tagged with GFP by stitching PCR (Heckman and Pease, 2007), where each open reading frame was amplified with the start codon included and the stop codon omitted, while GFP was amplified with its start codon omitted and stop codon included. Primersets were designed with overhangs including homology between each ORF and GFP, so that a second round of PCR with flanking primers and the first two PCR products used as templates generates an ORF-GFP fusion. EMDΔ95–99 was generated by Quickchange mutagenesis of the emerin-GFP sequence followed by sequence verification. EMDΔLEM-GFP was constructed by stitching PCR of emerin nucleic acid sequence 136–777 corresponding to residues 46–258 of emerin protein with the stop codon omitted. A new ATG start codon was introduced by PCR, and the C-terminal GFP tag introduced by stitching PCR. All ORFs were introduced into the pQCXIB vector (Campeau et al., 2009) for retroviral delivery and constitutive expression under a CMV promoter by Gateway cloning.

INM-RITE tag plasmids were constructed as described in Toyama et al. (2019). ORFs of interest were introduced into the FLAG/myc-RITE or myc/FLAG-RITE plasmid backbones, then the entire ORF-RITE construct was amplified and recombined into a pDONR207 Gateway entry vector, followed by recombination into the pQCXIB retroviral vector for constitutive mammalian expression.

Glycosylation reporter plasmids were constructed by introducing a 21 base-pair sequence encoding the glycosylation acceptor site SSNKTVD within a 3’ PCR primer for amplification of EMD-WT-GFP, EMDΔYEESY-GFP, and EMDΔLEM-GFP. The resulting PCR product was inserted into the pQCXIB vector by Gateway cloning. Sequence verified clones were used for stable cell line generation.

UBE2G1, UBE2G2, UBE2J1, and MARCH6 miR-E inducible RNAi plasmids were constructed as described in Fellmann et al. (2013). Validated shRNA sequences with the highest score for targeting mouse UBE2G1, UBE2G2, UBE2J1, and MARCH6 were selected from the shERWOOD database (www.sherwood.cshl.edu), and ~100 bp oligonucleotides with the corresponding sequence were synthesized. This sequence was amplified by PCR using degenerate primers with XhoI and EcoRI restriction sites. The PCR was digested with XhoI and EcoRI, gel purified, and ligated into the LT3GEPIR lentiviral vector for doxycycline-inducible RNAi expression with GFP reporter fluorescence. The LT3GEPIR vector was the kind gift of Johannes Zuber.

Cell line generation

Request a detailed protocol

GFP-tagged cell lines were generated in C2C12 mouse myoblasts. Low-passage C2C12 cells were obtained from ATCC, and identity was validated by a functional assay: cells were grown to confluency, switched to low serum medium for several days, and evaluated for the formation of multinucleated myotubes. Parallel cultures of C2C12 cells were infected with virus encoding GFP fusion proteins. 293 T cells were transfected with delivery vectors and viral packaging vectors for retroviral or lentiviral production. Conditioned media were collected 48–72 hr after transfection and applied to low-passage C2C12 cells in the presence of polybrene. Integrated clones were selected using the relevant antibiotic selections for each vector backbone. Fluorescent cell populations were isolated by FACS. The resulting stable GFP-expressing C2C12 cell lines were tested to verify the absence of mycoplasma contamination. miR-E RNAi cell lines were generated in U2OS cells. U2OS cells were obtained from ATCC and were periodically tested for mycoplasma contamination. EMDΔ95–99-GFP was introduced by retroviral infection and FACS sorted as described above. miR-E RNAi expression vectors were then introduced into these stable cell lines by lentiviral infection.

RITE tag switching

Request a detailed protocol

RITE tag switching experiments were performed in quiescent C2C12 cells stably expressing RITE-tagged INM proteins. C2C12s were grown in Ibidi chamber slides and induced to enter quiescence as previously described (Zhang et al., 2010) by growing C2C12 myoblasts to ~ 75% confluence, washing twice in warm PBS, and switching to quiescent medium (DMEM without methionine, 2% FBS, and pen-strep). Cells were maintained in quiescent medium for 3 days with media changes every other day before initiation of RITE timecourses. To induce tag exchange, concentrated adenovirus expressing Cre recombinase was added to the culture medium. Tag switching was initiated at the indicated timepoints such that the entire slide containing all time points could be fixed, stained, imaged, and quantified in parallel. To quantify loss of ‘old’ RITE-tagged protein over time, intensity per unit area of the ‘old’ tag was quantified across all conditions. Background measurements were taken from cell-free regions of the imaging dish and subtracted from all signals as a background correction. All signals were then normalized to the day 0 timepoint (no tag switch).

Antibody uptake assays

Request a detailed protocol

For antibody uptake assays, cells were pre-treated with drugs for the indicated times, then incubated in medium containing antibody, drug, and 125 μM leupeptin for 1 hr before fixation in paraformaldehyde and staining. Cells were stained with Alexa Fluor-conjugated secondary antibody to visualize internalized primary antibody:GFP conjugates. Cell surfaces were stained with Alexa Fluor-conjugated WGA; the WGA signal was used as a guide for outlining individual cells and quantifying internalized antibody fluorescence.

Preparation of protein lysates and western blotting

Request a detailed protocol

Cells were washed in PBS, then lysed directly in plates in PBS lysis buffer (PBS supplemented with 1% Triton-X-100, 0.1% SDS, and protease inhibitors). Cells were further lysed by passage through a 25-gauge needle. Protein concentrations were quantified by BCA assay, and ~20 ug of total protein was loaded per lane of 4–12% gradient gels (Invitrogen). Blots were incubated with emerin antibody (1:1000) or alpha-tubulin antibody (1:5000) followed by IR Dye-conjugated secondary antibodies (1:5000) for multiplexed detection on the Odyssey imaging system.

Microscopy and image analysis

Request a detailed protocol

Cells were grown in Ibidi culture chambers, treated as indicated, and fixed in 4% PFA for 5 min, then permeabilized in IF buffer (PBS, 0.1% Tx100, 0.02% SDS, 10 mg/ml BSA) before staining with Hoechst DNA dye. Wells were rinsed in PBS before imaging on a Zeiss LSM 710 scanning confocal microscope with a 63 × 1.4 NA objective. Images shown are single confocal slices. All image quantification was performed on maximum intensity projections of z-series with ImageJ. To quantify NE-localized protein levels, the DNA stain was used as a mask, and all GFP fluorescence within that mask was quantified.

For lysosomal staining, cells were prepared as described (Castellano et al., 2017) with the following modifications. Following fixation in 4% PFA for 5 min, cells were rinsed in PBS, then permeabilized in freshly prepared 0.1% digitonin in PBS for 10 min at 4C. Cells were rinsed again in PBS, then blocked in 2% goat serum in PBS for 30 min before staining with LAMP1 antibody (1:100 in 2% goat serum) for 1–2 hr at RT. Cells were rinsed again in PBS, then stained with Alexa Fluor-conjugated secondary antibody and Hoechst DNA stain for 1 hr at RT.

Data availability

Raw and analyzed mass spectrometric data and associated scripts and tables have been deposited in Dryad. Analyzed data are also included with the manuscript as supplementary tables.

The following data sets were generated
    1. Buchwalter A
    2. Schulte R
    3. Tsai H
    4. Capitanio J
    5. Hetzer MW
    (2019) Dryad Digital Repository
    Data from: Selective clearance of the inner nuclear membrane protein emerin by vesicular transport during ER stress.
    https://doi.org/10.5061/dryad.n0r525h

References

    1. Bulbarelli A
    2. Sprocati T
    3. Barberi M
    4. Pedrazzini E
    5. Borgese N
    (2002)
    Trafficking of tail-anchored proteins: transport from the endoplasmic reticulum to the plasma membrane and sorting between surface domains in polarised epithelial cells
    Journal of Cell Science 115:1689–1702.
    1. Fairley EA
    2. Kendrick-Jones J
    3. Ellis JA
    (1999)
    The Emery-Dreifuss muscular dystrophy phenotype arises from aberrant targeting and binding of emerin at the inner nuclear membrane
    Journal of Cell Science 112 ( Pt 15:2571–2582.
    1. Klionsky DJ
    2. Abdelmohsen K
    3. Abe A
    4. Abedin MJ
    5. Abeliovich H
    6. Acevedo Arozena A
    7. Adachi H
    8. Adams CM
    9. Adams PD
    10. Adeli K
    11. Adhihetty PJ
    12. Adler SG
    13. Agam G
    14. Agarwal R
    15. Aghi MK
    16. Agnello M
    17. Agostinis P
    18. Aguilar PV
    19. Aguirre-Ghiso J
    20. Airoldi EM
    21. Ait-Si-Ali S
    22. Akematsu T
    23. Akporiaye ET
    24. Al-Rubeai M
    25. Albaiceta GM
    26. Albanese C
    27. Albani D
    28. Albert ML
    29. Aldudo J
    30. Algül H
    31. Alirezaei M
    32. Alloza I
    33. Almasan A
    34. Almonte-Beceril M
    35. Alnemri ES
    36. Alonso C
    37. Altan-Bonnet N
    38. Altieri DC
    39. Alvarez S
    40. Alvarez-Erviti L
    41. Alves S
    42. Amadoro G
    43. Amano A
    44. Amantini C
    45. Ambrosio S
    46. Amelio I
    47. Amer AO
    48. Amessou M
    49. Amon A
    50. An Z
    51. Anania FA
    52. Andersen SU
    53. Andley UP
    54. Andreadi CK
    55. Andrieu-Abadie N
    56. Anel A
    57. Ann DK
    58. Anoopkumar-Dukie S
    59. Antonioli M
    60. Aoki H
    61. Apostolova N
    62. Aquila S
    63. Aquilano K
    64. Araki K
    65. Arama E
    66. Aranda A
    67. Araya J
    68. Arcaro A
    69. Arias E
    70. Arimoto H
    71. Ariosa AR
    72. Armstrong JL
    73. Arnould T
    74. Arsov I
    75. Asanuma K
    76. Askanas V
    77. Asselin E
    78. Atarashi R
    79. Atherton SS
    80. Atkin JD
    81. Attardi LD
    82. Auberger P
    83. Auburger G
    84. Aurelian L
    85. Autelli R
    86. Avagliano L
    87. Avantaggiati ML
    88. Avrahami L
    89. Awale S
    90. Azad N
    91. Bachetti T
    92. Backer JM
    93. Bae D-H
    94. Bae J-sung
    95. Bae O-N
    96. Bae SH
    97. Baehrecke EH
    98. Baek S-H
    99. Baghdiguian S
    100. Bagniewska-Zadworna A
    101. Bai H
    102. Bai J
    103. Bai X-Y
    104. Bailly Y
    105. Balaji KN
    106. Balduini W
    107. Ballabio A
    108. Balzan R
    109. Banerjee R
    110. Bánhegyi G
    111. Bao H
    112. Barbeau B
    113. Barrachina MD
    114. Barreiro E
    115. Bartel B
    116. Bartolomé A
    117. Bassham DC
    118. Bassi MT
    119. Bast RC
    120. Basu A
    121. Batista MT
    122. Batoko H
    123. Battino M
    124. Bauckman K
    125. Baumgarner BL
    126. Bayer KU
    127. Beale R
    128. Beaulieu J-F
    129. Beck GR
    130. Becker C
    131. Beckham JD
    132. Bédard P-A
    133. Bednarski PJ
    134. Begley TJ
    135. Behl C
    136. Behrends C
    137. Behrens GMN
    138. Behrns KE
    139. Bejarano E
    140. Belaid A
    141. Belleudi F
    142. Bénard G
    143. Berchem G
    144. Bergamaschi D
    145. Bergami M
    146. Berkhout B
    147. Berliocchi L
    148. Bernard A
    149. Bernard M
    150. Bernassola F
    151. Bertolotti A
    152. Bess AS
    153. Besteiro S
    154. Bettuzzi S
    155. Bhalla S
    156. Bhattacharyya S
    157. Bhutia SK
    158. Biagosch C
    159. Bianchi MW
    160. Biard-Piechaczyk M
    161. Billes V
    162. Bincoletto C
    163. Bingol B
    164. Bird SW
    165. Bitoun M
    166. Bjedov I
    167. Blackstone C
    168. Blanc L
    169. Blanco GA
    170. Blomhoff HK
    171. Boada-Romero E
    172. Böckler S
    173. Boes M
    174. Boesze-Battaglia K
    175. Boise LH
    176. Bolino A
    177. Boman A
    178. Bonaldo P
    179. Bordi M
    180. Bosch J
    181. Botana LM
    182. Botti J
    183. Bou G
    184. Bouché M
    185. Bouchecareilh M
    186. Boucher M-J
    187. Boulton ME
    188. Bouret SG
    189. Boya P
    190. Boyer-Guittaut M
    191. Bozhkov PV
    192. Brady N
    193. Braga VMM
    194. Brancolini C
    195. Braus GH
    196. Bravo-San Pedro JM
    197. Brennan LA
    198. Bresnick EH
    199. Brest P
    200. Bridges D
    201. Bringer M-A
    202. Brini M
    203. Brito GC
    204. Brodin B
    205. Brookes PS
    206. Brown EJ
    207. Brown K
    208. Broxmeyer HE
    209. Bruhat A
    210. Brum PC
    211. Brumell JH
    212. Brunetti-Pierri N
    213. Bryson-Richardson RJ
    214. Buch S
    215. Buchan AM
    216. Budak H
    217. Bulavin DV
    218. Bultman SJ
    219. Bultynck G
    220. Bumbasirevic V
    221. Burelle Y
    222. Burke RE
    223. Burmeister M
    224. Bütikofer P
    225. Caberlotto L
    226. Cadwell K
    227. Cahova M
    228. Cai D
    229. Cai J
    230. Cai Q
    231. Calatayud S
    232. Camougrand N
    233. Campanella M
    234. Campbell GR
    235. Campbell M
    236. Campello S
    237. Candau R
    238. Caniggia I
    239. Cantoni L
    240. Cao L
    241. Caplan AB
    242. Caraglia M
    243. Cardinali C
    244. Cardoso SM
    245. Carew JS
    246. Carleton LA
    247. Carlin CR
    248. Carloni S
    249. Carlsson SR
    250. Carmona-Gutierrez D
    251. Carneiro LAM
    252. Carnevali O
    253. Carra S
    254. Carrier A
    255. Carroll B
    256. Casas C
    257. Casas J
    258. Cassinelli G
    259. Castets P
    260. Castro-Obregon S
    261. Cavallini G
    262. Ceccherini I
    263. Cecconi F
    264. Cederbaum AI
    265. Ceña V
    266. Cenci S
    267. Cerella C
    268. Cervia D
    269. Cetrullo S
    270. Chaachouay H
    271. Chae H-J
    272. Chagin AS
    273. Chai C-Y
    274. Chakrabarti G
    275. Chamilos G
    276. Chan EYW
    277. Chan MTV
    278. Chandra D
    279. Chandra P
    280. Chang C-P
    281. Chang RC-C
    282. Chang TY
    283. Chatham JC
    284. Chatterjee S
    285. Chauhan S
    286. Che Y
    287. Cheetham ME
    288. Cheluvappa R
    289. Chen C-J
    290. Chen G
    291. Chen G-C
    292. Chen G
    293. Chen H
    294. Chen JW
    295. Chen J-K
    296. Chen M
    297. Chen M
    298. Chen P
    299. Chen Q
    300. Chen Q
    301. Chen S-D
    302. Chen S
    303. Chen SS-L
    304. Chen W
    305. Chen W-J
    306. Chen WQ
    307. Chen W
    308. Chen X
    309. Chen Y-H
    310. Chen Y-G
    311. Chen Y
    312. Chen Y
    313. Chen Y
    314. Chen Y-J
    315. Chen Y-Q
    316. Chen Y
    317. Chen Z
    318. Chen Z
    319. Cheng A
    320. Cheng CHK
    321. Cheng H
    322. Cheong H
    323. Cherry S
    324. Chesney J
    325. Cheung CHA
    326. Chevet E
    327. Chi HC
    328. Chi S-G
    329. Chiacchiera F
    330. Chiang H-L
    331. Chiarelli R
    332. Chiariello M
    333. Chieppa M
    334. Chin L-S
    335. Chiong M
    336. Chiu GNC
    337. Cho D-H
    338. Cho S-G
    339. Cho WC
    340. Cho Y-Y
    341. Cho Y-S
    342. Choi AMK
    343. Choi E-J
    344. Choi E-K
    345. Choi J
    346. Choi ME
    347. Choi S-I
    348. Chou T-F
    349. Chouaib S
    350. Choubey D
    351. Choubey V
    352. Chow K-C
    353. Chowdhury K
    354. Chu CT
    355. Chuang T-H
    356. Chun T
    357. Chung H
    358. Chung T
    359. Chung Y-L
    360. Chwae Y-J
    361. Cianfanelli V
    362. Ciarcia R
    363. Ciechomska IA
    364. Ciriolo MR
    365. Cirone M
    366. Claerhout S
    367. Clague MJ
    368. Clària J
    369. Clarke PGH
    370. Clarke R
    371. Clementi E
    372. Cleyrat C
    373. Cnop M
    374. Coccia EM
    375. Cocco T
    376. Codogno P
    377. Coers J
    378. Cohen EEW
    379. Colecchia D
    380. Coletto L
    381. Coll NS
    382. Colucci-Guyon E
    383. Comincini S
    384. Condello M
    385. Cook KL
    386. Coombs GH
    387. Cooper CD
    388. Cooper JM
    389. Coppens I
    390. Corasaniti MT
    391. Corazzari M
    392. Corbalan R
    393. Corcelle-Termeau E
    394. Cordero MD
    395. Corral-Ramos C
    396. Corti O
    397. Cossarizza A
    398. Costelli P
    399. Costes S
    400. Cotman SL
    401. Coto-Montes A
    402. Cottet S
    403. Couve E
    404. Covey LR
    405. Cowart LA
    406. Cox JS
    407. Coxon FP
    408. Coyne CB
    409. Cragg MS
    410. Craven RJ
    411. Crepaldi T
    412. Crespo JL
    413. Criollo A
    414. Crippa V
    415. Cruz MT
    416. Cuervo AM
    417. Cuezva JM
    418. Cui T
    419. Cutillas PR
    420. Czaja MJ
    421. Czyzyk-Krzeska MF
    422. Dagda RK
    423. Dahmen U
    424. Dai C
    425. Dai W
    426. Dai Y
    427. Dalby KN
    428. Dalla Valle L
    429. Dalmasso G
    430. D'Amelio M
    431. Damme M
    432. Darfeuille-Michaud A
    433. Dargemont C
    434. Darley-Usmar VM
    435. Dasarathy S
    436. Dasgupta B
    437. Dash S
    438. Dass CR
    439. Davey HM
    440. Davids LM
    441. Dávila D
    442. Davis RJ
    443. Dawson TM
    444. Dawson VL
    445. Daza P
    446. de Belleroche J
    447. de Figueiredo P
    448. de Figueiredo RCBQ
    449. de la Fuente J
    450. De Martino L
    451. De Matteis A
    452. De Meyer GRY
    453. De Milito A
    454. De Santi M
    455. de Souza W
    456. De Tata V
    457. De Zio D
    458. Debnath J
    459. Dechant R
    460. Decuypere J-P
    461. Deegan S
    462. Dehay B
    463. Del Bello B
    464. Del Re DP
    465. Delage-Mourroux R
    466. Delbridge LMD
    467. Deldicque L
    468. Delorme-Axford E
    469. Deng Y
    470. Dengjel J
    471. Denizot M
    472. Dent P
    473. Der CJ
    474. Deretic V
    475. Derrien B
    476. Deutsch E
    477. Devarenne TP
    478. Devenish RJ
    479. Di Bartolomeo S
    480. Di Daniele N
    481. Di Domenico F
    482. Di Nardo A
    483. Di Paola S
    484. Di Pietro A
    485. Di Renzo L
    486. DiAntonio A
    487. Díaz-Araya G
    488. Díaz-Laviada I
    489. Diaz-Meco MT
    490. Diaz-Nido J
    491. Dickey CA
    492. Dickson RC
    493. Diederich M
    494. Digard P
    495. Dikic I
    496. Dinesh-Kumar SP
    497. Ding C
    498. Ding W-X
    499. Ding Z
    500. Dini L
    501. Distler JHW
    502. Diwan A
    503. Djavaheri-Mergny M
    504. Dmytruk K
    505. Dobson RCJ
    506. Doetsch V
    507. Dokladny K
    508. Dokudovskaya S
    509. Donadelli M
    510. Dong XC
    511. Dong X
    512. Dong Z
    513. Donohue TM
    514. Doran KS
    515. D'Orazi G
    516. Dorn GW
    517. Dosenko V
    518. Dridi S
    519. Drucker L
    520. Du J
    521. Du L-L
    522. Du L
    523. du Toit A
    524. Dua P
    525. Duan L
    526. Duann P
    527. Dubey VK
    528. Duchen MR
    529. Duchosal MA
    530. Duez H
    531. Dugail I
    532. Dumit VI
    533. Duncan MC
    534. Dunlop EA
    535. Dunn WA
    536. Dupont N
    537. Dupuis L
    538. Durán RV
    539. Durcan TM
    540. Duvezin-Caubet S
    541. Duvvuri U
    542. Eapen V
    543. Ebrahimi-Fakhari D
    544. Echard A
    545. Eckhart L
    546. Edelstein CL
    547. Edinger AL
    548. Eichinger L
    549. Eisenberg T
    550. Eisenberg-Lerner A
    551. Eissa NT
    552. El-Deiry WS
    553. El-Khoury V
    554. Elazar Z
    555. Eldar-Finkelman H
    556. Elliott CJH
    557. Emanuele E
    558. Emmenegger U
    559. Engedal N
    560. Engelbrecht A-M
    561. Engelender S
    562. Enserink JM
    563. Erdmann R
    564. Erenpreisa J
    565. Eri R
    566. Eriksen JL
    567. Erman A
    568. Escalante R
    569. Eskelinen E-L
    570. Espert L
    571. Esteban-Martínez L
    572. Evans TJ
    573. Fabri M
    574. Fabrias G
    575. Fabrizi C
    576. Facchiano A
    577. Færgeman NJ
    578. Faggioni A
    579. Fairlie WD
    580. Fan C
    581. Fan D
    582. Fan J
    583. Fang S
    584. Fanto M
    585. Fanzani A
    586. Farkas T
    587. Faure M
    588. Favier FB
    589. Fearnhead H
    590. Federici M
    591. Fei E
    592. Felizardo TC
    593. Feng H
    594. Feng Y
    595. Feng Y
    596. Ferguson TA
    597. Fernández Álvaro F
    598. Fernandez-Barrena MG
    599. Fernandez-Checa JC
    600. Fernández-López A
    601. Fernandez-Zapico ME
    602. Feron O
    603. Ferraro E
    604. Ferreira-Halder CV
    605. Fesus L
    606. Feuer R
    607. Fiesel FC
    608. Filippi-Chiela EC
    609. Filomeni G
    610. Fimia GM
    611. Fingert JH
    612. Finkbeiner S
    613. Finkel T
    614. Fiorito F
    615. Fisher PB
    616. Flajolet M
    617. Flamigni F
    618. Florey O
    619. Florio S
    620. Floto RA
    621. Folini M
    622. Follo C
    623. Fon EA
    624. Fornai F
    625. Fortunato F
    626. Fraldi A
    627. Franco R
    628. Francois A
    629. François A
    630. Frankel LB
    631. Fraser IDC
    632. Frey N
    633. Freyssenet DG
    634. Frezza C
    635. Friedman SL
    636. Frigo DE
    637. Fu D
    638. Fuentes JM
    639. Fueyo J
    640. Fujitani Y
    641. Fujiwara Y
    642. Fujiya M
    643. Fukuda M
    644. Fulda S
    645. Fusco C
    646. Gabryel B
    647. Gaestel M
    648. Gailly P
    649. Gajewska M
    650. Galadari S
    651. Galili G
    652. Galindo I
    653. Galindo MF
    654. Galliciotti G
    655. Galluzzi L
    656. Galluzzi L
    657. Galy V
    658. Gammoh N
    659. Gandy S
    660. Ganesan AK
    661. Ganesan S
    662. Ganley IG
    663. Gannagé M
    664. Gao F-B
    665. Gao F
    666. Gao J-X
    667. García Nannig L
    668. García Véscovi E
    669. Garcia-Macía M
    670. Garcia-Ruiz C
    671. Garg AD
    672. Garg PK
    673. Gargini R
    674. Gassen NC
    675. Gatica D
    676. Gatti E
    677. Gavard J
    678. Gavathiotis E
    679. Ge L
    680. Ge P
    681. Ge S
    682. Gean P-W
    683. Gelmetti V
    684. Genazzani AA
    685. Geng J
    686. Genschik P
    687. Gerner L
    688. Gestwicki JE
    689. Gewirtz DA
    690. Ghavami S
    691. Ghigo E
    692. Ghosh D
    693. Giammarioli AM
    694. Giampieri F
    695. Giampietri C
    696. Giatromanolaki A
    697. Gibbings DJ
    698. Gibellini L
    699. Gibson SB
    700. Ginet V
    701. Giordano A
    702. Giorgini F
    703. Giovannetti E
    704. Girardin SE
    705. Gispert S
    706. Giuliano S
    707. Gladson CL
    708. Glavic A
    709. Gleave M
    710. Godefroy N
    711. Gogal RM
    712. Gokulan K
    713. Goldman GH
    714. Goletti D
    715. Goligorsky MS
    716. Gomes AV
    717. Gomes LC
    718. Gomez H
    719. Gomez-Manzano C
    720. Gómez-Sánchez R
    721. Gonçalves DAP
    722. Goncu E
    723. Gong Q
    724. Gongora C
    725. Gonzalez CB
    726. Gonzalez-Alegre P
    727. Gonzalez-Cabo P
    728. González-Polo RA
    729. Goping IS
    730. Gorbea C
    731. Gorbunov NV
    732. Goring DR
    733. Gorman AM
    734. Gorski SM
    735. Goruppi S
    736. Goto-Yamada S
    737. Gotor C
    738. Gottlieb RA
    739. Gozes I
    740. Gozuacik D
    741. Graba Y
    742. Graef M
    743. Granato GE
    744. Grant GD
    745. Grant S
    746. Gravina GL
    747. Green DR
    748. Greenhough A
    749. Greenwood MT
    750. Grimaldi B
    751. Gros F
    752. Grose C
    753. Groulx J-F
    754. Gruber F
    755. Grumati P
    756. Grune T
    757. Guan J-L
    758. Guan K-L
    759. Guerra B
    760. Guillen C
    761. Gulshan K
    762. Gunst J
    763. Guo C
    764. Guo L
    765. Guo M
    766. Guo W
    767. Guo X-G
    768. Gust AA
    769. Gustafsson Åsa B
    770. Gutierrez E
    771. Gutierrez MG
    772. Gwak H-S
    773. Haas A
    774. Haber JE
    775. Hadano S
    776. Hagedorn M
    777. Hahn DR
    778. Halayko AJ
    779. Hamacher-Brady A
    780. Hamada K
    781. Hamai A
    782. Hamann A
    783. Hamasaki M
    784. Hamer I
    785. Hamid Q
    786. Hammond EM
    787. Han F
    788. Han W
    789. Handa JT
    790. Hanover JA
    791. Hansen M
    792. Harada M
    793. Harhaji-Trajkovic L
    794. Harper JW
    795. Harrath AH
    796. Harris AL
    797. Harris J
    798. Hasler U
    799. Hasselblatt P
    800. Hasui K
    801. Hawley RG
    802. Hawley TS
    803. He C
    804. He CY
    805. He F
    806. He G
    807. He R-R
    808. He X-H
    809. He Y-W
    810. He Y-Y
    811. Heath JK
    812. Hébert M-J
    813. Heinzen RA
    814. Helgason GV
    815. Hensel M
    816. Henske EP
    817. Her C
    818. Herman PK
    819. Hernández A
    820. Hernandez C
    821. Hernández-Tiedra S
    822. Hetz C
    823. Hiesinger PR
    824. Higaki K
    825. Hilfiker S
    826. Hill BG
    827. Hill JA
    828. Hill WD
    829. Hino K
    830. Hofius D
    831. Hofman P
    832. Höglinger GU
    833. Höhfeld J
    834. Holz MK
    835. Hong Y
    836. Hood DA
    837. Hoozemans JJM
    838. Hoppe T
    839. Hsu C
    840. Hsu C-Y
    841. Hsu L-C
    842. Hu D
    843. Hu G
    844. Hu H-M
    845. Hu H
    846. Hu MC
    847. Hu Y-C
    848. Hu Z-W
    849. Hua F
    850. Hua Y
    851. Huang C
    852. Huang H-L
    853. Huang K-H
    854. Huang K-Y
    855. Huang S
    856. Huang S
    857. Huang W-P
    858. Huang Y-R
    859. Huang Y
    860. Huang Y
    861. Huber TB
    862. Huebbe P
    863. Huh W-K
    864. Hulmi JJ
    865. Hur GM
    866. Hurley JH
    867. Husak Z
    868. Hussain SNA
    869. Hussain S
    870. Hwang JJ
    871. Hwang S
    872. Hwang TIS
    873. Ichihara A
    874. Imai Y
    875. Imbriano C
    876. Inomata M
    877. Into T
    878. Iovane V
    879. Iovanna JL
    880. Iozzo RV
    881. Ip NY
    882. Irazoqui JE
    883. Iribarren P
    884. Isaka Y
    885. Isakovic AJ
    886. Ischiropoulos H
    887. Isenberg JS
    888. Ishaq M
    889. Ishida H
    890. Ishii I
    891. Ishmael JE
    892. Isidoro C
    893. Isobe K-ichi
    894. Isono E
    895. Issazadeh-Navikas S
    896. Itahana K
    897. Itakura E
    898. Ivanov AI
    899. Iyer AKV
    900. Izquierdo JM
    901. Izumi Y
    902. Izzo V
    903. Jäättelä M
    904. Jaber N
    905. Jackson DJ
    906. Jackson WT
    907. Jacob TG
    908. Jacques TS
    909. Jagannath C
    910. Jain A
    911. Jana NR
    912. Jang BK
    913. Jani A
    914. Janji B
    915. Jannig PR
    916. Jansson PJ
    917. Jean S
    918. Jendrach M
    919. Jeon J-H
    920. Jessen N
    921. Jeung E-B
    922. Jia K
    923. Jia L
    924. Jiang H
    925. Jiang H
    926. Jiang L
    927. Jiang T
    928. Jiang X
    929. Jiang X
    930. Jiang X
    931. Jiang Y
    932. Jiang Y
    933. Jiménez A
    934. Jin C
    935. Jin H
    936. Jin L
    937. Jin M
    938. Jin S
    939. Jinwal UK
    940. Jo E-K
    941. Johansen T
    942. Johnson DE
    943. Johnson GVW
    944. Johnson JD
    945. Jonasch E
    946. Jones C
    947. Joosten LAB
    948. Jordan J
    949. Joseph A-M
    950. Joseph B
    951. Joubert AM
    952. Ju D
    953. Ju J
    954. Juan H-F
    955. Juenemann K
    956. Juhász G
    957. Jung HS
    958. Jung JU
    959. Jung Y-K
    960. Jungbluth H
    961. Justice MJ
    962. Jutten B
    963. Kaakoush NO
    964. Kaarniranta K
    965. Kaasik A
    966. Kabuta T
    967. Kaeffer B
    968. Kågedal K
    969. Kahana A
    970. Kajimura S
    971. Kakhlon O
    972. Kalia M
    973. Kalvakolanu DV
    974. Kamada Y
    975. Kambas K
    976. Kaminskyy VO
    977. Kampinga HH
    978. Kandouz M
    979. Kang C
    980. Kang R
    981. Kang T-C
    982. Kanki T
    983. Kanneganti T-D
    984. Kanno H
    985. Kanthasamy AG
    986. Kantorow M
    987. Kaparakis-Liaskos M
    988. Kapuy O
    989. Karantza V
    990. Karim MR
    991. Karmakar P
    992. Kaser A
    993. Kaushik S
    994. Kawula T
    995. Kaynar AM
    996. Ke P-Y
    997. Ke Z-J
    998. Kehrl JH
    999. Keller KE
    1000. Kemper JK
    1001. Kenworthy AK
    1002. Kepp O
    1003. Kern A
    1004. Kesari S
    1005. Kessel D
    1006. Ketteler R
    1007. Kettelhut IdoC
    1008. Khambu B
    1009. Khan MM
    1010. Khandelwal VKM
    1011. Khare S
    1012. Kiang JG
    1013. Kiger AA
    1014. Kihara A
    1015. Kim AL
    1016. Kim CH
    1017. Kim DR
    1018. Kim D-H
    1019. Kim EK
    1020. Kim HY
    1021. Kim H-R
    1022. Kim J-S
    1023. Kim JH
    1024. Kim JC
    1025. Kim JH
    1026. Kim KW
    1027. Kim MD
    1028. Kim M-M
    1029. Kim PK
    1030. Kim SW
    1031. Kim S-Y
    1032. Kim Y-S
    1033. Kim Y
    1034. Kimchi A
    1035. Kimmelman AC
    1036. Kimura T
    1037. King JS
    1038. Kirkegaard K
    1039. Kirkin V
    1040. Kirshenbaum LA
    1041. Kishi S
    1042. Kitajima Y
    1043. Kitamoto K
    1044. Kitaoka Y
    1045. Kitazato K
    1046. Kley RA
    1047. Klimecki WT
    1048. Klinkenberg M
    1049. Klucken J
    1050. Knævelsrud H
    1051. Knecht E
    1052. Knuppertz L
    1053. Ko J-L
    1054. Kobayashi S
    1055. Koch JC
    1056. Koechlin-Ramonatxo C
    1057. Koenig U
    1058. Koh YH
    1059. Köhler K
    1060. Kohlwein SD
    1061. Koike M
    1062. Komatsu M
    1063. Kominami E
    1064. Kong D
    1065. Kong HJ
    1066. Konstantakou EG
    1067. Kopp BT
    1068. Korcsmaros T
    1069. Korhonen L
    1070. Korolchuk VI
    1071. Koshkina NV
    1072. Kou Y
    1073. Koukourakis MI
    1074. Koumenis C
    1075. Kovács AL
    1076. Kovács T
    1077. Kovacs WJ
    1078. Koya D
    1079. Kraft C
    1080. Krainc D
    1081. Kramer H
    1082. Kravic-Stevovic T
    1083. Krek W
    1084. Kretz-Remy C
    1085. Krick R
    1086. Krishnamurthy M
    1087. Kriston-Vizi J
    1088. Kroemer G
    1089. Kruer MC
    1090. Kruger R
    1091. Ktistakis NT
    1092. Kuchitsu K
    1093. Kuhn C
    1094. Kumar AP
    1095. Kumar A
    1096. Kumar A
    1097. Kumar D
    1098. Kumar D
    1099. Kumar R
    1100. Kumar S
    1101. Kundu M
    1102. Kung H-J
    1103. Kuno A
    1104. Kuo S-H
    1105. Kuret J
    1106. Kurz T
    1107. Kwok T
    1108. Kwon TK
    1109. Kwon YT
    1110. Kyrmizi I
    1111. La Spada AR
    1112. Lafont F
    1113. Lahm T
    1114. Lakkaraju A
    1115. Lam T
    1116. Lamark T
    1117. Lancel S
    1118. Landowski TH
    1119. Lane DJR
    1120. Lane JD
    1121. Lanzi C
    1122. Lapaquette P
    1123. Lapierre LR
    1124. Laporte J
    1125. Laukkarinen J
    1126. Laurie GW
    1127. Lavandero S
    1128. Lavie L
    1129. LaVoie MJ
    1130. Law BYK
    1131. Law HK-wai
    1132. Law KB
    1133. Layfield R
    1134. Lazo PA
    1135. Le Cam L
    1136. Le Roch KG
    1137. Le Stunff H
    1138. Leardkamolkarn V
    1139. Lecuit M
    1140. Lee B-H
    1141. Lee C-H
    1142. Lee EF
    1143. Lee GM
    1144. Lee H-J
    1145. Lee H
    1146. Lee JK
    1147. Lee J
    1148. Lee J-hyun
    1149. Lee JH
    1150. Lee M
    1151. Lee M-S
    1152. Lee PJ
    1153. Lee SW
    1154. Lee S-J
    1155. Lee S-J
    1156. Lee SY
    1157. Lee SH
    1158. Lee SS
    1159. Lee S-J
    1160. Lee S
    1161. Lee Y-R
    1162. Lee YJ
    1163. Lee YH
    1164. Leeuwenburgh C
    1165. Lefort S
    1166. Legouis R
    1167. Lei J
    1168. Lei Q-Y
    1169. Leib DA
    1170. Leibowitz G
    1171. Lekli I
    1172. Lemaire SD
    1173. Lemasters JJ
    1174. Lemberg MK
    1175. Lemoine A
    1176. Leng S
    1177. Lenz G
    1178. Lenzi P
    1179. Lerman LO
    1180. Lettieri Barbato D
    1181. Leu JI-J
    1182. Leung HY
    1183. Levine B
    1184. Lewis PA
    1185. Lezoualc'h F
    1186. Li C
    1187. Li F
    1188. Li F-J
    1189. Li J
    1190. Li K
    1191. Li L
    1192. Li M
    1193. Li M
    1194. Li Q
    1195. Li R
    1196. Li S
    1197. Li W
    1198. Li W
    1199. Li X
    1200. Li Y
    1201. Lian J
    1202. Liang C
    1203. Liang Q
    1204. Liao Y
    1205. Liberal J
    1206. Liberski PP
    1207. Lie P
    1208. Lieberman AP
    1209. Lim HJ
    1210. Lim K-L
    1211. Lim K
    1212. Lima RT
    1213. Lin C-S
    1214. Lin C-F
    1215. Lin F
    1216. Lin F
    1217. Lin F-C
    1218. Lin K
    1219. Lin K-H
    1220. Lin P-H
    1221. Lin T
    1222. Lin W-W
    1223. Lin Y-S
    1224. Lin Y
    1225. Linden R
    1226. Lindholm D
    1227. Lindqvist LM
    1228. Lingor P
    1229. Linkermann A
    1230. Liotta LA
    1231. Lipinski MM
    1232. Lira VA
    1233. Lisanti MP
    1234. Liton PB
    1235. Liu B
    1236. Liu C
    1237. Liu C-F
    1238. Liu F
    1239. Liu H-J
    1240. Liu J
    1241. Liu J-J
    1242. Liu J-L
    1243. Liu K
    1244. Liu L
    1245. Liu L
    1246. Liu Q
    1247. Liu R-Y
    1248. Liu S
    1249. Liu S
    1250. Liu W
    1251. Liu X-D
    1252. Liu X
    1253. Liu X-H
    1254. Liu X
    1255. Liu X
    1256. Liu X
    1257. Liu Y
    1258. Liu Y
    1259. Liu Z
    1260. Liu Z
    1261. Liuzzi JP
    1262. Lizard G
    1263. Ljujic M
    1264. Lodhi IJ
    1265. Logue SE
    1266. Lokeshwar BL
    1267. Long YC
    1268. Lonial S
    1269. Loos B
    1270. López-Otín C
    1271. López-Vicario C
    1272. Lorente M
    1273. Lorenzi PL
    1274. Lõrincz P
    1275. Los M
    1276. Lotze MT
    1277. Lovat PE
    1278. Lu B
    1279. Lu B
    1280. Lu J
    1281. Lu Q
    1282. Lu S-M
    1283. Lu S
    1284. Lu Y
    1285. Luciano F
    1286. Luckhart S
    1287. Lucocq JM
    1288. Ludovico P
    1289. Lugea A
    1290. Lukacs NW
    1291. Lum JJ
    1292. Lund AH
    1293. Luo H
    1294. Luo J
    1295. Luo S
    1296. Luparello C
    1297. Lyons T
    1298. Ma J
    1299. Ma Y
    1300. Ma Y
    1301. Ma Z
    1302. Machado J
    1303. Machado-Santelli GM
    1304. Macian F
    1305. MacIntosh GC
    1306. MacKeigan JP
    1307. Macleod KF
    1308. MacMicking JD
    1309. MacMillan-Crow LA
    1310. Madeo F
    1311. Madesh M
    1312. Madrigal-Matute J
    1313. Maeda A
    1314. Maeda T
    1315. Maegawa G
    1316. Maellaro E
    1317. Maes H
    1318. Magariños M
    1319. Maiese K
    1320. Maiti TK
    1321. Maiuri L
    1322. Maiuri MC
    1323. Maki CG
    1324. Malli R
    1325. Malorni W
    1326. Maloyan A
    1327. Mami-Chouaib F
    1328. Man N
    1329. Mancias JD
    1330. Mandelkow E-M
    1331. Mandell MA
    1332. Manfredi AA
    1333. Manié SN
    1334. Manzoni C
    1335. Mao K
    1336. Mao Z
    1337. Mao Z-W
    1338. Marambaud P
    1339. Marconi AM
    1340. Marelja Z
    1341. Marfe G
    1342. Margeta M
    1343. Margittai E
    1344. Mari M
    1345. Mariani FV
    1346. Marin C
    1347. Marinelli S
    1348. Mariño G
    1349. Markovic I
    1350. Marquez R
    1351. Martelli AM
    1352. Martens S
    1353. Martin KR
    1354. Martin SJ
    1355. Martin S
    1356. Martin-Acebes MA
    1357. Martín-Sanz P
    1358. Martinand-Mari C
    1359. Martinet W
    1360. Martinez J
    1361. Martinez-Lopez N
    1362. Martinez-Outschoorn U
    1363. Martínez-Velázquez M
    1364. Martinez-Vicente M
    1365. Martins WK
    1366. Mashima H
    1367. Mastrianni JA
    1368. Matarese G
    1369. Matarrese P
    1370. Mateo R
    1371. Matoba S
    1372. Matsumoto N
    1373. Matsushita T
    1374. Matsuura A
    1375. Matsuzawa T
    1376. Mattson MP
    1377. Matus S
    1378. Maugeri N
    1379. Mauvezin C
    1380. Mayer A
    1381. Maysinger D
    1382. Mazzolini GD
    1383. McBrayer MK
    1384. McCall K
    1385. McCormick C
    1386. McInerney GM
    1387. McIver SC
    1388. McKenna S
    1389. McMahon JJ
    1390. McNeish IA
    1391. Mechta-Grigoriou F
    1392. Medema JP
    1393. Medina DL
    1394. Megyeri K
    1395. Mehrpour M
    1396. Mehta JL
    1397. Mei Y
    1398. Meier U-C
    1399. Meijer AJ
    1400. Meléndez A
    1401. Melino G
    1402. Melino S
    1403. de Melo EJT
    1404. Mena MA
    1405. Meneghini MD
    1406. Menendez JA
    1407. Menezes R
    1408. Meng L
    1409. Meng L-hua
    1410. Meng S
    1411. Menghini R
    1412. Menko AS
    1413. Menna-Barreto RFS
    1414. Menon MB
    1415. Meraz-Ríos MA
    1416. Merla G
    1417. Merlini L
    1418. Merlot AM
    1419. Meryk A
    1420. Meschini S
    1421. Meyer JN
    1422. Mi M-tian
    1423. Miao C-Y
    1424. Micale L
    1425. Michaeli S
    1426. Michiels C
    1427. Migliaccio AR
    1428. Mihailidou AS
    1429. Mijaljica D
    1430. Mikoshiba K
    1431. Milan E
    1432. Miller-Fleming L
    1433. Mills GB
    1434. Mills IG
    1435. Minakaki G
    1436. Minassian BA
    1437. Ming X-F
    1438. Minibayeva F
    1439. Minina EA
    1440. Mintern JD
    1441. Minucci S
    1442. Miranda-Vizuete A
    1443. Mitchell CH
    1444. Miyamoto S
    1445. Miyazawa K
    1446. Mizushima N
    1447. Mnich K
    1448. Mograbi B
    1449. Mohseni S
    1450. Moita LF
    1451. Molinari M
    1452. Molinari M
    1453. Møller AB
    1454. Mollereau B
    1455. Mollinedo F
    1456. Mongillo M
    1457. Monick MM
    1458. Montagnaro S
    1459. Montell C
    1460. Moore DJ
    1461. Moore MN
    1462. Mora-Rodriguez R
    1463. Moreira PI
    1464. Morel E
    1465. Morelli MB
    1466. Moreno S
    1467. Morgan MJ
    1468. Moris A
    1469. Moriyasu Y
    1470. Morrison JL
    1471. Morrison LA
    1472. Morselli E
    1473. Moscat J
    1474. Moseley PL
    1475. Mostowy S
    1476. Motori E
    1477. Mottet D
    1478. Mottram JC
    1479. Moussa CE-H
    1480. Mpakou VE
    1481. Mukhtar H
    1482. Mulcahy Levy JM
    1483. Muller S
    1484. Muñoz-Moreno R
    1485. Muñoz-Pinedo C
    1486. Münz C
    1487. Murphy ME
    1488. Murray JT
    1489. Murthy A
    1490. Mysorekar IU
    1491. Nabi IR
    1492. Nabissi M
    1493. Nader GA
    1494. Nagahara Y
    1495. Nagai Y
    1496. Nagata K
    1497. Nagelkerke A
    1498. Nagy P
    1499. Naidu SR
    1500. Nair S
    1501. Nakano H
    1502. Nakatogawa H
    1503. Nanjundan M
    1504. Napolitano G
    1505. Naqvi NI
    1506. Nardacci R
    1507. Narendra DP
    1508. Narita M
    1509. Nascimbeni AC
    1510. Natarajan R
    1511. Navegantes LC
    1512. Nawrocki ST
    1513. Nazarko TY
    1514. Nazarko VY
    1515. Neill T
    1516. Neri LM
    1517. Netea MG
    1518. Netea-Maier RT
    1519. Neves BM
    1520. Ney PA
    1521. Nezis IP
    1522. Nguyen HTT
    1523. Nguyen HP
    1524. Nicot A-S
    1525. Nilsen H
    1526. Nilsson P
    1527. Nishimura M
    1528. Nishino I
    1529. Niso-Santano M
    1530. Niu H
    1531. Nixon RA
    1532. Njar VCO
    1533. Noda T
    1534. Noegel AA
    1535. Nolte EM
    1536. Norberg E
    1537. Norga KK
    1538. Noureini SK
    1539. Notomi S
    1540. Notterpek L
    1541. Nowikovsky K
    1542. Nukina N
    1543. Nürnberger T
    1544. O'Donnell VB
    1545. O'Donovan T
    1546. O'Dwyer PJ
    1547. Oehme I
    1548. Oeste CL
    1549. Ogawa M
    1550. Ogretmen B
    1551. Ogura Y
    1552. Oh YJ
    1553. Ohmuraya M
    1554. Ohshima T
    1555. Ojha R
    1556. Okamoto K
    1557. Okazaki T
    1558. Oliver FJ
    1559. Ollinger K
    1560. Olsson S
    1561. Orban DP
    1562. Ordonez P
    1563. Orhon I
    1564. Orosz L
    1565. O'Rourke EJ
    1566. Orozco H
    1567. Ortega AL
    1568. Ortona E
    1569. Osellame LD
    1570. Oshima J
    1571. Oshima S
    1572. Osiewacz HD
    1573. Otomo T
    1574. Otsu K
    1575. Ou J-hsiungJ
    1576. Outeiro TF
    1577. Ouyang D-yun
    1578. Ouyang H
    1579. Overholtzer M
    1580. Ozbun MA
    1581. Ozdinler PH
    1582. Ozpolat B
    1583. Pacelli C
    1584. Paganetti P
    1585. Page G
    1586. Pages G
    1587. Pagnini U
    1588. Pajak B
    1589. Pak SC
    1590. Pakos-Zebrucka K
    1591. Pakpour N
    1592. Palková Z
    1593. Palladino F
    1594. Pallauf K
    1595. Pallet N
    1596. Palmieri M
    1597. Paludan SR
    1598. Palumbo C
    1599. Palumbo S
    1600. Pampliega O
    1601. Pan H
    1602. Pan W
    1603. Panaretakis T
    1604. Pandey A
    1605. Pantazopoulou A
    1606. Papackova Z
    1607. Papademetrio DL
    1608. Papassideri I
    1609. Papini A
    1610. Parajuli N
    1611. Pardo J
    1612. Parekh VV
    1613. Parenti G
    1614. Park J-I
    1615. Park J
    1616. Park OK
    1617. Parker R
    1618. Parlato R
    1619. Parys JB
    1620. Parzych KR
    1621. Pasquet J-M
    1622. Pasquier B
    1623. Pasumarthi KBS
    1624. Patschan D
    1625. Patterson C
    1626. Pattingre S
    1627. Pattison S
    1628. Pause A
    1629. Pavenstädt H
    1630. Pavone F
    1631. Pedrozo Z
    1632. Peña FJ
    1633. Peñalva MA
    1634. Pende M
    1635. Peng J
    1636. Penna F
    1637. Penninger JM
    1638. Pensalfini A
    1639. Pepe S
    1640. Pereira GJS
    1641. Pereira PC
    1642. Pérez-de la Cruz V
    1643. Pérez-Pérez ME
    1644. Pérez-Rodríguez D
    1645. Pérez-Sala D
    1646. Perier C
    1647. Perl A
    1648. Perlmutter DH
    1649. Perrotta I
    1650. Pervaiz S
    1651. Pesonen M
    1652. Pessin JE
    1653. Peters GJ
    1654. Petersen M
    1655. Petrache I
    1656. Petrof BJ
    1657. Petrovski G
    1658. Phang JM
    1659. Piacentini M
    1660. Pierdominici M
    1661. Pierre P
    1662. Pierrefite-Carle V
    1663. Pietrocola F
    1664. Pimentel-Muiños FX
    1665. Pinar M
    1666. Pineda B
    1667. Pinkas-Kramarski R
    1668. Pinti M
    1669. Pinton P
    1670. Piperdi B
    1671. Piret JM
    1672. Platanias LC
    1673. Platta HW
    1674. Plowey ED
    1675. Pöggeler S
    1676. Poirot M
    1677. Polčic P
    1678. Poletti A
    1679. Poon AH
    1680. Popelka H
    1681. Popova B
    1682. Poprawa I
    1683. Poulose SM
    1684. Poulton J
    1685. Powers SK
    1686. Powers T
    1687. Pozuelo-Rubio M
    1688. Prak K
    1689. Prange R
    1690. Prescott M
    1691. Priault M
    1692. Prince S
    1693. Proia RL
    1694. Proikas-Cezanne T
    1695. Prokisch H
    1696. Promponas VJ
    1697. Przyklenk K
    1698. Puertollano R
    1699. Pugazhenthi S
    1700. Puglielli L
    1701. Pujol A
    1702. Puyal J
    1703. Pyeon D
    1704. Qi X
    1705. Qian W-bin
    1706. Qin Z-H
    1707. Qiu Y
    1708. Qu Z
    1709. Quadrilatero J
    1710. Quinn F
    1711. Raben N
    1712. Rabinowich H
    1713. Radogna F
    1714. Ragusa MJ
    1715. Rahmani M
    1716. Raina K
    1717. Ramanadham S
    1718. Ramesh R
    1719. Rami A
    1720. Randall-Demllo S
    1721. Randow F
    1722. Rao H
    1723. Rao VA
    1724. Rasmussen BB
    1725. Rasse TM
    1726. Ratovitski EA
    1727. Rautou P-E
    1728. Ray SK
    1729. Razani B
    1730. Reed BH
    1731. Reggiori F
    1732. Rehm M
    1733. Reichert AS
    1734. Rein T
    1735. Reiner DJ
    1736. Reits E
    1737. Ren J
    1738. Ren X
    1739. Renna M
    1740. Reusch JEB
    1741. Revuelta JL
    1742. Reyes L
    1743. Rezaie AR
    1744. Richards RI
    1745. Richardson DR
    1746. Richetta C
    1747. Riehle MA
    1748. Rihn BH
    1749. Rikihisa Y
    1750. Riley BE
    1751. Rimbach G
    1752. Rippo MR
    1753. Ritis K
    1754. Rizzi F
    1755. Rizzo E
    1756. Roach PJ
    1757. Robbins J
    1758. Roberge M
    1759. Roca G
    1760. Roccheri MC
    1761. Rocha S
    1762. Rodrigues CMP
    1763. Rodríguez CI
    1764. de Cordoba SR
    1765. Rodriguez-Muela N
    1766. Roelofs J
    1767. Rogov VV
    1768. Rohn TT
    1769. Rohrer B
    1770. Romanelli D
    1771. Romani L
    1772. Romano PS
    1773. Roncero MIG
    1774. Rosa JL
    1775. Rosello A
    1776. Rosen KV
    1777. Rosenstiel P
    1778. Rost-Roszkowska M
    1779. Roth KA
    1780. Roué G
    1781. Rouis M
    1782. Rouschop KM
    1783. Ruan DT
    1784. Ruano D
    1785. Rubinsztein DC
    1786. Rucker EB
    1787. Rudich A
    1788. Rudolf E
    1789. Rudolf R
    1790. Ruegg MA
    1791. Ruiz-Roldan C
    1792. Ruparelia AA
    1793. Rusmini P
    1794. Russ DW
    1795. Russo GL
    1796. Russo G
    1797. Russo R
    1798. Rusten TE
    1799. Ryabovol V
    1800. Ryan KM
    1801. Ryter SW
    1802. Sabatini DM
    1803. Sacher M
    1804. Sachse C
    1805. Sack MN
    1806. Sadoshima J
    1807. Saftig P
    1808. Sagi-Eisenberg R
    1809. Sahni S
    1810. Saikumar P
    1811. Saito T
    1812. Saitoh T
    1813. Sakakura K
    1814. Sakoh-Nakatogawa M
    1815. Sakuraba Y
    1816. Salazar-Roa M
    1817. Salomoni P
    1818. Saluja AK
    1819. Salvaterra PM
    1820. Salvioli R
    1821. Samali A
    1822. Sanchez AMJ
    1823. Sánchez-Alcázar JA
    1824. Sanchez-Prieto R
    1825. Sandri M
    1826. Sanjuan MA
    1827. Santaguida S
    1828. Santambrogio L
    1829. Santoni G
    1830. dos Santos CN
    1831. Saran S
    1832. Sardiello M
    1833. Sargent G
    1834. Sarkar P
    1835. Sarkar S
    1836. Sarrias MR
    1837. Sarwal MM
    1838. Sasakawa C
    1839. Sasaki M
    1840. Sass M
    1841. Sato K
    1842. Sato M
    1843. Satriano J
    1844. Savaraj N
    1845. Saveljeva S
    1846. Schaefer L
    1847. Schaible UE
    1848. Scharl M
    1849. Schatzl HM
    1850. Schekman R
    1851. Scheper W
    1852. Schiavi A
    1853. Schipper HM
    1854. Schmeisser H
    1855. Schmidt J
    1856. Schmitz I
    1857. Schneider BE
    1858. Schneider EM
    1859. Schneider JL
    1860. Schon EA
    1861. Schönenberger MJ
    1862. Schönthal AH
    1863. Schorderet DF
    1864. Schröder B
    1865. Schuck S
    1866. Schulze RJ
    1867. Schwarten M
    1868. Schwarz TL
    1869. Sciarretta S
    1870. Scotto K
    1871. Scovassi AI
    1872. Screaton RA
    1873. Screen M
    1874. Seca H
    1875. Sedej S
    1876. Segatori L
    1877. Segev N
    1878. Seglen PO
    1879. Seguí-Simarro JM
    1880. Segura-Aguilar J
    1881. Seki E
    1882. Seiliez I
    1883. Sell C
    1884. Semenkovich CF
    1885. Semenza GL
    1886. Sen U
    1887. Serra AL
    1888. Serrano-Puebla A
    1889. Sesaki H
    1890. Setoguchi T
    1891. Settembre C
    1892. Shacka JJ
    1893. Shajahan-Haq AN
    1894. Shapiro IM
    1895. Sharma S
    1896. She H
    1897. Shen C-KJ
    1898. Shen C-C
    1899. Shen H-M
    1900. Shen S
    1901. Shen W
    1902. Sheng R
    1903. Sheng X
    1904. Sheng Z-H
    1905. Shepherd TG
    1906. Shi J
    1907. Shi Q
    1908. Shi Q
    1909. Shi Y
    1910. Shibutani S
    1911. Shibuya K
    1912. Shidoji Y
    1913. Shieh J-J
    1914. Shih C-M
    1915. Shimada Y
    1916. Shimizu S
    1917. Shin DW
    1918. Shinohara ML
    1919. Shintani M
    1920. Shintani T
    1921. Shioi T
    1922. Shirabe K
    1923. Shiri-Sverdlov R
    1924. Shirihai O
    1925. Shore GC
    1926. Shu C-W
    1927. Shukla D
    1928. Sibirny AA
    1929. Sica V
    1930. Sigurdson CJ
    1931. Sigurdsson EM
    1932. Sijwali PS
    1933. Sikorska B
    1934. Silveira WA
    1935. Silvente-Poirot S
    1936. Silverman GA
    1937. Simak J
    1938. Simmet T
    1939. Simon AK
    1940. Simon H-U
    1941. Simone C
    1942. Simons M
    1943. Simonsen A
    1944. Singh R
    1945. Singh SV
    1946. Singh SK
    1947. Sinha D
    1948. Sinha S
    1949. Sinicrope FA
    1950. Sirko A
    1951. Sirohi K
    1952. Sishi BJN
    1953. Sittler A
    1954. Siu PM
    1955. Sivridis E
    1956. Skwarska A
    1957. Slack R
    1958. Slaninová I
    1959. Slavov N
    1960. Smaili SS
    1961. Smalley KSM
    1962. Smith DR
    1963. Soenen SJ
    1964. Soleimanpour SA
    1965. Solhaug A
    1966. Somasundaram K
    1967. Son JH
    1968. Sonawane A
    1969. Song C
    1970. Song F
    1971. Song HK
    1972. Song J-X
    1973. Song W
    1974. Soo KY
    1975. Sood AK
    1976. Soong TW
    1977. Soontornniyomkij V
    1978. Sorice M
    1979. Sotgia F
    1980. Soto-Pantoja DR
    1981. Sotthibundhu A
    1982. Sousa MJ
    1983. Spaink HP
    1984. Span PN
    1985. Spang A
    1986. Sparks JD
    1987. Speck PG
    1988. Spector SA
    1989. Spies CD
    1990. Springer W
    1991. Clair DS
    1992. Stacchiotti A
    1993. Staels B
    1994. Stang MT
    1995. Starczynowski DT
    1996. Starokadomskyy P
    1997. Steegborn C
    1998. Steele JW
    1999. Stefanis L
    2000. Steffan J
    2001. Stellrecht CM
    2002. Stenmark H
    2003. Stepkowski TM
    2004. Stern ST
    2005. Stevens C
    2006. Stockwell BR
    2007. Stoka V
    2008. Storchova Z
    2009. Stork B
    2010. Stratoulias V
    2011. Stravopodis DJ
    2012. Strnad P
    2013. Strohecker AM
    2014. Ström A-L
    2015. Stromhaug P
    2016. Stulik J
    2017. Su Y-X
    2018. Su Z
    2019. Subauste CS
    2020. Subramaniam S
    2021. Sue CM
    2022. Suh SW
    2023. Sui X
    2024. Sukseree S
    2025. Sulzer D
    2026. Sun F-L
    2027. Sun J
    2028. Sun J
    2029. Sun S-Y
    2030. Sun Y
    2031. Sun Y
    2032. Sun Y
    2033. Sundaramoorthy V
    2034. Sung J
    2035. Suzuki H
    2036. Suzuki K
    2037. Suzuki N
    2038. Suzuki T
    2039. Suzuki YJ
    2040. Swanson MS
    2041. Swanton C
    2042. Swärd K
    2043. Swarup G
    2044. Sweeney ST
    2045. Sylvester PW
    2046. Szatmari Z
    2047. Szegezdi E
    2048. Szlosarek PW
    2049. Taegtmeyer H
    2050. Tafani M
    2051. Taillebourg E
    2052. Tait SWG
    2053. Takacs-Vellai K
    2054. Takahashi Y
    2055. Takáts S
    2056. Takemura G
    2057. Takigawa N
    2058. Talbot NJ
    2059. Tamagno E
    2060. Tamburini J
    2061. Tan C-P
    2062. Tan L
    2063. Tan ML
    2064. Tan M
    2065. Tan Y-J
    2066. Tanaka K
    2067. Tanaka M
    2068. Tang D
    2069. Tang D
    2070. Tang G
    2071. Tanida I
    2072. Tanji K
    2073. Tannous BA
    2074. Tapia JA
    2075. Tasset-Cuevas I
    2076. Tatar M
    2077. Tavassoly I
    2078. Tavernarakis N
    2079. Taylor A
    2080. Taylor GS
    2081. Taylor GA
    2082. Taylor JP
    2083. Taylor MJ
    2084. Tchetina EV
    2085. Tee AR
    2086. Teixeira-Clerc F
    2087. Telang S
    2088. Tencomnao T
    2089. Teng B-B
    2090. Teng R-J
    2091. Terro F
    2092. Tettamanti G
    2093. Theiss AL
    2094. Theron AE
    2095. Thomas KJ
    2096. Thomé MP
    2097. Thomes PG
    2098. Thorburn A
    2099. Thorner J
    2100. Thum T
    2101. Thumm M
    2102. Thurston TLM
    2103. Tian L
    2104. Till A
    2105. Ting JP-yun
    2106. Titorenko VI
    2107. Toker L
    2108. Toldo S
    2109. Tooze SA
    2110. Topisirovic I
    2111. Torgersen ML
    2112. Torosantucci L
    2113. Torriglia A
    2114. Torrisi MR
    2115. Tournier C
    2116. Towns R
    2117. Trajkovic V
    2118. Travassos LH
    2119. Triola G
    2120. Tripathi DN
    2121. Trisciuoglio D
    2122. Troncoso R
    2123. Trougakos IP
    2124. Truttmann AC
    2125. Tsai K-J
    2126. Tschan MP
    2127. Tseng Y-H
    2128. Tsukuba T
    2129. Tsung A
    2130. Tsvetkov AS
    2131. Tu S
    2132. Tuan H-Y
    2133. Tucci M
    2134. Tumbarello DA
    2135. Turk B
    2136. Turk V
    2137. Turner RFB
    2138. Tveita AA
    2139. Tyagi SC
    2140. Ubukata M
    2141. Uchiyama Y
    2142. Udelnow A
    2143. Ueno T
    2144. Umekawa M
    2145. Umemiya-Shirafuji R
    2146. Underwood BR
    2147. Ungermann C
    2148. Ureshino RP
    2149. Ushioda R
    2150. Uversky VN
    2151. Uzcátegui NL
    2152. Vaccari T
    2153. Vaccaro MI
    2154. Váchová L
    2155. Vakifahmetoglu-Norberg H
    2156. Valdor R
    2157. Valente EM
    2158. Vallette F
    2159. Valverde AM
    2160. Van den Berghe G
    2161. Van Den Bosch L
    2162. van den Brink GR
    2163. van der Goot FG
    2164. van der Klei IJ
    2165. van der Laan LJW
    2166. van Doorn WG
    2167. van Egmond M
    2168. van Golen KL
    2169. Van Kaer L
    2170. van Lookeren Campagne M
    2171. Vandenabeele P
    2172. Vandenberghe W
    2173. Vanhorebeek I
    2174. Varela-Nieto I
    2175. Vasconcelos MH
    2176. Vasko R
    2177. Vavvas DG
    2178. Vega-Naredo I
    2179. Velasco G
    2180. Velentzas AD
    2181. Velentzas PD
    2182. Vellai T
    2183. Vellenga E
    2184. Vendelbo MH
    2185. Venkatachalam K
    2186. Ventura N
    2187. Ventura S
    2188. Veras PST
    2189. Verdier M
    2190. Vertessy BG
    2191. Viale A
    2192. Vidal M
    2193. Vieira HLA
    2194. Vierstra RD
    2195. Vigneswaran N
    2196. Vij N
    2197. Vila M
    2198. Villar M
    2199. Villar VH
    2200. Villarroya J
    2201. Vindis C
    2202. Viola G
    2203. Viscomi MT
    2204. Vitale G
    2205. Vogl DT
    2206. Voitsekhovskaja OV
    2207. von Haefen C
    2208. von Schwarzenberg K
    2209. Voth DE
    2210. Vouret-Craviari V
    2211. Vuori K
    2212. Vyas JM
    2213. Waeber C
    2214. Walker CL
    2215. Walker MJ
    2216. Walter J
    2217. Wan L
    2218. Wan X
    2219. Wang B
    2220. Wang C
    2221. Wang C-Y
    2222. Wang C
    2223. Wang C
    2224. Wang C
    2225. Wang D
    2226. Wang F
    2227. Wang F
    2228. Wang G
    2229. Wang H-jie
    2230. Wang H
    2231. Wang H-G
    2232. Wang H
    2233. Wang H-D
    2234. Wang J
    2235. Wang J
    2236. Wang M
    2237. Wang M-Q
    2238. Wang P-Y
    2239. Wang P
    2240. Wang RC
    2241. Wang S
    2242. Wang T-F
    2243. Wang X
    2244. Wang X-jia
    2245. Wang X-W
    2246. Wang X
    2247. Wang X
    2248. Wang Y
    2249. Wang Y
    2250. Wang Y
    2251. Wang Y-J
    2252. Wang Y
    2253. Wang Y
    2254. Wang YT
    2255. Wang Y
    2256. Wang Z-N
    2257. Wappner P
    2258. Ward C
    2259. Ward DM
    2260. Warnes G
    2261. Watada H
    2262. Watanabe Y
    2263. Watase K
    2264. Weaver TE
    2265. Weekes CD
    2266. Wei J
    2267. Weide T
    2268. Weihl CC
    2269. Weindl G
    2270. Weis SN
    2271. Wen L
    2272. Wen X
    2273. Wen Y
    2274. Westermann B
    2275. Weyand CM
    2276. White AR
    2277. White E
    2278. Whitton JL
    2279. Whitworth AJ
    2280. Wiels J
    2281. Wild F
    2282. Wildenberg ME
    2283. Wileman T
    2284. Wilkinson DS
    2285. Wilkinson S
    2286. Willbold D
    2287. Williams C
    2288. Williams K
    2289. Williamson PR
    2290. Winklhofer KF
    2291. Witkin SS
    2292. Wohlgemuth SE
    2293. Wollert T
    2294. Wolvetang EJ
    2295. Wong E
    2296. Wong GW
    2297. Wong RW
    2298. Wong VKW
    2299. Woodcock EA
    2300. Wright KL
    2301. Wu C
    2302. Wu D
    2303. Wu GS
    2304. Wu J
    2305. Wu J
    2306. Wu M
    2307. Wu M
    2308. Wu S
    2309. Wu WKK
    2310. Wu Y
    2311. Wu Z
    2312. Xavier CPR
    2313. Xavier RJ
    2314. Xia G-X
    2315. Xia T
    2316. Xia W
    2317. Xia Y
    2318. Xiao H
    2319. Xiao J
    2320. Xiao S
    2321. Xiao W
    2322. Xie C-M
    2323. Xie Z
    2324. Xie Z
    2325. Xilouri M
    2326. Xiong Y
    2327. Xu C
    2328. Xu C
    2329. Xu F
    2330. Xu H
    2331. Xu H
    2332. Xu J
    2333. Xu J
    2334. Xu J
    2335. Xu L
    2336. Xu X
    2337. Xu Y
    2338. Xu Y
    2339. Xu Z-X
    2340. Xu Z
    2341. Xue Y
    2342. Yamada T
    2343. Yamamoto A
    2344. Yamanaka K
    2345. Yamashina S
    2346. Yamashiro S
    2347. Yan B
    2348. Yan B
    2349. Yan X
    2350. Yan Z
    2351. Yanagi Y
    2352. Yang D-S
    2353. Yang J-M
    2354. Yang L
    2355. Yang M
    2356. Yang P-M
    2357. Yang P
    2358. Yang Q
    2359. Yang W
    2360. Yang WY
    2361. Yang X
    2362. Yang Y
    2363. Yang Y
    2364. Yang Z
    2365. Yang Z
    2366. Yao M-C
    2367. Yao PJ
    2368. Yao X
    2369. Yao Z
    2370. Yao Z
    2371. Yasui LS
    2372. Ye M
    2373. Yedvobnick B
    2374. Yeganeh B
    2375. Yeh ES
    2376. Yeyati PL
    2377. Yi F
    2378. Yi L
    2379. Yin X-M
    2380. Yip CK
    2381. Yoo Y-M
    2382. Yoo YH
    2383. Yoon S-Y
    2384. Yoshida K-I
    2385. Yoshimori T
    2386. Young KH
    2387. Yu H
    2388. Yu JJ
    2389. Yu J-T
    2390. Yu J
    2391. Yu L
    2392. Yu WH
    2393. Yu X-F
    2394. Yu Z
    2395. Yuan J
    2396. Yuan Z-M
    2397. Yue BYJT
    2398. Yue J
    2399. Yue Z
    2400. Zacks DN
    2401. Zacksenhaus E
    2402. Zaffaroni N
    2403. Zaglia T
    2404. Zakeri Z
    2405. Zecchini V
    2406. Zeng J
    2407. Zeng M
    2408. Zeng Q
    2409. Zervos AS
    2410. Zhang DD
    2411. Zhang F
    2412. Zhang G
    2413. Zhang G-C
    2414. Zhang H
    2415. Zhang H
    2416. Zhang H
    2417. Zhang H
    2418. Zhang J
    2419. Zhang J
    2420. Zhang J
    2421. Zhang J
    2422. Zhang J-pu
    2423. Zhang L
    2424. Zhang L
    2425. Zhang L
    2426. Zhang L
    2427. Zhang M-Y
    2428. Zhang X
    2429. Zhang XD
    2430. Zhang Y
    2431. Zhang Y
    2432. Zhang Y
    2433. Zhang Y
    2434. Zhang Y
    2435. Zhao M
    2436. Zhao W-L
    2437. Zhao X
    2438. Zhao YG
    2439. Zhao Y
    2440. Zhao Y
    2441. Zhao Y-xia
    2442. Zhao Z
    2443. Zhao ZJ
    2444. Zheng D
    2445. Zheng X-L
    2446. Zheng X
    2447. Zhivotovsky B
    2448. Zhong Q
    2449. Zhou G-Z
    2450. Zhou G
    2451. Zhou H
    2452. Zhou S-F
    2453. Zhou X-jie
    2454. Zhu H
    2455. Zhu H
    2456. Zhu W-G
    2457. Zhu W
    2458. Zhu X-F
    2459. Zhu Y
    2460. Zhuang S-M
    2461. Zhuang X
    2462. Ziparo E
    2463. Zois CE
    2464. Zoladek T
    2465. Zong W-X
    2466. Zorzano A
    2467. Zughaier SM
    (2016) Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition)
    Autophagy 12:1–222.
    https://doi.org/10.1080/15548627.2015.1100356
    1. Lee KK
    2. Haraguchi T
    3. Lee RS
    4. Koujin T
    5. Hiraoka Y
    6. Wilson KL
    (2001)
    Distinct functional domains in Emerin Bind Lamin A and DNA-bridging protein BAF
    Journal of Cell Science 114:4567–4573.
    1. Vaughan A
    2. Alvarez-Reyes M
    3. Bridger JM
    4. Broers JL
    5. Ramaekers FC
    6. Wehnert M
    7. Morris GE
    8. Whitfield WGF
    9. Hutchison CJ
    (2001)
    Both emerin and lamin C depend on lamin A for localization at the nuclear envelope
    Journal of Cell Science 114:2577–2590.

Article and author information

Author details

  1. Abigail Buchwalter

    1. Cardiovascular Research Institute, University of California, San Francisco, San Francisco, United States
    2. Department of Physiology, University of California, San Francisco, San Francisco, United States
    3. Chan Zuckerberg Biohub, San Francisco, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing
    For correspondence
    abigail.buchwalter@ucsf.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7181-6961
  2. Roberta Schulte

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Data curation, Investigation, Methodology, Project administration
    Competing interests
    No competing interests declared
  3. Hsiao Tsai

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  4. Juliana Capitanio

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Software, Formal analysis, Methodology
    Competing interests
    No competing interests declared
  5. Martin Hetzer

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Resources, Supervision, Funding acquisition, Writing—review and editing
    For correspondence
    hetzer@salk.edu
    Competing interests
    No competing interests declared

Funding

NIH Office of the Director (NS096786)

  • Martin Hetzer

National Institute of General Medical Sciences (R01GM126829)

  • Martin Hetzer

National Cancer Institute (P30 014195)

  • Martin Hetzer

Chapman Foundation

  • Martin Hetzer

Helmsley Charitable Trust

  • Martin Hetzer

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Copyright

© 2019, Buchwalter et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 4,886
    views
  • 757
    downloads
  • 48
    citations

Views, downloads and citations are aggregated across all versions of this paper published by eLife.

Citations by DOI

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Abigail Buchwalter
  2. Roberta Schulte
  3. Hsiao Tsai
  4. Juliana Capitanio
  5. Martin Hetzer
(2019)
Selective clearance of the inner nuclear membrane protein emerin by vesicular transport during ER stress
eLife 8:e49796.
https://doi.org/10.7554/eLife.49796

Share this article

https://doi.org/10.7554/eLife.49796