1. Cell Biology
Download icon

Selective clearance of the inner nuclear membrane protein emerin by vesicular transport during ER stress

  1. Abigail Buchwalter  Is a corresponding author
  2. Roberta Schulte
  3. Hsiao Tsai
  4. Juliana Capitanio
  5. Martin Hetzer  Is a corresponding author
  1. University of California, San Francisco, United States
  2. Chan Zuckerberg Biohub, United States
  3. The Salk Institute for Biological Studies, United States
Research Article
  • Cited 0
  • Views 659
  • Annotations
Cite this article as: eLife 2019;8:e49796 doi: 10.7554/eLife.49796

Abstract

The inner nuclear membrane (INM) is a subdomain of the endoplasmic reticulum (ER) that is gated by the nuclear pore complex. It is unknown whether proteins of the INM and ER are degraded through shared or distinct pathways in mammalian cells. We applied dynamic proteomics to profile protein half-lives and report that INM and ER residents turn over at similar rates, indicating that the INM’s unique topology is not a barrier to turnover. Using a microscopy approach, we observed that the proteasome can degrade INM proteins in situ. However, we also uncovered evidence for selective, vesicular transport-mediated turnover of a single INM protein, emerin, that is potentiated by ER stress. Emerin is rapidly cleared from the INM by a mechanism that requires emerin’s LEM domain to mediate vesicular trafficking to lysosomes. This work demonstrates that the INM can be dynamically remodeled in response to environmental inputs.

https://doi.org/10.7554/eLife.49796.001

Introduction

The biogenesis of roughly one-third of the cell’s proteome takes place within the endoplasmic reticulum (ER) network. The ER is contiguous with the nuclear envelope (NE) membrane, a double bilayer membrane that defines the boundary of the nucleus. The NE is punctuated by nuclear pore complexes (NPCs) which control transport between the nuclear and cytoplasmic compartments. The outer nuclear membrane (ONM) and the bulk ER membrane network have a similar protein composition, including ribosomes that can be seen associated with the ONM. The inner nuclear membrane (INM), in contrast, is cloistered away from the bulk ER network by the NPC (Figure 1A). Proteomic analyses suggest that hundreds of proteins are selectively concentrated at the INM (Schirmer et al., 2003), and mutations to these proteins cause a broad array of rare pathologies (Schreiber and Kennedy, 2013).

Figure 1 with 1 supplement see all
Dynamic proteomic analysis of inner nuclear membrane protein turnover.

(A) Diagram of the ER with associated ribosomes, the NE composed of the ONM and INM, the NPCs, and the underlying nuclear lamina. INM proteins are synthesized in the ER, pass through the NPC, and enrich at the INM. (B) Overview of dynamic SILAC labeling experimental design. C2C12 mouse myoblasts were cultured for five population doublings in medium containing 13C6-lysine and 13C6, 15N4-arginine to completely label the proteome. After 3 days of culturing under differentiating conditions to generate non-dividing myotubes, cultures were switched to chase medium containing 12C-lysine and 12C, 14N-arginine for 1 to 3 days. Nuclear extracts were prepared at day 0, day 1, day 2, and day three for proteomic identification. (C,D) Representative peptide scans for a slowly degraded protein (Nup160) and (D) for a rapidly degraded protein (Topo2α) at the starting and ending points of the experiment outlined in (B). (E) Histogram of calculated half-lives for 1677 proteins with a median half-life of 2.4 days. (F) Features of nuclear proteome turnover. Median turnover behavior of 1677 proteins detected in at least three timepoints with at least one peptide (black line) with one standard deviation (gray); compared to turnover of the slowly exchanged protein Nup160 (black) and the rapidly exchanged protein Topo2α (blue). Error bars indicate SEM. (G) Calculated half-lives of 10 bona fide INM proteins, ranging from slowly degraded (nurim, purple) to rapidly degraded (emerin, green); 12 nuclear envelope transmembrane proteins (NETs) identified as NE residents by subtractive proteomics (see Schirmer et al., 2003); and 112 ER membrane proteins. ns indicates lack of statistical significance by Mann-Whitney test. Error bars indicate SEM. (H) There is no significant correlation between extraluminal domain size of INM proteins and their half-lives. See also Source Data 1–2, Supplementary files 13, and Figure 1—figure supplement 1.

https://doi.org/10.7554/eLife.49796.002

As the INM is devoid of ribosomes and translocation machinery, INM proteins must be synthesized in the ONM/ER and transported into the INM. Proteins concentrate at the INM by mechanisms including diffusion followed by stable binding to a nuclear structure, such as chromatin or the nuclear lamina, or signal-mediated import through the NPC (Katta et al., 2014). Transport across the NPC is a major kinetic barrier to accumulation of proteins at the INM (Boni et al., 2015; Ungricht et al., 2015). While mechanisms of INM targeting have been extensively studied, it is less clear how INM proteins are targeted for degradation if misfolded, damaged, or mistargeted.

Protein folding is inefficient, and newly synthesized proteins often become terminally misfolded and require degradation (Hegde and Zavodszky, 2019). Mature proteins also become damaged or misfolded over time and require selective degradation and replacement. Within the ER membrane network, the major degradation pathway is ER-associated degradation, or ERAD. ERAD is initiated by poly-ubiquitination of a target protein by an E3 ubiquitin ligase, followed by extraction from the membrane and proteolysis by proteasomes in the cytosol (Hegde and Zavodszky, 2019). Flux through ERAD helps to maintain organelle homeostasis and cell function by clearing damaged, misfolded, or mislocalized proteins.

Recent work in S. cerevisiae has identified a small number of ubiquitin ligases that target INM-localized proteins for degradation by ERAD, but the mammalian homologs remain elusive, perhaps because of the massive expansion of the E3 ubiquitin ligase family in recent evolution (Deshaies and Joazeiro, 2009). Degradation of mammalian INM proteins also appears to rely on activity of the proteasome and on the ERAD ATPase p97 (Tsai et al., 2016), suggesting that mammalian INM proteins may be subject to ERAD. However, we lack a broad understanding of the lifetimes of INM proteins in this compartment and the pathways used for their degradation within mammalian cells.

We sought to understand features of INM protein turnover in mammalian cells, and applied both proteome-wide and targeted candidate approaches to address this question. Here we show that the LEM domain protein emerin (EMD) is a rapidly degraded constituent of the INM. We use EMD as a model for dissecting INM protein turnover pathways and demonstrate that EMD is subject to both proteasome-dependent and lysosome-dependent modes of degradation. We report that both misfolded and normally folded variants of EMD are selectively exported from the INM and ER during acute ER stress by vesicular transport through the secretory pathway and delivery to the lysosome. These findings indicate that the INM sub-compartment senses and responds to ER stress.

Results

Trends in protein turnover across the NE/ER membrane network

We first used a dynamic proteomic approach to understand trends in protein turnover across ER sub-compartments. Since the nucleus is entirely disassembled during mitosis in mammalian cells, we chose a system that would allow us to profile protein turnover in the absence of cell division. We made use of the C2C12 myoblast culture system, which can be induced to irreversibly differentiate into myotubes by serum withdrawal (D'Angelo et al., 2009). We subjected these non-dividing mouse muscle myotubes to a pulse-chase timecourse using stable isotope labeling in cell culture (SILAC) (Ong and Mann, 2006) for timepoints ranging from 1 to 3 days (Figure 1B, see Materials and methods). Crude nuclear extracts were prepared and analyzed by mass spectrometry, and the ratio of ‘old’ (13C6-Lys, 15N4 + 13C6-Arg-labeled) to ‘new’ (12C6-Lys, 14N4 + 12C6-Arg-labeled) protein was quantified at the peptide level over time; peptides that passed stringent quality control filters were retained for estimation of half-lives by a linear regression fitting method (Dörrbaum et al., 2018)(see Materials and methods). We evaluated 1677 proteins and predicted half-lives over a wide range, from less than a day to greater than 15 days (Figure 1E, Table S3). Linear regression performs well when a line can be fitted with high fidelity and a non-zero slope is detectable; these conditions were generally met for proteins with predicted half-lives ranging from 1 to 8 days. We observed more frequent deviations in linearity at the low extreme (predicted t1/2 <1 day) and slopes approaching zero at the high extreme (predicted t1/2 > 8 days) (Figure 1—figure supplement 1). We expect that these factors limit the precision of half-life determination below 1 day and above 8 days from our 3 day timecourse. The median turnover rate that we observed (2.4 days) corresponds well with previous analyses in non-dividing mammalian cell cultures (Cambridge et al., 2011).

We observed some extremes in protein stability that are consistent with previous reports; for example, the long-lived nuclear pore complex component Nup160 (Toyama et al., 2013) was in the top 10% of predicted half-lives, with a calculated half-life of approximately 18 days (Figure 1C,F, Table S1). Near the other extreme, we observed that the enzyme topoisomerase 2α (Topo2α) had a predicted half-life in the bottom 10%, of less than 1 day (Figure 1D,F). This is consistent with this enzyme’s known regulation by ubiquitination and proteolysis (Gao et al., 2014).

Having established this framework, we then quantified the turnover kinetics of known inner nuclear membrane (INM) proteins. For this analysis, we focused on proteins whose preferential enrichment in this membrane compartment had been experimentally verified; we identified ten such proteins in our dataset (see Table S1) and determined their half-lives (see Materials and methods). We observed half-lives for these proteins ranging from 8.8 days (nurim) to 1.5 days (emerin) (Figure 1G). While very little is known about nurim’s function, its intrinsic biophysical properties may contribute to its long half-life: nurim contains six transmembrane domains, is extremely insoluble (Hofemeister and O'Hare, 2005), and diffuses very slowly within the INM (Rolls et al., 1999). Emerin (EMD) is a founding member of the LEM domain family of INM proteins with essential functions in muscle development (Brachner and Foisner, 2011). Unlike nurim, EMD is a small (~25 kDa), single-pass, tail-anchored transmembrane protein that diffuses freely through the NPC and enriches at the INM by virtue of its affinity for lamin A (Vaughan et al., 2001).

Given the INM’s status as a restricted sub-compartment of the ER, we reasoned that it might be possible that INM proteins would be generally less accessible to protein turnover than ER membrane proteins. Alternatively, similarly effective turnover in both compartments might support the possibility that turnover can occur in situ at the INM. ER membrane proteins were well represented in our dataset, as a significant proportion of ER membranes remain attached to and co-purify with nuclei (Schirmer et al., 2003). We could thus query whether INM proteins exhibited distinct turnover kinetics from membrane proteins of the bulk ER by comparing INM and ER transmembrane protein half-lives. We also compared bona fide INM proteins to proteins that had been identified as preferentially associated with either the inner or outer bilayer of the nuclear envelope (NE) membrane by comparative proteomics (Schirmer et al., 2003), termed NE transmembrane proteins (NETs). Altogether, these analyses indicate that INM proteins do not exhibit unique turnover kinetics as a protein class, compared to ER membrane proteins in general or to the overlapping designation of NETs (Figure 1G).

The size of INM proteins determines whether a protein must rely on signal-mediated transport through the NPC (Katta et al., 2014), and live imaging assays indicate that INM proteins with larger nucleoplasm-facing domains move more slowly across the NPC barrier (Boni et al., 2015; Ungricht et al., 2015). If transit across the NPC and out of the INM were a prerequisite for turnover in the bulk ER, we reasoned that turnover efficiency would also exhibit some dependence on protein size, because of the relationship between protein size and transport efficiency between the two compartments. The short half-life and small size of EMD is in line with this possibility. Our dataset of INM proteins included four single-pass INM and six multi-pass INM proteins, with total size of extraluminal domains ranging from 40 amino acids to 733 amino acids (Table S5). If export out of the NPC were a prerequisite for INM protein turnover, we reasoned that half-life should increase as the bulk of nucleoplasm-facing domains increases. We found no evidence for such a correlation (Figure 1H). We infer from this analysis that other factors distinct from monomeric protein size regulate protein turnover rate. This indicates that for INM proteins, export out of the INM is not a rate-limiting step for protein turnover. Rather, this is consistent with evidence in S. cerevisiae (Foresti et al., 2013; Khmelinskii et al., 2014) and in mammalian cells (Tsai et al., 2016) that turnover of INM proteins can take place in situ at the INM.

Recombination-induced tag exchange confirms INM protein lifetimes

We observed a wide range of half-lives for INM proteins in our proteomic analyses (Figure 1G), with the polytopic INM protein nurim turning over most slowly and the single-pass INM protein EMD turning over most rapidly. To directly visualize these relative differences in protein stability, we used recombination-induced tag exchange (RITE) (Toyama et al., 2019; Verzijlbergen et al., 2010) (Figure 2A) to perform a microscopy-based pulse-chase experiment. We expressed either nurim or EMD in a cassette encoding two C-terminal epitope tags separated by LoxP sites and by a stop codon, such that the resulting transcript will encode a protein that will be C-terminally tagged with the first tag. Upon adenoviral introduction of Cre recombinase, the RITE cassette is recombined to remove the first tag and position the second tag downstream of the open reading frame, so that all newly synthesized mRNA encodes a protein marked with the second tag. This enables simultaneous tracking of older and newer pools of protein that were synthesized before and after Cre addition, respectively (Toyama et al., 2019; Verzijlbergen et al., 2010). Using this approach, we visualized the rate of decline in the fluorescence intensity of ‘old’ myc-tagged nurim or EMD over several days in quiescent C2C12 cells. Consistent with our proteomic observations, we observed that RITE-tagged nurim decayed significantly more slowly than RITE-tagged EMD at the NE (Figure 2B–C,H).

The RITE system allows unambiguous dissection of the fates of maturely folded protein as well as nascent, newly synthesized protein. Recent work in yeast (Foresti et al., 2013; Khmelinskii et al., 2014) and in mammalian cells (Tsai et al., 2016) strongly suggests that INM proteins are subject to proteasome-mediated degradation via the ERAD pathway. The RITE system provides a means to distinguish the effects of proteasome inhibition on maturely folded proteins by inhibiting the proteasome after RITE tag switching, and monitoring the effects on maturely folded proteins. Mature nurim-RITE decreases only modestly within 2 days of tag switching, but co-incubation with the proteasome inhibitor MG132 for 1 day causes accumulation of nurim-RITE through the NE and ER (Figure 2E,H). Maturely folded EMD-RITE diminishes significantly at the NE within 2 days of tag switching but is partially stabilized at the NE in the presence of MG132 (Figure 2F,H). This indicates that mature, INM-localized proteins can be degraded in a proteasome-dependent pathway in situ at the INM. Notably, abundant proteasomes have been observed along the INM in cryo-EM studies and could possibly engage with substrate there (Albert et al., 2017). This is also consistent with a recent report that an unstable INM protein mutant accumulates within the nucleus of mammalian cells when the proteasome is inhibited (Tsai et al., 2016).

Identification of a model substrate for dissecting INM protein turnover

In order to gain more insight into the pathways that control INM protein turnover in mammalian cells, we chose to focus on EMD for its relatively fast turnover rate (Figure 1G, Table S1) and for the variety of disease-linked mutations to EMD that appear to influence protein stability (Fairley et al., 1999). Loss-of-function mutations to EMD cause Emery-Dreifuss muscular dystrophy (EDMD) (Bonne and Quijano-Roy, 2013). In some cases, EDMD-linked mutations cause loss of detectable EMD protein without affecting mRNA levels, suggesting that these mutations might cause misfolding and degradation of EMD (Fairley et al., 1999). We sought to identify such an EDMD-linked EMD variant for use as a model substrate for dissecting INM protein turnover. We selected a small in-frame deletion (Δ95–99) within EMD’s lamin-binding domain (Figure 2D) that had been previously shown to localize to the NE when ectopically expressed (Fairley et al., 1999). Consistently, when we expressed either EMD-GFP or EMDΔ95–99-GFP in C2C12 cells, we observed similar enrichment at the NE (Figure 2—figure supplement 1). Further, both protein variants exhibited identical residence times at the NE as assayed by fluorescence recovery after photobleaching (FRAP) analysis (Figure 2—figure supplement 1). Directly monitoring the stability of EMDΔ95–99 by RITE tagging indicates that it disappears from the NE faster than wild type EMD (Figure 2G), but is also stabilized at the NE by proteasome inhibition (Figure 2G–H). These observations indicate that EMDΔ95–99 is an unstable EMD variant that resides within the INM. We next moved to dissect that pathway(s) involved in EMDΔ95–99 degradation.

Figure 2 with 1 supplement see all
RITE analysis of INM proteins enables visualization of proteasome-dependent turnover.

RITE analysis of INM proteins corroborates protein turnover determined by proteomics. (A) Schematic of recombination-induced tag exchange (RITE) expression cassette for visualizing protein turnover using Cre recombinase-mediated tag switching. (B-C) RITE timecourses of nurim-RITE (B) and EMD-RITE (C) in quiescent C2C12 cells. Maximum intensity projections of confocal z-series shown. (D) Diagram of emerin domain organization and position of EDMD-linked deletion mutant (EMDΔ95-99) within the lamin-binding domain. (E-G) RITE timecourses of nurim-RITE (E), EMD-RITE (F), and EMDΔ-RITE (G) with or without 1 day of cotreatment with the proteasome inhibitor MG132 (right panels). Single confocal z-slices shown. (H) Quantification of normalized intensity of old NE-localized RITE-tagged protein in maximum intensity projections of confocal z series acquired across the conditions shown in (E-G). Bars indicate average values with error bars indicating SEM for N > 42 cells per condition from 2 independent experiments. **** indicates p-value < 0.0001 (by t-test) for comparison between untreated and treated conditions. Scale bar, 10 mm. See also Figure 2—figure supplement 1.

https://doi.org/10.7554/eLife.49796.004

Proteasome-dependent and proteasome-independent modes of emerin clearance

Misfolded ER resident proteins are cleared by the ER-associated degradation (ERAD) pathway. ERAD clients are marked for degradation by ubiquitination, extracted from the ER membrane by the ATPase enzyme p97, and degraded by the proteasome in the cytosol (Ruggiano et al., 2014). INM proteins may also be targeted to an arm of the ERAD pathway in mammalian cells (Tsai et al., 2016), and our data indicate that multiple INM proteins are stabilized in situ by proteasome inhibition. However, ubiquitin ligase(s) that recognize INM-localized substrates in mammalian cells have not been identified.

To sensitively probe factors that influence INM protein stability, we tracked the stability of GFP-tagged EMD variants. When de novo protein synthesis was blocked by cycloheximide (CHX), we observed rapid loss of EMDΔ95–99-GFP within 4–8 hr (Figure 3A–B) while wild type EMD remained stable (Figure 3—figure supplement 1). This loss is blunted by co-treatment with the proteasome inhibitor MG132 (Figure 3A, third panel), consistent with our observations that INM protein turnover is slowed by proteasome inhibition using the RITE system (Figure 2E–G). If EMDΔ95–99-GFP is directed to the proteasome through ERAD, inhibition of earlier steps in this pathway should similarly cause accumulation of EMDΔ95–99-GFP. Indeed, pharmacological inhibition of p97 with the drug eeyarestatin I (Wang et al., 2008) causes modest accumulation of EMDΔ95–99 and of higher molecular weight species, a similar effect to proteasome inhibition itself (Figure 3B). In contrast, the drug kifunensine, which prevents ERAD targeting of misfolded glycosylated proteins (Fagioli and Sitia, 2001), has no effect on EMDΔ95–99-GFP levels as would be expected given the lack of glycosylation sites within EMD’s small luminal domain (Figure 3B).

Figure 3 with 3 supplements see all
Acute stressors destabilize mutant emerin protein levels.

(A) C2C12 cells stably expressing EMDΔ-GFP and treated with DMSO vehicle control, CHX alone, CHX and MG132, or MG132 alone for 8 hours. All images were acquired using the same laser power and detector gain settings. Single confocal z slices shown. (B) Western blot analysis of protein levels in C2C12 cells stably expressing EMDΔ-GFP and treated with DMSO vehicle, the translation inhibitor CHX, the proteasome inhibitor MG132, the p97 ATPase inhibitor eeyarestatin, or the glycosylation trimming inhibitor kifunensine for the time periods shown. a-tubulin shown as loading control. (C) Western blot analysis of U2OS cells stably expressing EMDΔ-GFP and doxycycline-inducible RNAi targeting the E2 ubiquitin ligases UBE2G1 and UBE2G2 and treated with DMSO vehicle control (-) or with doxycycline (+) for 48 hours. Free GFP indicates RNAi induction. a-tubulin shown as loading control. (D) Western blot detection of EMDΔ-GFP levels in cells treated with DMSO vehicle, or co-treated with CHX and the ER stress inducer THG for the time periods shown. a-tubulin shown as loading control. (E) C2C12 cells stably expressing EMDΔ-GFP and treated with vehicle control or with THG for the time periods shown. Insets show nuclei in the same ~50 µm field of view stained with Hoechst. All images acquired using the same laser power and detector gain settings; single confocal z slices shown. (F) Quantification of total NE-localized GFP fluorescence in maximum intensity projections of confocal z slices acquired across the conditions shown in (E) for N > 410 cells per condition. (G) Diagram of emerin domain organization and the sequence of an inserted C-terminal glycosylation sequence derived from the opsin protein, with glycosylation acceptor site marked (*). (H) Analysis of EMDΔ-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or CHX and THG cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMDΔ-GFP*; orange arrowhead indicates EndoH-resistant states of EMDΔ-GFP*; black arrowhead indicates deglycosylated EMDΔ-GFP*. a-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 mm. See also Figure 3 – figure supplement 1, 2, and 3.

https://doi.org/10.7554/eLife.49796.006

E3 ubiquitin ligases transfer ubiquitin to ERAD substrates, and each E3 ligase exhibits preference for a small number of substrates. A few E3 ligases have been implicated in ERAD of INM-localized substrates in yeast, including Doa10 and Asi1 (Khmelinskii et al., 2014). MARCH6 is a mammalian ortholog of Doa10 (Zattas et al., 2016). Mammalian orthologs of Asi1 have not been identified. Based on iterative sequence homology analysis through the MetaPhORs database (Pryszcz et al., 2011) we identified two possible Asi1 homologs: Rnf26 and CGRRF1. We depleted MARCH6, Rnf26, and CGRRF1 with short interfering RNA (siRNA), but observed no effect on EMDΔ95–99 protein levels (Figure 3—figure supplement 2), suggesting that these ligases do not catalyze EMD turnover, or alternatively that multiple E3 ligases are redundant in this process. Importantly, the broad group of ERAD-implicated E3 ligases rely on a handful of E2 ubiquitin conjugating enzymes for ubiquitin transfer. These E2 ligases – four in mammals – thus represent a key control point for ERAD (Christianson et al., 2011; Leto et al., 2019). We targeted these four E2 ubiquitin ligases by siRNA transfection (Figure 3—figure supplement 2) and a subset of these by inducible RNAi using a potent microRNA-based system (Fellmann et al., 2013) and analyzed the effects on EMDΔ95–99-GFP levels. To our surprise, knockdown of UBE2G1, UBE2G2, UBE2J1, and UBE2J2 either did not stabilize or instead decreased EMDΔ95–99-GFP levels (Figure 3C; Figure 3—figure supplement 2). This finding suggests that when ERAD is perturbed, EMD variants can be cleared by an alternative pathway.

Emerin is subject to rapid stress-dependent clearance from the ER and NE

Global inhibition of ERAD places profound protein folding stress on the ER membrane network and induces the unfolded protein response (UPR) (Christianson et al., 2011). We considered whether direct induction of ER stress was sufficient to accelerate the turnover of EMDΔ95–99-GFP. We tested the effect of the ER stressor thapsigargin (THG), which disrupts ER homeostasis by causing release of Ca2+ from the ER lumen, on EMDΔ95–99 protein stability. Compared to CHX treatment alone (Figure 3—figure supplement 1), THG co-treatment further destabilized EMDΔ95–99-GFP (Figure 3D). Strikingly, when we tracked EMDΔ95–99 protein localization by time-lapse microscopy (Figure 3E), it became apparent that NE localization of EMDΔ95–99 significantly decreases within 2 hr of THG treatment, concomitant with accumulation in a perinuclear membrane compartment that morphologically resembles the Golgi apparatus. By 8 hr after THG administration, EMDΔ95–99 was undetectable (Figure 3E–F). These data suggest that under conditions of ER stress, EMDΔ95–99 is cleared from the NE/ER membrane network by transport out of the ER and eventual disposal of the protein in a post-ER compartment.

Acute ER stress reroutes emerin through the secretory pathway

We took several approaches to test the possibility that EMDΔ95–99 leaves the NE/ER network during ER stress. Firstly, we made use of the characteristic sugar modifications that occur as cargoes progress through the secretory pathway to determine whether EMDΔ95–99 accesses post-ER compartments. Since the short lumenal domain of EMD lacks a glycosylation consensus site, we engineered the glycosylation site from the opsin protein (Bulbarelli et al., 2002) (SSNKTVD) onto the lumen-facing C terminus of EMDΔ95–99. If EMDΔ95–99 is retained in the ER, all of its N-linked glycans should remain sensitive to the trimming enzyme Endo H. On the other hand, if EMDΔ95–99 exits the ER, its N-linked glycans will be elaborated with further modifications so that Endo H can no longer trim them. These glycosylation states can be detected as progressive increases in molecular weight, and can be completely removed by incubation with the enzyme PNGase F. This engineered variant, EMDΔ95–99-GFP*, localizes normally to the NE and also disappears from the NE upon ER stress induction (Figure 3—figure supplement 3). In unstressed cells, EMDΔ95–99-GFP* is predominantly observed in an Endo H-sensitive glycosylation state (Figure 3H, red arrowhead), with a minor pool of Endo H-resistant protein (Figure 3H, orange arrowhead). In contrast, EMDΔ95–99-GFP* shifts progressively to a higher molecular weight, Endo H-resistant state over 2 to 4 hr of co-treatment with CHX and THG. This indicates that ER stress induction increases the proportion of EMDΔ95–99 that exits the NE/ER and samples post-ER compartments.

Upon ER stress induction, EMDΔ95–99-GFP accumulates in a perinuclear domain that resembles the Golgi apparatus (Figure 3E). We evaluated the extent of colocalization of EMDΔ95–99-GFP with the medial Golgi resident protein giantin in untreated cells and cells that had been treated with THG for 2–4 hr (Figure 4A–C). In untreated cells, EMDΔ95–99-GFP was not detectable in the Golgi, but THG treatment rapidly induced Golgi colocalization as NE-localized EMDΔ95–99 levels decreased (Figure 4A–C). Comparing GFP fluorescence intensity in the Golgi versus the NE over time revealed that ER stress induces significant enrichment of EMDΔ95–99-GFP in the Golgi accompanied by loss from the NE within 2 hr (Figure 4D).

Figure 4 with 1 supplement see all
Stress-induced clearance of mutant emerin from the ER and NE involves the secretory pathway.

(A-C) Representative confocal slices of cells stably expressing EMDΔ-GFP, treated with DMSO or THG for the indicated times and costained for giantin to mark the Golgi (magenta). All images were acquired using the same laser power and detector gain settings. (A’-C’) Are contrast-adjusted to show relative levels of EMDΔ-GFP in NE and Golgi. Dotted lines mark positions of linescans in (A’’-C’’). (D) Quantification of GFP fluorescence intensity abundance ratio in Golgi versus NE in single, non-contrast-adjusted z slices over THG treatment timecourse. Columns indicate average with error bars indicating SEM for N > 37 cells from two independent experiments. **** indicates p-value<0.0001 compared to untreated (by t-test). (E-F) Representative confocal slices of cells stably expressing EMDΔ-GFP (F) after 16 hr of treatment with DMSO vehicle control, THG, BFA, or co-treatment with THG and BFA. All images were acquired using the same laser power and detector gain settings. Insets show nuclei in the same ~ 50 µm field of view stained with Hoechst. (E) Quantification of GFP fluorescence intensity at the NE in maximum intensity projections of confocal z series acquired across the conditions represented in (F). Columns indicate average with error bars indicating SEM for N > 386 cells from three independent experiments. **** indicates p-value<0.0001 compared to untreated (by t-test). Scale bars in micrographs indicate 10 μm. See also Figure 4—figure supplement 1.

https://doi.org/10.7554/eLife.49796.010

EMDΔ95–99 could be delivered to the Golgi by vesicular transport from the ER. Transport between the ER and the Golgi is mediated by packaging of cargoes into COP-coated vesicles (Barlowe and Miller, 2013), a process which can be inhibited by the drug brefeldin A (BFA). BFA acts by disrupting COPI vesicle formation, leading to the collapse of the Golgi into the ER membrane network (Chardin and McCormick, 1999). To test whether clearance of EMDΔ95–99-GFP from the NE/ER requires vesicle-mediated ER-to-Golgi transport, we co-incubated cells expressing EMDΔ95–99-GFP with THG and BFA. Strikingly, co-treatment with BFA nearly quantitatively reversed loss of EMDΔ95–99-GFP from the NE (Figure 4E–F). Taken together with the time-dependent enrichment of EMD variants in the Golgi apparatus (Figure 4A–C), and the time-dependent accumulation of more complex N-glycosylated variants of EMDΔ95–99-GFP* (Figure 3H), this indicates that under ER stress, EMD variants can be cleared from both the NE and ER by vesicular transport through the Golgi.

While vesicle-mediated transport is the major pathway by which proteins move from the ER and onward through the secretory pathway, alternative modes of removing protein from the ER exist, in particular during ER stress. Recent evidence indicates that the ER can undergo autophagy under various conditions, including acute ER stress (Smith et al., 2018). To evaluate the possibility that EMDΔ95–99-GFP could be engulfed and removed from the NE and ER by autophagosomes, we tested the ability of the PI3K inhibitor KU55933 to reverse EMDΔ95–99-GFP loss. PI3K signaling promotes the formation of isolation membranes that engulf autophagic cargo (Farkas et al., 2011; Klionsky et al., 2016). We observed that cotreatment with KU55933 during acute ER stress could not prevent loss of EMDΔ95–99-GFP from the NE/ER (Figure 5A–C), in contrast to the ability of BFA treatment to rescue EMD loss. This indicates that vesicle-mediated transport to the Golgi and not autophagic engulfment mediates EMDΔ95–99-GFP’s exit from the ER during stress.

Mutant emerin trafficking is dependent on lysosomal but not autophagosomal function.

(A) Representative confocal slices of cells stably expressing EMDΔ-GFP after 8 hr of treatment with DMSO vehicle control, THG, co-treatment with THG and BFA, or co-treatment with THG and KU55933. Insets show nuclei in the same field of view stained with Hoechst. (B) Quantification of NE-localized GFP fluorescence intensity in maximum intensity projections of confocal z series acquired across the conditions shown in (A). Columns indicate average and error bars indicate SEM for N > 56 cells from three independent experiments. **** indicates p-value<0.0001 compared to untreated (by t-test). (C) Diagram of processes perturbed by KU55933, BFA, and Baf A1 treatment. (D-F) Representative confocal slices of C2C12 cells stably expressing EMDΔ-GFP and costained for LAMP1 after treatment with DMSO vehicle control (D), Baf A1 (E), or co-treatment with THG and Baf A1 (F) for the indicated times. (D’-F’) Insets show GFP-LAMP1 colocalization within ~ 15 µm field of view demarcated by dashed rectangles in (D-F). (G) Analysis of EMDΔ-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or THG and Baf A1 cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMDΔ-GFP*; orange arrowhead indicates EndoH-resistant states of EMDΔ-GFP*; black arrowhead indicates deglycosylated EMDΔ-GFP*. α-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 μm.

https://doi.org/10.7554/eLife.49796.012

Proteins in post-ER compartments can be degraded by vesicle-mediated traffic to the lysosome (Saftig and Klumperman, 2009). To investigate whether the lysosome was the eventual destination of EMDΔ95–99-GFP after ER export, we co-incubated cells expressing EMDΔ95–99-GFP with THG and bafilomycin A1 (Baf A1), which impairs lysosome acidification and thus slows protein degradative processes within lysosomes.

Under these conditions, we observed complete translocation of EMDΔ95–99-GFP out of the NE and ER and into numerous vesicles that are decorated with the lysosomal marker LAMP1 (Figure 5F). Notably, bafilomycin A1 alone did not trap EMDΔ95–99-GFP in lysosomes (Figure 5E), indicating that ER stress potentiates exit from the NE/ER and lysosomal accumulation. This indicates that the eventual destination of EMDΔ95–99-GFP after export from the NE/ER network is the lysosome.

If EMDΔ95–99 arrives at the lysosome by trafficking through the secretory pathway, this should be accompanied by the accumulation of Endo H-resistant N-glycosylation modifications on our engineered reporter EMDΔ95–99-GFP*. Indeed, we observe that the majority of EMDΔ95–99-GFP* exists as an Endo H-sensitive species in unperturbed cells (Figure 5G, red arrowhead), but shifts progressively to a higher molecular weight, Endo H-resistant state over 2 to 4 hr of co-treatment with THG and Baf A1 (Figure 5G, orange arrowhead). This indicates that EMDΔ95–99 traverses the secretory pathway before being delivered to the lysosome.

Emerin transiently accesses the plasma membrane during ER stress

A possible route from the early secretory pathway to the lysosome could involve anterograde transport following the ‘bulk flow’ of the secretory pathway, through the Golgi and into vesicles destined for the plasma membrane (PM). There, mislocalized proteins may be selectively endocytosed and trafficked to lysosomes for degradation through retrograde transport (Saftig and Klumperman, 2009). To explore this possibility, we performed antibody uptake assays in cells expressing EMDΔ95–99-GFP under homeostatic or stressed conditions. EMD is a tail-anchored protein with its final C-terminal amino acids facing the ER lumen; the C-terminal GFP tag will thus face the extracellular space if EMDΔ95–99-GFP accesses the PM (Figure 6A). We tested whether EMDΔ95–99’s GFP tag is accessible to an anti-GFP antibody applied to the surface of intact cells. In untreated cells, a small amount of EMDΔ95–99-GFP (Figure 6B–D) is accessible to an anti-GFP antibody, but not to an anti-myc antibody, indicating that EMDΔ95–99 is not completely restricted to intracellular membrane compartments under homeostatic conditions. Importantly, the signal from the anti-GFP antibody is specific to cells that express a GFP fusion protein (Figure 6D–E). Upon induction of ER stress by THG, the amount of PM-accessible EMDΔ95–99-GFP rapidly increases within 2–4 hr, and begins to taper off within 6 hr. This implies that ER stress induces the export of EMDΔ95–99-GFP from the NE/ER to the PM as well as its internalization. Importantly, the GFP antibody signal is visible within intracellular puncta, consistent with EMDΔ95–99-GFP:antibody conjugates being rapidly internalized into vesicles after PM delivery. Based on the timescale when the levels of EMDΔ95–99-GFP begin to significantly decrease at the NE (Figure 3E–F), increase in the Golgi (Figure 4A–D), transit through the PM (Figure 6) and accumulate in lysosomes (Figure 5F), we infer that EMDΔ95–99-GFP is transported through the secretory pathway to the PM, then internalized and delivered to lysosomes for degradation.

Figure 6 with 1 supplement see all
Mutant emerin traffics through the plasma membrane upon ER stress.

(A) Schematic of antibody uptake assay experimental design. If emerin accesses the plasma membrane (PM), it will be detected by anti-GFP antibody (green), which will bind the surface-exposed GFP tag. (B) Uptake of anti-GFP antibody (magenta) by cells stably expressing EMDΔ-GFP and treated with DMSO vehicle control or THG for 2, 4, or 6 hours. Cells were incubated with anti-GFP antibody for the final hour of these treatment periods before fixation and imaging. (C) Control demonstrating lack of uptake of anti-myc antibody by cells stably expressing EMDΔ-GFP and treated with THG for 2 hours. (D) Quantification of internalized antibody signal in EMDΔ-GFP expressing cells. Columns indicate average and error bars indicate SEM for N > 235 cells from 3 independent experiments. **** indicates p-value < 0.0001 (t-test) compared to untreated. (E) Control demonstrating lack of uptake of anti-GFP antibody by untreated C2C12 cells that do not express a GFP fusion protein. WGA is used to define cell boundaries. All images were acquired using the same laser power and detector gain settings. Scale bars in micrographs indicate 10 µm. See also Figure 6—figure supplement 1.

https://doi.org/10.7554/eLife.49796.013

Other INM proteins do not undergo stress-dependent clearance

Our findings indicate that EMDΔ95–99 is subject to proteasome-dependent turnover at the INM (Figure 2G–H; Figure 3A–B), but can also be rapidly removed from the INM and ER membrane network and targeted for degradation during ER stress. This raises the possibility that additional INM proteins are susceptible to stress-dependent degradation. To address this, we tested the response of additional INM proteins to ER stress induction by THG, to ER export blockage by BFA, and to lysosomal maturation blockage by Baf A1. We selected proteins with distinct topologies and half-lives, including the long-lived polytopic INM protein nurim and the less stable single-pass transmembrane protein Sun2 (see Figure 1H, Table S5). Prolonged treatment with THG modestly decreased nurim protein levels and significantly decreased Sun2 protein levels (Figure 7A–B,D), likely as a consequence of translational inhibition caused by ER stress (Harding et al., 1999). Consistent with this interpretation, the sensitivity of these two proteins tracks with the relative differences in their half-lives (Table S5); nurim has a half-life of ~ 9 days, while Sun2 has a half-life of ~ 3 days in non-dividing cells. Importantly, however, co-incubation with THG and BFA had no effect on either the subcellular localization or abundance of nurim or Sun2 (Figure 7A–B,D), indicating that loss of these proteins is not mediated by ER export. Further, neither protein leaves the NE/ER to accumulate in lysosomes when lysosome acidification is blocked by Baf A1 (Figure 7A’, B’).

Figure 7 with 1 supplement see all
Emerin, but not other INM proteins, undergoes stress-dependent clearance from the NE and ER and accesses lysosomes.

(A-C) Representative confocal slices of cells stably expressing NRM-GFP (A), Sun2-GFP (B), or EMD-GFP (C) after 16 hr of treatment with DMSO vehicle control, THG, or co-treatment with THG and BFA. Insets show nuclei in the same ~ 50 µm field of view stained with Hoechst. (A’-C’) Representative confocal slices of cells co-treated with THG and Baf A1. All images were acquired using the same laser power and detector gain settings. (D) Quantification of GFP fluorescence intensity at the NE in maximum intensity projections of confocal z series acquired across conditions represented in (A-C). Columns indicate average and error bars indicate SEM for N > 690 cells from three independent experiments. **** indicates p-value<0.0001 compared to untreated (t-test). (E-F) Analysis of EMD-WT-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or THG and CHX (E) or THG and Baf A1 (F) cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMD-WT-GFP*; orange arrowhead indicates EndoH-resistant states of EMD-WT-GFP*; black arrowhead indicates deglycosylated EMD-WT-GFP*. α-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 μm. See also Figure 7—figure supplement 1.

https://doi.org/10.7554/eLife.49796.015

We next asked whether wild type EMD was also subject to this pathway. Similarly to EMDΔ95–99, NE-localized EMD-GFP decreases when stress is induced by THG, but remains stable when stress induction by THG is accompanied by secretory pathway disruption by BFA (Figure 7C). ER stress also induces EMD-GFP to enrich in the Golgi (Figure 4—figure supplement 1) and access the plasma membrane (Figure 6—figure supplement 1). EMD-GFP also accumulates in perinuclear puncta that are likely lysosomes when cells are co-incubated with THG and Baf A1 (Figure 7C’). We again engineered an opsin glycosylation site onto the C-terminus of EMD-GFP in order to track movement of EMD through membrane compartments. EMD-WT-GFP* localizes to the NE and responds similarly to ER stress and secretory pathway blockage (Figure 7—figure supplement 1). As we observed with EMDΔ95–99, EMD-WT-GFP* exists predominantly in an Endo H-sensitive modification state in unstressed cells (Figure 7E–F, red arrowheads). Higher molecular weight, Endo H-resistant species increase in abundance when cells are coincubated with THG and CHX (Figure 7E, orange arrowhead) or with THG and Baf A1 (Figure 7F, orange arrowhead). We thus conclude that wild type EMD is subject to the same stress-induced lysosomal degradation pathway as EMDΔ95–99. However, when EMD-GFP’s response to THG is tracked over time, it is clear that displacement of wild type EMD from the NE proceeds significantly more slowly than displacement of EMDΔ95–99 (Figure 8B,D). This indicates that stress-dependent trafficking out of the INM is selective to variants of EMD, and that intrinsic features of EMD control its clearance from the NE/ER and targeting into lysosomes.

Figure 8 with 2 supplements see all
A signal within emerin’s.

LEM domain is required for stress-dependent clearance from the NE and ER (A) Diagram of emerin domain organization with N-terminal LEM domain deletion indicated (amino acids 1-45). (B-C) Representative confocal slices of C2C12 cells stably expressing EMD-WT-GFP (B) or EMDΔLEM-GFP (C) after treatment with DMSO vehicle control or THG for the indicated times. Insets show nuclei in the same ~50 µm field of view stained with Hoechst. (D) Quantification of EMDΔ95-99-GFP (as also shown in Figure 3F), EMD-WT-GFP, and EMDΔLEM-GFP fluorescence intensity at the NE in maximum intensity projections of confocal z series acquired across the timecourse shown in (B-C). Columns indicate average and error bars indicate SEM for N > 146 cells from 3 independent experiments. **** indicates p-value < 0.0001 compared to untreated (t-test). (E) Western blot of EMDΔLEM-GFP in cells treated with DMSO vehicle control or co-treated with THG and CHX for the indicated times. (F-G) Representative confocal slices of C2C12 cells stably expressing EMDΔLEM-GFP after treatment with (F) DMSO vehicle control, THG, THG + BFA, or (G) THG + Baf A1. (H) Quantification of GFP fluorescence intensity at the NE across the conditions shown in (F). Columns indicate average and error bars indicate SEM for N > 776 cells from 3 independent experiments. **** indicates p-value < 0.0001 compared to untreated (t-test). (I-J) Analysis of EMD-ΔLEM-GFP* glycosylation state in cells subjected to treatment with DMSO vehicle control or THG and CHX (I) or THG and Baf A1 (J) cotreatments for the times indicated. Red arrowhead indicates EndoH-sensitive glycosylated state of EMDΔLEM-GFP*; black arrowhead indicates deglycosylated EMDΔLEM-GFP*. a-tubulin shown as loading control. Numbers to left of blots indicate molecular weights in kDa. Scale bars in micrographs indicate 10 mm. See also Figure 8—figure supplements 1 and 2.

https://doi.org/10.7554/eLife.49796.017

A signal within emerin’s LEM domain is required for stress-dependent export

Why are EMD variants selectively targeted for stress-dependent clearance from the INM and ER? We considered functional domains that might be involved in responding to ER stress. EMD is a tail-anchored protein with a ~ 10 amino acid tail that protrudes into the ER lumen (Figure 3A). This short sequence lacks any known motifs for engaging with proteins within the ER lumen. EMD’s nucleoplasmic domain includes an N-terminal LEM domain and an internal lamin A-binding region (Figure 3A). Emerin relies on lamin A for targeting to the INM (Vaughan et al., 2001) but we noted that in lmna - /- MEFs, EMD-GFP remained stably expressed even while mislocalized to the peripheral ER (Figure 8—figure supplement 2). The small deletion within EMDΔ95–99 falls within the lamin A-binding domain, but does not appear to affect the protein’s affinity for the lamina as judged by FRAP (Figure 2—figure supplement 1), even though this variant responds more potently than wild type EMD to ER stress (Figure 8D). Taken together, these observations indicate that dissociation from the lamina is not sufficient to promote clearance of EMD from the NE/ER membrane system.

We next evaluated whether interactions mediated by the LEM domain could contribute to stress-dependent EMD export. The LEM domain (Figure 3A) is a protein fold that binds with high affinity to the soluble nucleoplasmic protein BAF (Lee et al., 2001). We deleted this domain and queried the effects on EMD localization and trafficking. When expressed within unperturbed cells, EMDΔLEM exhibited normal enrichment in the NE (Figure 8C), consistent with its ability to bind the lamina independently of the LEM domain. However, we observed that this mutant was less responsive than other EMD variants to ER stress induction; NE-localized EMDΔLEM was clearly detectable over several hours of THG treatment and was significantly less sensitive than full-length EMD to ER stress (Figure 8C–E). We surmise that the eventual loss of EMDΔLEM results from translational inhibition resulting from ER stress (Harding et al., 1999) and degradation by alternative pathways. Consistent with the interpretation that the LEM domain mediates post-ER trafficking, co-incubation of EMDΔLEM-expressing cells with THG and BFA or Baf A1 each had no effect on protein levels or localization (Figure 8F–H). These results suggest that without the LEM domain, EMD does not access post-ER compartments. To directly evaluate this, we generated a glycosylation-reporting variant, EMDΔLEM-GFP*, with a glycosylation consensus site at the lumenal C terminus. In contrast to variants of EMD with an intact LEM domain, EMDΔLEM-GFP* accumulates only Endo H-sensitive modifications and remains equivalently Endo H-sensitive during ER stress and lysosome blockage (Figure 8I–J, red arrowheads). Altogether, these data indicate that a signal within emerin’s LEM domain enables selective export from the ER under stress conditions.

Discussion

In this work, we applied a dynamic proteomic strategy to define organelle-wide trends in protein turnover across the NE/ER membrane network in mammalian cells. While the INM is separated from the bulk ER by the selective barrier of the NPC, we observe no difference in global protein turnover rates between the ER and INM compartments or any correlation between INM protein size and turnover kinetics. This, along with specific visualization of mature INM proteins by RITE tagging and microscopy (Figure 2) and previous studies (Tsai et al., 2016), suggests that turnover of INM proteins can be effectively achieved in situ.

Moving forward with the rapidly turned over INM protein EMD as a model substrate for dissecting INM protein turnover, we identified an even less stable, EDMD-linked variant of EMD as an ideal substrate for sensitively probing INM protein turnover pathways. We noted that turnover of maturely folded EMD and EMDΔ95–99 exhibits proteasome dependence at the INM (Figure 2F–H; Figure 3A), while nascent EMDΔ95–99 accumulates in multiple cellular compartments when the proteasome is inhibited (Figure 3A, fourth panel). Taken together, these observations lead us to infer that mature EMD variants and potentially other INM proteins can be turned over in situ at the INM by a pathway that terminates in proteasomal degradation, while immature EMD variants (and potentially other INM proteins) are also subject to co-translational quality control that terminates in proteasomal degradation. As proteasomal inhibition and p97 inhibition each stabilize EMDΔ95–99 (Figure 3B), we expect that EMDΔ95–99 is an ERAD client under some conditions.

Surprisingly, however, we also find that EMD can be selectively shunted to an alternative turnover pathway under conditions of acute ER stress. This pathway is rapidly induced by ERAD blockage or by pharmacological induction of acute ER protein folding stress (Figure 3) and requires ER export (Figures 3 and 4). Notably, changes to EMDΔ95–99 localization and levels are apparent at a timescale shorter than the normal half-life of EMDΔ95–99, within 2–4 hr of ER stress induction. Based on the transient appearance of EMDΔ95–99 at the PM (Figure 6) and its accumulation in lysosomes (Figure 5), we conclude that EMD transits through the secretory pathway and is then internalized into lysosomes. While our data indicate that a significant proportion of EMD leaves the NE/ER during ER stress, we cannot rule out the possibility that ERAD-mediated degradation of some proportion of EMD takes place within the NE/ER network in parallel to the lysosome-mediated pathway that we have identified. Nonetheless, this dynamic and selective removal of an INM protein is quite surprising and is inconsistent with models of the INM as a terminal depot for its resident proteins.

Our findings have some intriguing parallels to the fate of a misfolded variant of the GPI-anchored prion protein, PrP, during ER stress (Satpute-Krishnan et al., 2014). PrP is normally targeted to the PM, but a misfolded variant is retained within the ER by persistent association with protein folding chaperones. Similarly to what we observe for an INM protein, ER stress induces the rapid export of misfolded PrP through the secretory pathway, followed by transit through the PM and internalization and delivery to lysosomes for degradation. This mode of clearance has been referred to as rapid ER stress-induced export, or RESET (Satpute-Krishnan et al., 2014).

There are several notable contrasts between PrP’s export from the peripheral ER and EMD’s export from the INM and ER. For instance, the topologies of PrP and EMD are quite disparate. As a GPI-anchored protein, misfolded PrP faces the lumen of the ER, and an interaction between PrP and Tmp21, a sorting adaptor for luminal proteins, controls RESET (Satpute-Krishnan et al., 2014). Misfolded PrP remains associated with additional luminal ER-derived proteins during its transit through the secretory pathway, and these associations appear to enable recognition of misfolded PrP at the cell surface for internalization (Zavodszky and Hegde, 2019). In contrast, EMD is a tail-anchored protein, and interactions mediated by EMD’s nucleoplasmic-facing LEM domain (Figure 8) control its stress-dependent clearance. We do not yet know whether EMD remains associated with other proteins as it transits through the secretory pathway, or what role those associations might play in targeting EMD for degradation.

PrP and EMD also exhibit distinct subcellular localization when not undergoing RESET. Misfolded PrP is retained in the ER network until RESET is initiated, while EMD is enriched in the INM and associated with the nuclear lamina. Importantly, EMD is small enough (~25 kDa) to diffuse freely across the NPC, meaning that it may release INM-localized binding partners and sample the ER with some frequency. This spatial separation between EMD’s normal site of enrichment and its site of ER export may explain the longer timescale of RESET for EMD (2–4 hr) compared to ER-localized misfolded PrP (~1 hr) (Satpute-Krishnan et al., 2014).

Finally, PrP and EMD variants exhibit clear differences in selectivity for the RESET pathway. Only misfolded, ER-retained mutants of PrP are subject to RESET. On the other hand, both wild type EMD (Figure 7) and a less stable disease-linked variant (EMDΔ95–99) are subject to stress-dependent clearance, although EMDΔ95–99 is more rapidly cleared from the NE and ER. Both EMD variants appear functional until ER stress is induced, as judged by their localization and affinity for the INM (Figure 3, Figure 2—figure supplement 1). This suggests that clearance of EMD from the NE/ER is not strictly contingent on protein misfolding.

We find that selective, stress dependent clearance of EMD depends on its 45-amino acid LEM domain. LEM domains bind dynamically to the small soluble protein BAF, which exists in both nuclear and cytoplasmic pools (Shimi et al., 2004). While glycosylation reporters indicate that EMD variants also exit the NE/ER with some frequency under homeostatic conditions (Figure 3H, Figure 7E–F), this is completely abolished by deletion of the LEM domain (Figure 8). One model that could explain the dichotomy between LEM-mediated BAF binding and LEM-mediated ER export is that BAF and ER export-promoting factor(s) bind competitively to the same surface of EMD’s LEM domain (Figure 9). It could be that acute ER stress is relayed to EMD via a structural reorganization or post-translational modification that disrupts the LEM:BAF interface. It is possible that this system could be used to rapidly remove EMD in response to ER stress and potentially other physiological stressors. This could in turn rapidly inhibit the normal functions of EMD at the INM, including participating in mechanosensitive signaling pathways (Guilluy et al., 2014) and contributing to the scaffolding of heterochromatic domains at the nuclear periphery (Demmerle et al., 2013). Overall, our findings indicate that the INM can be rapidly remodeled in response to environmental stimuli, and that the function of the INM protein EMD may be dynamically controlled by integration of environmental inputs via its LEM domain.

Competition model for emerin sorting via its LEM domain competitively binding to BAF or to the ER export machinery.
https://doi.org/10.7554/eLife.49796.020

Notably, muscular dystrophy and cardiomyopathy diseases are caused by loss-of-function mutations to EMD, many of which further destabilize the protein (Bonne and Quijano-Roy, 2013; Fairley et al., 1999). We find evidence that a muscular dystrophy-linked EMD variant (EMDΔ95–99) is more rapidly degraded under acute stress conditions, suggesting that an overzealous response to ER stress could contribute to the pathogenesis of EDMD. EMD is broadly expressed (Uhlen et al., 2015), but mutations predominantly affect muscle tissues. Intriguingly, skeletal muscle undergoes significant ER stress both during development and during normal function (Deldicque et al., 2012). We speculate that these features of muscle physiology may make muscle-localized EMD mutants especially vulnerable to ER stress-induced degradation.

Materials and methods

Key resources table
Reagent
type (species)
or resource
DesignationSource or
reference
IdentifiersAdditional
information
Gene (Mus musculus)emerinNCBI RefSeq NM_007927
Gene (Mus musculus)nurimNCBI RefSeq NM_134122
Gene (Mus musculus)Sun2NCBI RefSeq NM_001205346
Cell line (Mus musculus)C2C12ATCCCRL-1772
Cell line (Homo sapiens)U-2-OSATCCHTB-96
Recombinant DNA reagent (plasmid)pQCXIB vectorCampeau et al. (2009) AddgeneRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)Myc/FLAG RITE vectorToyama et al. (2019)Lentiviral contruct for stable expression of RITE-tagged protein
Recombinant DNA reagent (plasmid)pQCXIB emerin-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-D95-99-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-DLEM-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-GFP-SSNKTVDThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-Δ95–99-GFP-SSNKTVDThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB emerin-ΔLEM-GFP-SSNKTVDThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB Sun2-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)pQCXIB nurim-GFPThis paperRetroviral construct for stable expression
Recombinant DNA reagent (plasmid)Emerin-RITEThis paperLentiviral contruct for stable expression of RITE-tagged protein
Recombinant DNA reagent (plasmid)Nurim-RITEThis paperLentiviral contruct for stable expression of RITE-tagged protein
Recombinant DNA reagent (plasmid)Emerin-Δ95–99-RITEThis paperLentiviral contruct for stable expression of RITE-tagged protein
AntibodyRabbit polyclonal anti-emerinSanta Cruz BiotechnologySc-15378WB (1:1000)
AntibodyGFPAbcamab290Ab uptake (1:500); WB (1:1000)
AntibodyMouse monoclonal anti-FLAGSigma-AldrichF1804IF (1:1000)
AntibodyMouse monoclonal anti-MycCell Signaling2233IF (1:1000); Ab uptake (1:500)
AntibodyMouse monoclonal anti-tubulinSigma-AldrichT5168WB (1:2500)
AntibodygiantinBioLegendPRB-114CIF (1:1000)
AntibodyLAMP1Abcamab24170IF(1:100)
OtherAlexa-647 WGALife TechnologiesW32466IF (5 ug/ml)
Commercial assay or kitPNGase FNEBP0704
Commercial assay or kitEndo HNEBP0702
Chemical compound, drugThapsigarginThermo FisherT7459Used at 100 nM
Chemical compound, drugMG132Cayman Chemical1211877-36-9Used at10 uM
Chemical compound, drugBafilomycin A1BioVioticaBVT-0252Used at100 nM
Chemical compound, drugBrefeldin ATocris1231Used at2.5 uM
Chemical compound, drugLeupeptinSigma-AldrichL5793Used at 125 uM
Chemical compound, drugcycloheximideSigma-AldrichC-7698Used at200 ug/ml
Other13C6-LysineCambridge IsotopesCLM-2247
Other13C6, 15N4-ArginineCambridge IsotopesCNLM-539
OtherLysine/arginine free DMEMThermo Fisher88364
OtherDialyzed fetal bovine serumThermo Fisher26400044
OtherHoechst stainMolecular ProbesH1399Used at 10 ug/ml
Recombinant DNA reagent (plasmid)UBE2G1 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGAAAGACAGCTGGCAGAACTCAATAGTGAAGCCACAGATGTATTGAGTTCTGCCAGCTGTCTTCTGCCTACTGCCTCGGA
Recombinant DNA reagent (plasmid)UBE2G2 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGAACCGGGAGCAGTTCTATAAGATAGTGAAGCCACAGATGTATCTTATAGAACTGCTCCCGGTCTGCCTACTGCCTCGGA
Recombinant DNA reagent (plasmid)UBE2J1 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGAAAGGTTGTCTACTTCACCAGATAGTGAAGCCACAGATGTATCTGGTGAAGTAGACAACCTTCTGCCTACTGCCTCGGA
Recombinant DNA reagent (plasmid)MARCH6 miR-E LT3GEPIRKnott et al., 2014TGCTGTTGACAGTGAGCGACTGGATCTTCATTCTTATTTATAGTGAAGCCACAGATGTATAAATAAGAATGAAGATCCAGCTGCCTACTGCCTCGGA
Software, algorithmFijihttps://fiji.sc/
Software, algorithmRStudiohttps://rstudio.com/

SILAC labeling

Request a detailed protocol

SILAC labeling was performed as a pulse-chase (Ong and Mann, 2006). Proliferating C2C12 mouse myoblasts were subcultured for > 5 population doublings in culture medium containing stable heavy isotopes of lysine and arginine (13C6-Lysine, 13C6, 15N4-Arginine) to completely label the cellular proteome. Cells were grown in SILAC-formulated DMEM lacking lysine and arginine and supplemented with 20% dialyzed FBS, penicillin/streptomycin, and SILAC amino acids. Complete label incorporation was verified by LC-MS/MS. Myoblasts were then grown to confluency and switched to differentiation medium containing heavy isotopes for 5 days to induce myotube differentiation. Differentiation medium contained SILAC DMEM, 2% dialyzed FBS, penicillin/streptomycin, and SILAC amino acids. Media was refreshed every other day. After differentiation, the mature myotube culture was switched to low serum differentiation medium containing the normal isotopes of lysine and arginine: 12C6-Lysine, 12C6, 14N4-Arginine for 1–3 days.

Crude nuclear extracts were prepared similarly to previous work (Buchwalter and Hetzer, 2017; Schirmer et al., 2003). Cells were harvested by scraping into PBS, then swollen in hypotonic lysis buffer (10 mM potassium acetate, 20 mM Tris acetate pH 7.5, 0.5 mM DTT, 1.5 mM MgCl2, and protease inhibitors), followed by mechanical lysis through a 25-gauge needle and syringe. The nuclei were pelleted and the supernatant (containing cytosol) was decanted. Nuclei were then resuspended in buffer containing 10 mM Tris pH 8.0, 10% sucrose, 1 mM DTT, 0.1 mM MgCl2, 20 ug/ml DNase I, and 1 ug/ml RNase I. After nuclease treatment, nuclei were layered on top of a 30% sucrose cushion and pelleted. Crude nuclei were then extracted in 10 mM Tris pH 8, 1% n-octyl glucoside, 400 mM NaCl, and 1 mM DTT, and extracts and pellets were prepared separately for liquid chromatography-mass spectrometry.

Lc-ms/MS

Request a detailed protocol

Samples were denatured in 8M urea/100 mM TEAB, pH 8.5; reduced with TCEP; alkylated with chloroacetamide; and digested overnight with trypsin. Digestion was quenched with 5% formic acid. Detergent was removed from pulse-labeled SILAC samples with SCX tips (EMD Millipore). Samples were run on a Thermo Orbitrap Fusion Tribrid MS/MS with CID fragmentation. The digest was injected directly onto a 30 cm, 75 um ID column packed with BEH 1.7 um C18 resin. Samples were separated at a flow rate of 200 nl/min on a nLC 1000. Buffer A and B were 0.1% formic acid in water and acetonitrile, respectively. A gradient of 1–25% B over 160 min, an increase to 35% B over 60 min, an increase to 90% B over another 10 min and a hold at 90%B for a final 10 min of washing was used for a total run time of 240 min. The column was re-equilibrated with 20 ul of buffer A prior to the injection of sample. Peptides were eluted directly from the tip of the column and nanosprayed into the mass spectrometer by application of 2.5 kV voltage at the back of the column. The Orbitrap Fusion was operated in data dependent mode. Full MS1 scans were collected in the Orbitrap at 120K resolution with a mass range of 400 to 1500 m/z and an AGC target of 4e. The cycle time was set to 3 s, and within this 3 s the most abundant ions per scan were selected for CID MS/MS in the ion trap with an AGC target of 1e and minimum intensity of 5000. Maximum fill times were set to 50 ms and 100 ms for MS and MS/MS scans, respectively. Quadrupole isolation at 1.6 m/z was used, monoisotopic precursor selection was enabled, charge states of 2–7 were selected and dynamic exclusion was used with an exclusion duration of 5 s.

Analysis of proteomic data

Request a detailed protocol

Peptide and protein identification, quantification, and analysis were performed with Integrated Proteomics Pipeline (IP2) (Integrated Proteomics Applications; www.integratedproteomics.com). Tandem mass spectra were extracted from raw files using RawConverter (He et al., 2015) and searched with ProLUCID (Xu et al., 2015) against the mouse UniProt database (ID). The search space included all fully tryptic and half-tryptic peptide candidates. Carbamidomethylation on cysteine was allowed as a static modification. Data were searched with 50 ppm precursor ion tolerance and 600 ppm fragment ion tolerance. Data were filtered to 10 ppm precursor ion tolerance post-search. Identified proteins were filtered using DTASelect (Tabb et al., 2002) and utilizing a target-decoy database strategy to control the false discovery rate to 1% at the protein level.

Census2 (Park et al., 2014) was used for quantitative analysis of SILAC-labeled peptides. Peptides were subjected to stringent quality control criteria before inclusion in half-life determination analyses. Firstly, any peptide with a profile score < 0.8 was discarded. Secondly, peptides were filtered based on the extent of correlation between the heavy and light chromatograms, which is quantified as a regression score in Census. Peptides with extreme area ratios (less than 0.111 or greater than 9) were retained only if their regression score was > 0. Peptides with intermediate area ratios (between 0.111 and 9) were retained only if their regression score was > 0.8.

Half-life calculation

Request a detailed protocol

For estimation of protein half-lives, we restricted our analysis to peptides that were detected in at least three timepoints. 1685 proteins passed this criterion with at least one peptide; individual peptides and protein-level data are reported in Tables S1 and S2, respectively. Area ratio values were transformed into % old values using the following equation:

%old=100(1/(1+AR))

And individual peptides were fit to a line corresponding to the following equation:

Ln(%old)=kt+a

Individual peptide fits with r2 > 0.8 and values of k < 0 were retained for protein-level estimation of half-life. The slope of the fit for all peptides detected were averaged to produce an average value and standard deviation at the protein level. These average slope values were converted to half-life estimates using the equation below.

T1/2=ln(2)/k

These values are reported in Table S3 for 1677 proteins. While calculated half-lives range from ~0.33 days to ~30 days, we note that half-lives at either extreme should be considered rough estimates of protein stability. For illustration, we have included example fits for proteins in Figure S1 with predicted half-lives of 0.5 day, 1 day, 2 days, 4 days, 8 days, and 16 days. Linear regression predicts half-life well under conditions where a line can be fitted with high fidelity and a non-zero slope is detectable. We note the good performance and clear distinctions in slope for proteins with predicted half-lives ranging from 1 to 8 days, and observed more frequent deviations in linearity at the low extreme (predicted T1/2 < 1 day) and slopes approaching zero at the high extreme (predicted T1/2 > 8 days). We expect that these factors limit the precision of half-life determination below 1 day and above 8 days from a 3 day timecourse. Shorter or longer timecourses would be required to investigate turnover at these timescales.

The TMHMM server (Krogh et al., 2001) was used to define the positions of transmembrane domains in INM proteins and infer extraluminal domain sequences.

Plasmid construction

Request a detailed protocol

All emerin constructs are based on the emerin sequence from mouse (Uniprot ID O08579); all nurim constructs based on the nurim sequence from mouse (Uniprot ID Q8VC65); and all Sun2 constructs based on the Sun2 sequence from mouse (Uniprot ID Q8BJS4). Emerin, Sun2, and nurim were each C-terminally tagged with GFP by stitching PCR (Heckman and Pease, 2007), where each open reading frame was amplified with the start codon included and the stop codon omitted, while GFP was amplified with its start codon omitted and stop codon included. Primersets were designed with overhangs including homology between each ORF and GFP, so that a second round of PCR with flanking primers and the first two PCR products used as templates generates an ORF-GFP fusion. EMDΔ95–99 was generated by Quickchange mutagenesis of the emerin-GFP sequence followed by sequence verification. EMDΔLEM-GFP was constructed by stitching PCR of emerin nucleic acid sequence 136–777 corresponding to residues 46–258 of emerin protein with the stop codon omitted. A new ATG start codon was introduced by PCR, and the C-terminal GFP tag introduced by stitching PCR. All ORFs were introduced into the pQCXIB vector (Campeau et al., 2009) for retroviral delivery and constitutive expression under a CMV promoter by Gateway cloning.

INM-RITE tag plasmids were constructed as described in Toyama et al. (2019). ORFs of interest were introduced into the FLAG/myc-RITE or myc/FLAG-RITE plasmid backbones, then the entire ORF-RITE construct was amplified and recombined into a pDONR207 Gateway entry vector, followed by recombination into the pQCXIB retroviral vector for constitutive mammalian expression.

Glycosylation reporter plasmids were constructed by introducing a 21 base-pair sequence encoding the glycosylation acceptor site SSNKTVD within a 3’ PCR primer for amplification of EMD-WT-GFP, EMDΔYEESY-GFP, and EMDΔLEM-GFP. The resulting PCR product was inserted into the pQCXIB vector by Gateway cloning. Sequence verified clones were used for stable cell line generation.

UBE2G1, UBE2G2, UBE2J1, and MARCH6 miR-E inducible RNAi plasmids were constructed as described in Fellmann et al. (2013). Validated shRNA sequences with the highest score for targeting mouse UBE2G1, UBE2G2, UBE2J1, and MARCH6 were selected from the shERWOOD database (www.sherwood.cshl.edu), and ~100 bp oligonucleotides with the corresponding sequence were synthesized. This sequence was amplified by PCR using degenerate primers with XhoI and EcoRI restriction sites. The PCR was digested with XhoI and EcoRI, gel purified, and ligated into the LT3GEPIR lentiviral vector for doxycycline-inducible RNAi expression with GFP reporter fluorescence. The LT3GEPIR vector was the kind gift of Johannes Zuber.

Cell line generation

Request a detailed protocol

GFP-tagged cell lines were generated in C2C12 mouse myoblasts. Low-passage C2C12 cells were obtained from ATCC, and identity was validated by a functional assay: cells were grown to confluency, switched to low serum medium for several days, and evaluated for the formation of multinucleated myotubes. Parallel cultures of C2C12 cells were infected with virus encoding GFP fusion proteins. 293 T cells were transfected with delivery vectors and viral packaging vectors for retroviral or lentiviral production. Conditioned media were collected 48–72 hr after transfection and applied to low-passage C2C12 cells in the presence of polybrene. Integrated clones were selected using the relevant antibiotic selections for each vector backbone. Fluorescent cell populations were isolated by FACS. The resulting stable GFP-expressing C2C12 cell lines were tested to verify the absence of mycoplasma contamination. miR-E RNAi cell lines were generated in U2OS cells. U2OS cells were obtained from ATCC and were periodically tested for mycoplasma contamination. EMDΔ95–99-GFP was introduced by retroviral infection and FACS sorted as described above. miR-E RNAi expression vectors were then introduced into these stable cell lines by lentiviral infection.

RITE tag switching

Request a detailed protocol

RITE tag switching experiments were performed in quiescent C2C12 cells stably expressing RITE-tagged INM proteins. C2C12s were grown in Ibidi chamber slides and induced to enter quiescence as previously described (Zhang et al., 2010) by growing C2C12 myoblasts to ~ 75% confluence, washing twice in warm PBS, and switching to quiescent medium (DMEM without methionine, 2% FBS, and pen-strep). Cells were maintained in quiescent medium for 3 days with media changes every other day before initiation of RITE timecourses. To induce tag exchange, concentrated adenovirus expressing Cre recombinase was added to the culture medium. Tag switching was initiated at the indicated timepoints such that the entire slide containing all time points could be fixed, stained, imaged, and quantified in parallel. To quantify loss of ‘old’ RITE-tagged protein over time, intensity per unit area of the ‘old’ tag was quantified across all conditions. Background measurements were taken from cell-free regions of the imaging dish and subtracted from all signals as a background correction. All signals were then normalized to the day 0 timepoint (no tag switch).

Antibody uptake assays

Request a detailed protocol

For antibody uptake assays, cells were pre-treated with drugs for the indicated times, then incubated in medium containing antibody, drug, and 125 μM leupeptin for 1 hr before fixation in paraformaldehyde and staining. Cells were stained with Alexa Fluor-conjugated secondary antibody to visualize internalized primary antibody:GFP conjugates. Cell surfaces were stained with Alexa Fluor-conjugated WGA; the WGA signal was used as a guide for outlining individual cells and quantifying internalized antibody fluorescence.

Preparation of protein lysates and western blotting

Request a detailed protocol

Cells were washed in PBS, then lysed directly in plates in PBS lysis buffer (PBS supplemented with 1% Triton-X-100, 0.1% SDS, and protease inhibitors). Cells were further lysed by passage through a 25-gauge needle. Protein concentrations were quantified by BCA assay, and ~20 ug of total protein was loaded per lane of 4–12% gradient gels (Invitrogen). Blots were incubated with emerin antibody (1:1000) or alpha-tubulin antibody (1:5000) followed by IR Dye-conjugated secondary antibodies (1:5000) for multiplexed detection on the Odyssey imaging system.

Microscopy and image analysis

Request a detailed protocol

Cells were grown in Ibidi culture chambers, treated as indicated, and fixed in 4% PFA for 5 min, then permeabilized in IF buffer (PBS, 0.1% Tx100, 0.02% SDS, 10 mg/ml BSA) before staining with Hoechst DNA dye. Wells were rinsed in PBS before imaging on a Zeiss LSM 710 scanning confocal microscope with a 63 × 1.4 NA objective. Images shown are single confocal slices. All image quantification was performed on maximum intensity projections of z-series with ImageJ. To quantify NE-localized protein levels, the DNA stain was used as a mask, and all GFP fluorescence within that mask was quantified.

For lysosomal staining, cells were prepared as described (Castellano et al., 2017) with the following modifications. Following fixation in 4% PFA for 5 min, cells were rinsed in PBS, then permeabilized in freshly prepared 0.1% digitonin in PBS for 10 min at 4C. Cells were rinsed again in PBS, then blocked in 2% goat serum in PBS for 30 min before staining with LAMP1 antibody (1:100 in 2% goat serum) for 1–2 hr at RT. Cells were rinsed again in PBS, then stained with Alexa Fluor-conjugated secondary antibody and Hoechst DNA stain for 1 hr at RT.

References

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
    Trafficking of tail-anchored proteins: transport from the endoplasmic reticulum to the plasma membrane and sorting between surface domains in polarised epithelial cells
    1. A Bulbarelli
    2. T Sprocati
    3. M Barberi
    4. E Pedrazzini
    5. N Borgese
    (2002)
    Journal of Cell Science 115:1689–1702.
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
    The Emery-Dreifuss muscular dystrophy phenotype arises from aberrant targeting and binding of emerin at the inner nuclear membrane
    1. EA Fairley
    2. J Kendrick-Jones
    3. JA Ellis
    (1999)
    Journal of Cell Science 112 ( Pt 15:2571–2582.
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
    Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition)
    1. DJ Klionsky
    2. K Abdelmohsen
    3. A Abe
    4. MJ Abedin
    5. H Abeliovich
    6. A Acevedo Arozena
    7. H Adachi
    8. CM Adams
    9. PD Adams
    10. K Adeli
    11. PJ Adhihetty
    12. SG Adler
    13. G Agam
    14. R Agarwal
    15. MK Aghi
    16. M Agnello
    17. P Agostinis
    18. PV Aguilar
    19. J Aguirre-Ghiso
    20. EM Airoldi
    21. S Ait-Si-Ali
    22. T Akematsu
    23. ET Akporiaye
    24. M Al-Rubeai
    25. GM Albaiceta
    26. C Albanese
    27. D Albani
    28. ML Albert
    29. J Aldudo
    30. H Algül
    31. M Alirezaei
    32. I Alloza
    33. A Almasan
    34. M Almonte-Beceril
    35. ES Alnemri
    36. C Alonso
    37. N Altan-Bonnet
    38. DC Altieri
    39. S Alvarez
    40. L Alvarez-Erviti
    41. S Alves
    42. G Amadoro
    43. A Amano
    44. C Amantini
    45. S Ambrosio
    46. I Amelio
    47. AO Amer
    48. M Amessou
    49. A Amon
    50. Z An
    51. FA Anania
    52. SU Andersen
    53. UP Andley
    54. CK Andreadi
    55. N Andrieu-Abadie
    56. A Anel
    57. DK Ann
    58. S Anoopkumar-Dukie
    59. M Antonioli
    60. H Aoki
    61. N Apostolova
    62. S Aquila
    63. K Aquilano
    64. K Araki
    65. E Arama
    66. A Aranda
    67. J Araya
    68. A Arcaro
    69. E Arias
    70. H Arimoto
    71. AR Ariosa
    72. JL Armstrong
    73. T Arnould
    74. I Arsov
    75. K Asanuma
    76. V Askanas
    77. E Asselin
    78. R Atarashi
    79. SS Atherton
    80. JD Atkin
    81. LD Attardi
    82. P Auberger
    83. G Auburger
    84. L Aurelian
    85. R Autelli
    86. L Avagliano
    87. ML Avantaggiati
    88. L Avrahami
    89. S Awale
    90. N Azad
    91. T Bachetti
    92. JM Backer
    93. D-H Bae
    94. J-sung Bae
    95. O-N Bae
    96. SH Bae
    97. EH Baehrecke
    98. S-H Baek
    99. S Baghdiguian
    100. A Bagniewska-Zadworna
    101. H Bai
    102. J Bai
    103. X-Y Bai
    104. Y Bailly
    105. KN Balaji
    106. W Balduini
    107. A Ballabio
    108. R Balzan
    109. R Banerjee
    110. G Bánhegyi
    111. H Bao
    112. B Barbeau
    113. MD Barrachina
    114. E Barreiro
    115. B Bartel
    116. A Bartolomé
    117. DC Bassham
    118. MT Bassi
    119. RC Bast
    120. A Basu
    121. MT Batista
    122. H Batoko
    123. M Battino
    124. K Bauckman
    125. BL Baumgarner
    126. KU Bayer
    127. R Beale
    128. J-F Beaulieu
    129. GR Beck
    130. C Becker
    131. JD Beckham
    132. P-A Bédard
    133. PJ Bednarski
    134. TJ Begley
    135. C Behl
    136. C Behrends
    137. GMN Behrens
    138. KE Behrns
    139. E Bejarano
    140. A Belaid
    141. F Belleudi
    142. G Bénard
    143. G Berchem
    144. D Bergamaschi
    145. M Bergami
    146. B Berkhout
    147. L Berliocchi
    148. A Bernard
    149. M Bernard
    150. F Bernassola
    151. A Bertolotti
    152. AS Bess
    153. S Besteiro
    154. S Bettuzzi
    155. S Bhalla
    156. S Bhattacharyya
    157. SK Bhutia
    158. C Biagosch
    159. MW Bianchi
    160. M Biard-Piechaczyk
    161. V Billes
    162. C Bincoletto
    163. B Bingol
    164. SW Bird
    165. M Bitoun
    166. I Bjedov
    167. C Blackstone
    168. L Blanc
    169. GA Blanco
    170. HK Blomhoff
    171. E Boada-Romero
    172. S Böckler
    173. M Boes
    174. K Boesze-Battaglia
    175. LH Boise
    176. A Bolino
    177. A Boman
    178. P Bonaldo
    179. M Bordi
    180. J Bosch
    181. LM Botana
    182. J Botti
    183. G Bou
    184. M Bouché
    185. M Bouchecareilh
    186. M-J Boucher
    187. ME Boulton
    188. SG Bouret
    189. P Boya
    190. M Boyer-Guittaut
    191. PV Bozhkov
    192. N Brady
    193. VMM Braga
    194. C Brancolini
    195. GH Braus
    196. JM Bravo-San Pedro
    197. LA Brennan
    198. EH Bresnick
    199. P Brest
    200. D Bridges
    201. M-A Bringer
    202. M Brini
    203. GC Brito
    204. B Brodin
    205. PS Brookes
    206. EJ Brown
    207. K Brown
    208. HE Broxmeyer
    209. A Bruhat
    210. PC Brum
    211. JH Brumell
    212. N Brunetti-Pierri
    213. RJ Bryson-Richardson
    214. S Buch
    215. AM Buchan
    216. H Budak
    217. DV Bulavin
    218. SJ Bultman
    219. G Bultynck
    220. V Bumbasirevic
    221. Y Burelle
    222. RE Burke
    223. M Burmeister
    224. P Bütikofer
    225. L Caberlotto
    226. K Cadwell
    227. M Cahova
    228. D Cai
    229. J Cai
    230. Q Cai
    231. S Calatayud
    232. N Camougrand
    233. M Campanella
    234. GR Campbell
    235. M Campbell
    236. S Campello
    237. R Candau
    238. I Caniggia
    239. L Cantoni
    240. L Cao
    241. AB Caplan
    242. M Caraglia
    243. C Cardinali
    244. SM Cardoso
    245. JS Carew
    246. LA Carleton
    247. CR Carlin
    248. S Carloni
    249. SR Carlsson
    250. D Carmona-Gutierrez
    251. LAM Carneiro
    252. O Carnevali
    253. S Carra
    254. A Carrier
    255. B Carroll
    256. C Casas
    257. J Casas
    258. G Cassinelli
    259. P Castets
    260. S Castro-Obregon
    261. G Cavallini
    262. I Ceccherini
    263. F Cecconi
    264. AI Cederbaum
    265. V Ceña
    266. S Cenci
    267. C Cerella
    268. D Cervia
    269. S Cetrullo
    270. H Chaachouay
    271. H-J Chae
    272. AS Chagin
    273. C-Y Chai
    274. G Chakrabarti
    275. G Chamilos
    276. EYW Chan
    277. MTV Chan
    278. D Chandra
    279. P Chandra
    280. C-P Chang
    281. RC-C Chang
    282. TY Chang
    283. JC Chatham
    284. S Chatterjee
    285. S Chauhan
    286. Y Che
    287. ME Cheetham
    288. R Cheluvappa
    289. C-J Chen
    290. G Chen
    291. G-C Chen
    292. G Chen
    293. H Chen
    294. JW Chen
    295. J-K Chen
    296. M Chen
    297. M Chen
    298. P Chen
    299. Q Chen
    300. Q Chen
    301. S-D Chen
    302. S Chen
    303. SS-L Chen
    304. W Chen
    305. W-J Chen
    306. WQ Chen
    307. W Chen
    308. X Chen
    309. Y-H Chen
    310. Y-G Chen
    311. Y Chen
    312. Y Chen
    313. Y Chen
    314. Y-J Chen
    315. Y-Q Chen
    316. Y Chen
    317. Z Chen
    318. Z Chen
    319. A Cheng
    320. CHK Cheng
    321. H Cheng
    322. H Cheong
    323. S Cherry
    324. J Chesney
    325. CHA Cheung
    326. E Chevet
    327. HC Chi
    328. S-G Chi
    329. F Chiacchiera
    330. H-L Chiang
    331. R Chiarelli
    332. M Chiariello
    333. M Chieppa
    334. L-S Chin
    335. M Chiong
    336. GNC Chiu
    337. D-H Cho
    338. S-G Cho
    339. WC Cho
    340. Y-Y Cho
    341. Y-S Cho
    342. AMK Choi
    343. E-J Choi
    344. E-K Choi
    345. J Choi
    346. ME Choi
    347. S-I Choi
    348. T-F Chou
    349. S Chouaib
    350. D Choubey
    351. V Choubey
    352. K-C Chow
    353. K Chowdhury
    354. CT Chu
    355. T-H Chuang
    356. T Chun
    357. H Chung
    358. T Chung
    359. Y-L Chung
    360. Y-J Chwae
    361. V Cianfanelli
    362. R Ciarcia
    363. IA Ciechomska
    364. MR Ciriolo
    365. M Cirone
    366. S Claerhout
    367. MJ Clague
    368. J Clària
    369. PGH Clarke
    370. R Clarke
    371. E Clementi
    372. C Cleyrat
    373. M Cnop
    374. EM Coccia
    375. T Cocco
    376. P Codogno
    377. J Coers
    378. EEW Cohen
    379. D Colecchia
    380. L Coletto
    381. NS Coll
    382. E Colucci-Guyon
    383. S Comincini
    384. M Condello
    385. KL Cook
    386. GH Coombs
    387. CD Cooper
    388. JM Cooper
    389. I Coppens
    390. MT Corasaniti
    391. M Corazzari
    392. R Corbalan
    393. E Corcelle-Termeau
    394. MD Cordero
    395. C Corral-Ramos
    396. O Corti
    397. A Cossarizza
    398. P Costelli
    399. S Costes
    400. SL Cotman
    401. A Coto-Montes
    402. S Cottet
    403. E Couve
    404. LR Covey
    405. LA Cowart
    406. JS Cox
    407. FP Coxon
    408. CB Coyne
    409. MS Cragg
    410. RJ Craven
    411. T Crepaldi
    412. JL Crespo
    413. A Criollo
    414. V Crippa
    415. MT Cruz
    416. AM Cuervo
    417. JM Cuezva
    418. T Cui
    419. PR Cutillas
    420. MJ Czaja
    421. MF Czyzyk-Krzeska
    422. RK Dagda
    423. U Dahmen
    424. C Dai
    425. W Dai
    426. Y Dai
    427. KN Dalby
    428. L Dalla Valle
    429. G Dalmasso
    430. M D'Amelio
    431. M Damme
    432. A Darfeuille-Michaud
    433. C Dargemont
    434. VM Darley-Usmar
    435. S Dasarathy
    436. B Dasgupta
    437. S Dash
    438. CR Dass
    439. HM Davey
    440. LM Davids
    441. D Dávila
    442. RJ Davis
    443. TM Dawson
    444. VL Dawson
    445. P Daza
    446. J de Belleroche
    447. P de Figueiredo
    448. RCBQ de Figueiredo
    449. J de la Fuente
    450. L De Martino
    451. A De Matteis
    452. GRY De Meyer
    453. A De Milito
    454. M De Santi
    455. W de Souza
    456. V De Tata
    457. D De Zio
    458. J Debnath
    459. R Dechant
    460. J-P Decuypere
    461. S Deegan
    462. B Dehay
    463. B Del Bello
    464. DP Del Re
    465. R Delage-Mourroux
    466. LMD Delbridge
    467. L Deldicque
    468. E Delorme-Axford
    469. Y Deng
    470. J Dengjel
    471. M Denizot
    472. P Dent
    473. CJ Der
    474. V Deretic
    475. B Derrien
    476. E Deutsch
    477. TP Devarenne
    478. RJ Devenish
    479. S Di Bartolomeo
    480. N Di Daniele
    481. F Di Domenico
    482. A Di Nardo
    483. S Di Paola
    484. A Di Pietro
    485. L Di Renzo
    486. A DiAntonio
    487. G Díaz-Araya
    488. I Díaz-Laviada
    489. MT Diaz-Meco
    490. J Diaz-Nido
    491. CA Dickey
    492. RC Dickson
    493. M Diederich
    494. P Digard
    495. I Dikic
    496. SP Dinesh-Kumar
    497. C Ding
    498. W-X Ding
    499. Z Ding
    500. L Dini
    501. JHW Distler
    502. A Diwan
    503. M Djavaheri-Mergny
    504. K Dmytruk
    505. RCJ Dobson
    506. V Doetsch
    507. K Dokladny
    508. S Dokudovskaya
    509. M Donadelli
    510. XC Dong
    511. X Dong
    512. Z Dong
    513. TM Donohue
    514. KS Doran
    515. G D'Orazi
    516. GW Dorn
    517. V Dosenko
    518. S Dridi
    519. L Drucker
    520. J Du
    521. L-L Du
    522. L Du
    523. A du Toit
    524. P Dua
    525. L Duan
    526. P Duann
    527. VK Dubey
    528. MR Duchen
    529. MA Duchosal
    530. H Duez
    531. I Dugail
    532. VI Dumit
    533. MC Duncan
    534. EA Dunlop
    535. WA Dunn
    536. N Dupont
    537. L Dupuis
    538. RV Durán
    539. TM Durcan
    540. S Duvezin-Caubet
    541. U Duvvuri
    542. V Eapen
    543. D Ebrahimi-Fakhari
    544. A Echard
    545. L Eckhart
    546. CL Edelstein
    547. AL Edinger
    548. L Eichinger
    549. T Eisenberg
    550. A Eisenberg-Lerner
    551. NT Eissa
    552. WS El-Deiry
    553. V El-Khoury
    554. Z Elazar
    555. H Eldar-Finkelman
    556. CJH Elliott
    557. E Emanuele
    558. U Emmenegger
    559. N Engedal
    560. A-M Engelbrecht
    561. S Engelender
    562. JM Enserink
    563. R Erdmann
    564. J Erenpreisa
    565. R Eri
    566. JL Eriksen
    567. A Erman
    568. R Escalante
    569. E-L Eskelinen
    570. L Espert
    571. L Esteban-Martínez
    572. TJ Evans
    573. M Fabri
    574. G Fabrias
    575. C Fabrizi
    576. A Facchiano
    577. NJ Færgeman
    578. A Faggioni
    579. WD Fairlie
    580. C Fan
    581. D Fan
    582. J Fan
    583. S Fang
    584. M Fanto
    585. A Fanzani
    586. T Farkas
    587. M Faure
    588. FB Favier
    589. H Fearnhead
    590. M Federici
    591. E Fei
    592. TC Felizardo
    593. H Feng
    594. Y Feng
    595. Y Feng
    596. TA Ferguson
    597. Álvaro F Fernández
    598. MG Fernandez-Barrena
    599. JC Fernandez-Checa
    600. A Fernández-López
    601. ME Fernandez-Zapico
    602. O Feron
    603. E Ferraro
    604. CV Ferreira-Halder
    605. L Fesus
    606. R Feuer
    607. FC Fiesel
    608. EC Filippi-Chiela
    609. G Filomeni
    610. GM Fimia
    611. JH Fingert
    612. S Finkbeiner
    613. T Finkel
    614. F Fiorito
    615. PB Fisher
    616. M Flajolet
    617. F Flamigni
    618. O Florey
    619. S Florio
    620. RA Floto
    621. M Folini
    622. C Follo
    623. EA Fon
    624. F Fornai
    625. F Fortunato
    626. A Fraldi
    627. R Franco
    628. A Francois
    629. A François
    630. LB Frankel
    631. IDC Fraser
    632. N Frey
    633. DG Freyssenet
    634. C Frezza
    635. SL Friedman
    636. DE Frigo
    637. D Fu
    638. JM Fuentes
    639. J Fueyo
    640. Y Fujitani
    641. Y Fujiwara
    642. M Fujiya
    643. M Fukuda
    644. S Fulda
    645. C Fusco
    646. B Gabryel
    647. M Gaestel
    648. P Gailly
    649. M Gajewska
    650. S Galadari
    651. G Galili
    652. I Galindo
    653. MF Galindo
    654. G Galliciotti
    655. L Galluzzi
    656. L Galluzzi
    657. V Galy
    658. N Gammoh
    659. S Gandy
    660. AK Ganesan
    661. S Ganesan
    662. IG Ganley
    663. M Gannagé
    664. F-B Gao
    665. F Gao
    666. J-X Gao
    667. L García Nannig
    668. E García Véscovi
    669. M Garcia-Macía
    670. C Garcia-Ruiz
    671. AD Garg
    672. PK Garg
    673. R Gargini
    674. NC Gassen
    675. D Gatica
    676. E Gatti
    677. J Gavard
    678. E Gavathiotis
    679. L Ge
    680. P Ge
    681. S Ge
    682. P-W Gean
    683. V Gelmetti
    684. AA Genazzani
    685. J Geng
    686. P Genschik
    687. L Gerner
    688. JE Gestwicki
    689. DA Gewirtz
    690. S Ghavami
    691. E Ghigo
    692. D Ghosh
    693. AM Giammarioli
    694. F Giampieri
    695. C Giampietri
    696. A Giatromanolaki
    697. DJ Gibbings
    698. L Gibellini
    699. SB Gibson
    700. V Ginet
    701. A Giordano
    702. F Giorgini
    703. E Giovannetti
    704. SE Girardin
    705. S Gispert
    706. S Giuliano
    707. CL Gladson
    708. A Glavic
    709. M Gleave
    710. N Godefroy
    711. RM Gogal
    712. K Gokulan
    713. GH Goldman
    714. D Goletti
    715. MS Goligorsky
    716. AV Gomes
    717. LC Gomes
    718. H Gomez
    719. C Gomez-Manzano
    720. R Gómez-Sánchez
    721. DAP Gonçalves
    722. E Goncu
    723. Q Gong
    724. C Gongora
    725. CB Gonzalez
    726. P Gonzalez-Alegre
    727. P Gonzalez-Cabo
    728. RA González-Polo
    729. IS Goping
    730. C Gorbea
    731. NV Gorbunov
    732. DR Goring
    733. AM Gorman
    734. SM Gorski
    735. S Goruppi
    736. S Goto-Yamada
    737. C Gotor
    738. RA Gottlieb
    739. I Gozes
    740. D Gozuacik
    741. Y Graba
    742. M Graef
    743. GE Granato
    744. GD Grant
    745. S Grant
    746. GL Gravina
    747. DR Green
    748. A Greenhough
    749. MT Greenwood
    750. B Grimaldi
    751. F Gros
    752. C Grose
    753. J-F Groulx
    754. F Gruber
    755. P Grumati
    756. T Grune
    757. J-L Guan
    758. K-L Guan
    759. B Guerra
    760. C Guillen
    761. K Gulshan
    762. J Gunst
    763. C Guo
    764. L Guo
    765. M Guo
    766. W Guo
    767. X-G Guo
    768. AA Gust
    769. Åsa B Gustafsson
    770. E Gutierrez
    771. MG Gutierrez
    772. H-S Gwak
    773. A Haas
    774. JE Haber
    775. S Hadano
    776. M Hagedorn
    777. DR Hahn
    778. AJ Halayko
    779. A Hamacher-Brady
    780. K Hamada
    781. A Hamai
    782. A Hamann
    783. M Hamasaki
    784. I Hamer
    785. Q Hamid
    786. EM Hammond
    787. F Han
    788. W Han
    789. JT Handa
    790. JA Hanover
    791. M Hansen
    792. M Harada
    793. L Harhaji-Trajkovic
    794. JW Harper
    795. AH Harrath
    796. AL Harris
    797. J Harris
    798. U Hasler
    799. P Hasselblatt
    800. K Hasui
    801. RG Hawley
    802. TS Hawley
    803. C He
    804. CY He
    805. F He
    806. G He
    807. R-R He
    808. X-H He
    809. Y-W He
    810. Y-Y He
    811. JK Heath
    812. M-J Hébert
    813. RA Heinzen
    814. GV Helgason
    815. M Hensel
    816. EP Henske
    817. C Her
    818. PK Herman
    819. A Hernández
    820. C Hernandez
    821. S Hernández-Tiedra
    822. C Hetz
    823. PR Hiesinger
    824. K Higaki
    825. S Hilfiker
    826. BG Hill
    827. JA Hill
    828. WD Hill
    829. K Hino
    830. D Hofius
    831. P Hofman
    832. GU Höglinger
    833. J Höhfeld
    834. MK Holz
    835. Y Hong
    836. DA Hood
    837. JJM Hoozemans
    838. T Hoppe
    839. C Hsu
    840. C-Y Hsu
    841. L-C Hsu
    842. D Hu
    843. G Hu
    844. H-M Hu
    845. H Hu
    846. MC Hu
    847. Y-C Hu
    848. Z-W Hu
    849. F Hua
    850. Y Hua
    851. C Huang
    852. H-L Huang
    853. K-H Huang
    854. K-Y Huang
    855. S Huang
    856. S Huang
    857. W-P Huang
    858. Y-R Huang
    859. Y Huang
    860. Y Huang
    861. TB Huber
    862. P Huebbe
    863. W-K Huh
    864. JJ Hulmi
    865. GM Hur
    866. JH Hurley
    867. Z Husak
    868. SNA Hussain
    869. S Hussain
    870. JJ Hwang
    871. S Hwang
    872. TIS Hwang
    873. A Ichihara
    874. Y Imai
    875. C Imbriano
    876. M Inomata
    877. T Into
    878. V Iovane
    879. JL Iovanna
    880. RV Iozzo
    881. NY Ip
    882. JE Irazoqui
    883. P Iribarren
    884. Y Isaka
    885. AJ Isakovic
    886. H Ischiropoulos
    887. JS Isenberg
    888. M Ishaq
    889. H Ishida
    890. I Ishii
    891. JE Ishmael
    892. C Isidoro
    893. K-ichi Isobe
    894. E Isono
    895. S Issazadeh-Navikas
    896. K Itahana
    897. E Itakura
    898. AI Ivanov
    899. AKV Iyer
    900. JM Izquierdo
    901. Y Izumi
    902. V Izzo
    903. M Jäättelä
    904. N Jaber
    905. DJ Jackson
    906. WT Jackson
    907. TG Jacob
    908. TS Jacques
    909. C Jagannath
    910. A Jain
    911. NR Jana
    912. BK Jang
    913. A Jani
    914. B Janji
    915. PR Jannig
    916. PJ Jansson
    917. S Jean
    918. M Jendrach
    919. J-H Jeon
    920. N Jessen
    921. E-B Jeung
    922. K Jia
    923. L Jia
    924. H Jiang
    925. H Jiang
    926. L Jiang
    927. T Jiang
    928. X Jiang
    929. X Jiang
    930. X Jiang
    931. Y Jiang
    932. Y Jiang
    933. A Jiménez
    934. C Jin
    935. H Jin
    936. L Jin
    937. M Jin
    938. S Jin
    939. UK Jinwal
    940. E-K Jo
    941. T Johansen
    942. DE Johnson
    943. GVW Johnson
    944. JD Johnson
    945. E Jonasch
    946. C Jones
    947. LAB Joosten
    948. J Jordan
    949. A-M Joseph
    950. B Joseph
    951. AM Joubert
    952. D Ju
    953. J Ju
    954. H-F Juan
    955. K Juenemann
    956. G Juhász
    957. HS Jung
    958. JU Jung
    959. Y-K Jung
    960. H Jungbluth
    961. MJ Justice
    962. B Jutten
    963. NO Kaakoush
    964. K Kaarniranta
    965. A Kaasik
    966. T Kabuta
    967. B Kaeffer
    968. K Kågedal
    969. A Kahana
    970. S Kajimura
    971. O Kakhlon
    972. M Kalia
    973. DV Kalvakolanu
    974. Y Kamada
    975. K Kambas
    976. VO Kaminskyy
    977. HH Kampinga
    978. M Kandouz
    979. C Kang
    980. R Kang
    981. T-C Kang
    982. T Kanki
    983. T-D Kanneganti
    984. H Kanno
    985. AG Kanthasamy
    986. M Kantorow
    987. M Kaparakis-Liaskos
    988. O Kapuy
    989. V Karantza
    990. MR Karim
    991. P Karmakar
    992. A Kaser
    993. S Kaushik
    994. T Kawula
    995. AM Kaynar
    996. P-Y Ke
    997. Z-J Ke
    998. JH Kehrl
    999. KE Keller
    1000. JK Kemper
    1001. AK Kenworthy
    1002. O Kepp
    1003. A Kern
    1004. S Kesari
    1005. D Kessel
    1006. R Ketteler
    1007. IdoC Kettelhut
    1008. B Khambu
    1009. MM Khan
    1010. VKM Khandelwal
    1011. S Khare
    1012. JG Kiang
    1013. AA Kiger
    1014. A Kihara
    1015. AL Kim
    1016. CH Kim
    1017. DR Kim
    1018. D-H Kim
    1019. EK Kim
    1020. HY Kim
    1021. H-R Kim
    1022. J-S Kim
    1023. JH Kim
    1024. JC Kim
    1025. JH Kim
    1026. KW Kim
    1027. MD Kim
    1028. M-M Kim
    1029. PK Kim
    1030. SW Kim
    1031. S-Y Kim
    1032. Y-S Kim
    1033. Y Kim
    1034. A Kimchi
    1035. AC Kimmelman
    1036. T Kimura
    1037. JS King
    1038. K Kirkegaard
    1039. V Kirkin
    1040. LA Kirshenbaum
    1041. S Kishi
    1042. Y Kitajima
    1043. K Kitamoto
    1044. Y Kitaoka
    1045. K Kitazato
    1046. RA Kley
    1047. WT Klimecki
    1048. M Klinkenberg
    1049. J Klucken
    1050. H Knævelsrud
    1051. E Knecht
    1052. L Knuppertz
    1053. J-L Ko
    1054. S Kobayashi
    1055. JC Koch
    1056. C Koechlin-Ramonatxo
    1057. U Koenig
    1058. YH Koh
    1059. K Köhler
    1060. SD Kohlwein
    1061. M Koike
    1062. M Komatsu
    1063. E Kominami
    1064. D Kong
    1065. HJ Kong
    1066. EG Konstantakou
    1067. BT Kopp
    1068. T Korcsmaros
    1069. L Korhonen
    1070. VI Korolchuk
    1071. NV Koshkina
    1072. Y Kou
    1073. MI Koukourakis
    1074. C Koumenis
    1075. AL Kovács
    1076. T Kovács
    1077. WJ Kovacs
    1078. D Koya
    1079. C Kraft
    1080. D Krainc
    1081. H Kramer
    1082. T Kravic-Stevovic
    1083. W Krek
    1084. C Kretz-Remy
    1085. R Krick
    1086. M Krishnamurthy
    1087. J Kriston-Vizi
    1088. G Kroemer
    1089. MC Kruer
    1090. R Kruger
    1091. NT Ktistakis
    1092. K Kuchitsu
    1093. C Kuhn
    1094. AP Kumar
    1095. A Kumar
    1096. A Kumar
    1097. D Kumar
    1098. D Kumar
    1099. R Kumar
    1100. S Kumar
    1101. M Kundu
    1102. H-J Kung
    1103. A Kuno
    1104. S-H Kuo
    1105. J Kuret
    1106. T Kurz
    1107. T Kwok
    1108. TK Kwon
    1109. YT Kwon
    1110. I Kyrmizi
    1111. AR La Spada
    1112. F Lafont
    1113. T Lahm
    1114. A Lakkaraju
    1115. T Lam
    1116. T Lamark
    1117. S Lancel
    1118. TH Landowski
    1119. DJR Lane
    1120. JD Lane
    1121. C Lanzi
    1122. P Lapaquette
    1123. LR Lapierre
    1124. J Laporte
    1125. J Laukkarinen
    1126. GW Laurie
    1127. S Lavandero
    1128. L Lavie
    1129. MJ LaVoie
    1130. BYK Law
    1131. HK-wai Law
    1132. KB Law
    1133. R Layfield
    1134. PA Lazo
    1135. L Le Cam
    1136. KG Le Roch
    1137. H Le Stunff
    1138. V Leardkamolkarn
    1139. M Lecuit
    1140. B-H Lee
    1141. C-H Lee
    1142. EF Lee
    1143. GM Lee
    1144. H-J Lee
    1145. H Lee
    1146. JK Lee
    1147. J Lee
    1148. J-hyun Lee
    1149. JH Lee
    1150. M Lee
    1151. M-S Lee
    1152. PJ Lee
    1153. SW Lee
    1154. S-J Lee
    1155. S-J Lee
    1156. SY Lee
    1157. SH Lee
    1158. SS Lee
    1159. S-J Lee
    1160. S Lee
    1161. Y-R Lee
    1162. YJ Lee
    1163. YH Lee
    1164. C Leeuwenburgh
    1165. S Lefort
    1166. R Legouis
    1167. J Lei
    1168. Q-Y Lei
    1169. DA Leib
    1170. G Leibowitz
    1171. I Lekli
    1172. SD Lemaire
    1173. JJ Lemasters
    1174. MK Lemberg
    1175. A Lemoine
    1176. S Leng
    1177. G Lenz
    1178. P Lenzi
    1179. LO Lerman
    1180. D Lettieri Barbato
    1181. JI-J Leu
    1182. HY Leung
    1183. B Levine
    1184. PA Lewis
    1185. F Lezoualc'h
    1186. C Li
    1187. F Li
    1188. F-J Li
    1189. J Li
    1190. K Li
    1191. L Li
    1192. M Li
    1193. M Li
    1194. Q Li
    1195. R Li
    1196. S Li
    1197. W Li
    1198. W Li
    1199. X Li
    1200. Y Li
    1201. J Lian
    1202. C Liang
    1203. Q Liang
    1204. Y Liao
    1205. J Liberal
    1206. PP Liberski
    1207. P Lie
    1208. AP Lieberman
    1209. HJ Lim
    1210. K-L Lim
    1211. K Lim
    1212. RT Lima
    1213. C-S Lin
    1214. C-F Lin
    1215. F Lin
    1216. F Lin
    1217. F-C Lin
    1218. K Lin
    1219. K-H Lin
    1220. P-H Lin
    1221. T Lin
    1222. W-W Lin
    1223. Y-S Lin
    1224. Y Lin
    1225. R Linden
    1226. D Lindholm
    1227. LM Lindqvist
    1228. P Lingor
    1229. A Linkermann
    1230. LA Liotta
    1231. MM Lipinski
    1232. VA Lira
    1233. MP Lisanti
    1234. PB Liton
    1235. B Liu
    1236. C Liu
    1237. C-F Liu
    1238. F Liu
    1239. H-J Liu
    1240. J Liu
    1241. J-J Liu
    1242. J-L Liu
    1243. K Liu
    1244. L Liu
    1245. L Liu
    1246. Q Liu
    1247. R-Y Liu
    1248. S Liu
    1249. S Liu
    1250. W Liu
    1251. X-D Liu
    1252. X Liu
    1253. X-H Liu
    1254. X Liu
    1255. X Liu
    1256. X Liu
    1257. Y Liu
    1258. Y Liu
    1259. Z Liu
    1260. Z Liu
    1261. JP Liuzzi
    1262. G Lizard
    1263. M Ljujic
    1264. IJ Lodhi
    1265. SE Logue
    1266. BL Lokeshwar
    1267. YC Long
    1268. S Lonial
    1269. B Loos
    1270. C López-Otín
    1271. C López-Vicario
    1272. M Lorente
    1273. PL Lorenzi
    1274. P Lõrincz
    1275. M Los
    1276. MT Lotze
    1277. PE Lovat
    1278. B Lu
    1279. B Lu
    1280. J Lu
    1281. Q Lu
    1282. S-M Lu
    1283. S Lu
    1284. Y Lu
    1285. F Luciano
    1286. S Luckhart
    1287. JM Lucocq
    1288. P Ludovico
    1289. A Lugea
    1290. NW Lukacs
    1291. JJ Lum
    1292. AH Lund
    1293. H Luo
    1294. J Luo
    1295. S Luo
    1296. C Luparello
    1297. T Lyons
    1298. J Ma
    1299. Y Ma
    1300. Y Ma
    1301. Z Ma
    1302. J Machado
    1303. GM Machado-Santelli
    1304. F Macian
    1305. GC MacIntosh
    1306. JP MacKeigan
    1307. KF Macleod
    1308. JD MacMicking
    1309. LA MacMillan-Crow
    1310. F Madeo
    1311. M Madesh
    1312. J Madrigal-Matute
    1313. A Maeda
    1314. T Maeda
    1315. G Maegawa
    1316. E Maellaro
    1317. H Maes
    1318. M Magariños
    1319. K Maiese
    1320. TK Maiti
    1321. L Maiuri
    1322. MC Maiuri
    1323. CG Maki
    1324. R Malli
    1325. W Malorni
    1326. A Maloyan
    1327. F Mami-Chouaib
    1328. N Man
    1329. JD Mancias
    1330. E-M Mandelkow
    1331. MA Mandell
    1332. AA Manfredi
    1333. SN Manié
    1334. C Manzoni
    1335. K Mao
    1336. Z Mao
    1337. Z-W Mao
    1338. P Marambaud
    1339. AM Marconi
    1340. Z Marelja
    1341. G Marfe
    1342. M Margeta
    1343. E Margittai
    1344. M Mari
    1345. FV Mariani
    1346. C Marin
    1347. S Marinelli
    1348. G Mariño
    1349. I Markovic
    1350. R Marquez
    1351. AM Martelli
    1352. S Martens
    1353. KR Martin
    1354. SJ Martin
    1355. S Martin
    1356. MA Martin-Acebes
    1357. P Martín-Sanz
    1358. C Martinand-Mari
    1359. W Martinet
    1360. J Martinez
    1361. N Martinez-Lopez
    1362. U Martinez-Outschoorn
    1363. M Martínez-Velázquez
    1364. M Martinez-Vicente
    1365. WK Martins
    1366. H Mashima
    1367. JA Mastrianni
    1368. G Matarese
    1369. P Matarrese
    1370. R Mateo
    1371. S Matoba
    1372. N Matsumoto
    1373. T Matsushita
    1374. A Matsuura
    1375. T Matsuzawa
    1376. MP Mattson
    1377. S Matus
    1378. N Maugeri
    1379. C Mauvezin
    1380. A Mayer
    1381. D Maysinger
    1382. GD Mazzolini
    1383. MK McBrayer
    1384. K McCall
    1385. C McCormick
    1386. GM McInerney
    1387. SC McIver
    1388. S McKenna
    1389. JJ McMahon
    1390. IA McNeish
    1391. F Mechta-Grigoriou
    1392. JP Medema
    1393. DL Medina
    1394. K Megyeri
    1395. M Mehrpour
    1396. JL Mehta
    1397. Y Mei
    1398. U-C Meier
    1399. AJ Meijer
    1400. A Meléndez
    1401. G Melino
    1402. S Melino
    1403. EJT de Melo
    1404. MA Mena
    1405. MD Meneghini
    1406. JA Menendez
    1407. R Menezes
    1408. L Meng
    1409. L-hua Meng
    1410. S Meng
    1411. R Menghini
    1412. AS Menko
    1413. RFS Menna-Barreto
    1414. MB Menon
    1415. MA Meraz-Ríos
    1416. G Merla
    1417. L Merlini
    1418. AM Merlot
    1419. A Meryk
    1420. S Meschini
    1421. JN Meyer
    1422. M-tian Mi
    1423. C-Y Miao
    1424. L Micale
    1425. S Michaeli
    1426. C Michiels
    1427. AR Migliaccio
    1428. AS Mihailidou
    1429. D Mijaljica
    1430. K Mikoshiba
    1431. E Milan
    1432. L Miller-Fleming
    1433. GB Mills
    1434. IG Mills
    1435. G Minakaki
    1436. BA Minassian
    1437. X-F Ming
    1438. F Minibayeva
    1439. EA Minina
    1440. JD Mintern
    1441. S Minucci
    1442. A Miranda-Vizuete
    1443. CH Mitchell
    1444. S Miyamoto
    1445. K Miyazawa
    1446. N Mizushima
    1447. K Mnich
    1448. B Mograbi
    1449. S Mohseni
    1450. LF Moita
    1451. M Molinari
    1452. M Molinari
    1453. AB Møller
    1454. B Mollereau
    1455. F Mollinedo
    1456. M Mongillo
    1457. MM Monick
    1458. S Montagnaro
    1459. C Montell
    1460. DJ Moore
    1461. MN Moore
    1462. R Mora-Rodriguez
    1463. PI Moreira
    1464. E Morel
    1465. MB Morelli
    1466. S Moreno
    1467. MJ Morgan
    1468. A Moris
    1469. Y Moriyasu
    1470. JL Morrison
    1471. LA Morrison
    1472. E Morselli
    1473. J Moscat
    1474. PL Moseley
    1475. S Mostowy
    1476. E Motori
    1477. D Mottet
    1478. JC Mottram
    1479. CE-H Moussa
    1480. VE Mpakou
    1481. H Mukhtar
    1482. JM Mulcahy Levy
    1483. S Muller
    1484. R Muñoz-Moreno
    1485. C Muñoz-Pinedo
    1486. C Münz
    1487. ME Murphy
    1488. JT Murray
    1489. A Murthy
    1490. IU Mysorekar
    1491. IR Nabi
    1492. M Nabissi
    1493. GA Nader
    1494. Y Nagahara
    1495. Y Nagai
    1496. K Nagata
    1497. A Nagelkerke
    1498. P Nagy
    1499. SR Naidu
    1500. S Nair
    1501. H Nakano
    1502. H Nakatogawa
    1503. M Nanjundan
    1504. G Napolitano
    1505. NI Naqvi
    1506. R Nardacci
    1507. DP Narendra
    1508. M Narita
    1509. AC Nascimbeni
    1510. R Natarajan
    1511. LC Navegantes
    1512. ST Nawrocki
    1513. TY Nazarko
    1514. VY Nazarko
    1515. T Neill
    1516. LM Neri
    1517. MG Netea
    1518. RT Netea-Maier
    1519. BM Neves
    1520. PA Ney
    1521. IP Nezis
    1522. HTT Nguyen
    1523. HP Nguyen
    1524. A-S Nicot
    1525. H Nilsen
    1526. P Nilsson
    1527. M Nishimura
    1528. I Nishino
    1529. M Niso-Santano
    1530. H Niu
    1531. RA Nixon
    1532. VCO Njar
    1533. T Noda
    1534. AA Noegel
    1535. EM Nolte
    1536. E Norberg
    1537. KK Norga
    1538. SK Noureini
    1539. S Notomi
    1540. L Notterpek
    1541. K Nowikovsky
    1542. N Nukina
    1543. T Nürnberger
    1544. VB O'Donnell
    1545. T O'Donovan
    1546. PJ O'Dwyer
    1547. I Oehme
    1548. CL Oeste
    1549. M Ogawa
    1550. B Ogretmen
    1551. Y Ogura
    1552. YJ Oh
    1553. M Ohmuraya
    1554. T Ohshima
    1555. R Ojha
    1556. K Okamoto
    1557. T Okazaki
    1558. FJ Oliver
    1559. K Ollinger
    1560. S Olsson
    1561. DP Orban
    1562. P Ordonez
    1563. I Orhon
    1564. L Orosz
    1565. EJ O'Rourke
    1566. H Orozco
    1567. AL Ortega
    1568. E Ortona
    1569. LD Osellame
    1570. J Oshima
    1571. S Oshima
    1572. HD Osiewacz
    1573. T Otomo
    1574. K Otsu
    1575. J-hsiungJ Ou
    1576. TF Outeiro
    1577. D-yun Ouyang
    1578. H Ouyang
    1579. M Overholtzer
    1580. MA Ozbun
    1581. PH Ozdinler
    1582. B Ozpolat
    1583. C Pacelli
    1584. P Paganetti
    1585. G Page
    1586. G Pages
    1587. U Pagnini
    1588. B Pajak
    1589. SC Pak
    1590. K Pakos-Zebrucka
    1591. N Pakpour
    1592. Z Palková
    1593. F Palladino
    1594. K Pallauf
    1595. N Pallet
    1596. M Palmieri
    1597. SR Paludan
    1598. C Palumbo
    1599. S Palumbo
    1600. O Pampliega
    1601. H Pan
    1602. W Pan
    1603. T Panaretakis
    1604. A Pandey
    1605. A Pantazopoulou
    1606. Z Papackova
    1607. DL Papademetrio
    1608. I Papassideri
    1609. A Papini
    1610. N Parajuli
    1611. J Pardo
    1612. VV Parekh
    1613. G Parenti
    1614. J-I Park
    1615. J Park
    1616. OK Park
    1617. R Parker
    1618. R Parlato
    1619. JB Parys
    1620. KR Parzych
    1621. J-M Pasquet
    1622. B Pasquier
    1623. KBS Pasumarthi
    1624. D Patschan
    1625. C Patterson
    1626. S Pattingre
    1627. S Pattison
    1628. A Pause
    1629. H Pavenstädt
    1630. F Pavone
    1631. Z Pedrozo
    1632. FJ Peña
    1633. MA Peñalva
    1634. M Pende
    1635. J Peng
    1636. F Penna
    1637. JM Penninger
    1638. A Pensalfini
    1639. S Pepe
    1640. GJS Pereira
    1641. PC Pereira
    1642. V Pérez-de la Cruz
    1643. ME Pérez-Pérez
    1644. D Pérez-Rodríguez
    1645. D Pérez-Sala
    1646. C Perier
    1647. A Perl
    1648. DH Perlmutter
    1649. I Perrotta
    1650. S Pervaiz
    1651. M Pesonen
    1652. JE Pessin
    1653. GJ Peters
    1654. M Petersen
    1655. I Petrache
    1656. BJ Petrof
    1657. G Petrovski
    1658. JM Phang
    1659. M Piacentini
    1660. M Pierdominici
    1661. P Pierre
    1662. V Pierrefite-Carle
    1663. F Pietrocola
    1664. FX Pimentel-Muiños
    1665. M Pinar
    1666. B Pineda
    1667. R Pinkas-Kramarski
    1668. M Pinti
    1669. P Pinton
    1670. B Piperdi
    1671. JM Piret
    1672. LC Platanias
    1673. HW Platta
    1674. ED Plowey
    1675. S Pöggeler
    1676. M Poirot
    1677. P Polčic
    1678. A Poletti
    1679. AH Poon
    1680. H Popelka
    1681. B Popova
    1682. I Poprawa
    1683. SM Poulose
    1684. J Poulton
    1685. SK Powers
    1686. T Powers
    1687. M Pozuelo-Rubio
    1688. K Prak
    1689. R Prange
    1690. M Prescott
    1691. M Priault
    1692. S Prince
    1693. RL Proia
    1694. T Proikas-Cezanne
    1695. H Prokisch
    1696. VJ Promponas
    1697. K Przyklenk
    1698. R Puertollano
    1699. S Pugazhenthi
    1700. L Puglielli
    1701. A Pujol
    1702. J Puyal
    1703. D Pyeon
    1704. X Qi
    1705. W-bin Qian
    1706. Z-H Qin
    1707. Y Qiu
    1708. Z Qu
    1709. J Quadrilatero
    1710. F Quinn
    1711. N Raben
    1712. H Rabinowich
    1713. F Radogna
    1714. MJ Ragusa
    1715. M Rahmani
    1716. K Raina
    1717. S Ramanadham
    1718. R Ramesh
    1719. A Rami
    1720. S Randall-Demllo
    1721. F Randow
    1722. H Rao
    1723. VA Rao
    1724. BB Rasmussen
    1725. TM Rasse
    1726. EA Ratovitski
    1727. P-E Rautou
    1728. SK Ray
    1729. B Razani
    1730. BH Reed
    1731. F Reggiori
    1732. M Rehm
    1733. AS Reichert
    1734. T Rein
    1735. DJ Reiner
    1736. E Reits
    1737. J Ren
    1738. X Ren
    1739. M Renna
    1740. JEB Reusch
    1741. JL Revuelta
    1742. L Reyes
    1743. AR Rezaie
    1744. RI Richards
    1745. DR Richardson
    1746. C Richetta
    1747. MA Riehle
    1748. BH Rihn
    1749. Y Rikihisa
    1750. BE Riley
    1751. G Rimbach
    1752. MR Rippo
    1753. K Ritis
    1754. F Rizzi
    1755. E Rizzo
    1756. PJ Roach
    1757. J Robbins
    1758. M Roberge
    1759. G Roca
    1760. MC Roccheri
    1761. S Rocha
    1762. CMP Rodrigues
    1763. CI Rodríguez
    1764. SR de Cordoba
    1765. N Rodriguez-Muela
    1766. J Roelofs
    1767. VV Rogov
    1768. TT Rohn
    1769. B Rohrer
    1770. D Romanelli
    1771. L Romani
    1772. PS Romano
    1773. MIG Roncero
    1774. JL Rosa
    1775. A Rosello
    1776. KV Rosen
    1777. P Rosenstiel
    1778. M Rost-Roszkowska
    1779. KA Roth
    1780. G Roué
    1781. M Rouis
    1782. KM Rouschop
    1783. DT Ruan
    1784. D Ruano
    1785. DC Rubinsztein
    1786. EB Rucker
    1787. A Rudich
    1788. E Rudolf
    1789. R Rudolf
    1790. MA Ruegg
    1791. C Ruiz-Roldan
    1792. AA Ruparelia
    1793. P Rusmini
    1794. DW Russ
    1795. GL Russo
    1796. G Russo
    1797. R Russo
    1798. TE Rusten
    1799. V Ryabovol
    1800. KM Ryan
    1801. SW Ryter
    1802. DM Sabatini
    1803. M Sacher
    1804. C Sachse
    1805. MN Sack
    1806. J Sadoshima
    1807. P Saftig
    1808. R Sagi-Eisenberg
    1809. S Sahni
    1810. P Saikumar
    1811. T Saito
    1812. T Saitoh
    1813. K Sakakura
    1814. M Sakoh-Nakatogawa
    1815. Y Sakuraba
    1816. M Salazar-Roa
    1817. P Salomoni
    1818. AK Saluja
    1819. PM Salvaterra
    1820. R Salvioli
    1821. A Samali
    1822. AMJ Sanchez
    1823. JA Sánchez-Alcázar
    1824. R Sanchez-Prieto
    1825. M Sandri
    1826. MA Sanjuan
    1827. S Santaguida
    1828. L Santambrogio
    1829. G Santoni
    1830. CN dos Santos
    1831. S Saran
    1832. M Sardiello
    1833. G Sargent
    1834. P Sarkar
    1835. S Sarkar
    1836. MR Sarrias
    1837. MM Sarwal
    1838. C Sasakawa
    1839. M Sasaki
    1840. M Sass
    1841. K Sato
    1842. M Sato
    1843. J Satriano
    1844. N Savaraj
    1845. S Saveljeva
    1846. L Schaefer
    1847. UE Schaible
    1848. M Scharl
    1849. HM Schatzl
    1850. R Schekman
    1851. W Scheper
    1852. A Schiavi
    1853. HM Schipper
    1854. H Schmeisser
    1855. J Schmidt
    1856. I Schmitz
    1857. BE Schneider
    1858. EM Schneider
    1859. JL Schneider
    1860. EA Schon
    1861. MJ Schönenberger
    1862. AH Schönthal
    1863. DF Schorderet
    1864. B Schröder
    1865. S Schuck
    1866. RJ Schulze
    1867. M Schwarten
    1868. TL Schwarz
    1869. S Sciarretta
    1870. K Scotto
    1871. AI Scovassi
    1872. RA Screaton
    1873. M Screen
    1874. H Seca
    1875. S Sedej
    1876. L Segatori
    1877. N Segev
    1878. PO Seglen
    1879. JM Seguí-Simarro
    1880. J Segura-Aguilar
    1881. E Seki
    1882. I Seiliez
    1883. C Sell
    1884. CF Semenkovich
    1885. GL Semenza
    1886. U Sen
    1887. AL Serra
    1888. A Serrano-Puebla
    1889. H Sesaki
    1890. T Setoguchi
    1891. C Settembre
    1892. JJ Shacka
    1893. AN Shajahan-Haq
    1894. IM Shapiro
    1895. S Sharma
    1896. H She
    1897. C-KJ Shen
    1898. C-C Shen
    1899. H-M Shen
    1900. S Shen
    1901. W Shen
    1902. R Sheng
    1903. X Sheng
    1904. Z-H Sheng
    1905. TG Shepherd
    1906. J Shi
    1907. Q Shi
    1908. Q Shi
    1909. Y Shi
    1910. S Shibutani
    1911. K Shibuya
    1912. Y Shidoji
    1913. J-J Shieh
    1914. C-M Shih
    1915. Y Shimada
    1916. S Shimizu
    1917. DW Shin
    1918. ML Shinohara
    1919. M Shintani
    1920. T Shintani
    1921. T Shioi
    1922. K Shirabe
    1923. R Shiri-Sverdlov
    1924. O Shirihai
    1925. GC Shore
    1926. C-W Shu
    1927. D Shukla
    1928. AA Sibirny
    1929. V Sica
    1930. CJ Sigurdson
    1931. EM Sigurdsson
    1932. PS Sijwali
    1933. B Sikorska
    1934. WA Silveira
    1935. S Silvente-Poirot
    1936. GA Silverman
    1937. J Simak
    1938. T Simmet
    1939. AK Simon
    1940. H-U Simon
    1941. C Simone
    1942. M Simons
    1943. A Simonsen
    1944. R Singh
    1945. SV Singh
    1946. SK Singh
    1947. D Sinha
    1948. S Sinha
    1949. FA Sinicrope
    1950. A Sirko
    1951. K Sirohi
    1952. BJN Sishi
    1953. A Sittler
    1954. PM Siu
    1955. E Sivridis
    1956. A Skwarska
    1957. R Slack
    1958. I Slaninová
    1959. N Slavov
    1960. SS Smaili
    1961. KSM Smalley
    1962. DR Smith
    1963. SJ Soenen
    1964. SA Soleimanpour
    1965. A Solhaug
    1966. K Somasundaram
    1967. JH Son
    1968. A Sonawane
    1969. C Song
    1970. F Song
    1971. HK Song
    1972. J-X Song
    1973. W Song
    1974. KY Soo
    1975. AK Sood
    1976. TW Soong
    1977. V Soontornniyomkij
    1978. M Sorice
    1979. F Sotgia
    1980. DR Soto-Pantoja
    1981. A Sotthibundhu
    1982. MJ Sousa
    1983. HP Spaink
    1984. PN Span
    1985. A Spang
    1986. JD Sparks
    1987. PG Speck
    1988. SA Spector
    1989. CD Spies
    1990. W Springer
    1991. DS Clair
    1992. A Stacchiotti
    1993. B Staels
    1994. MT Stang
    1995. DT Starczynowski
    1996. P Starokadomskyy
    1997. C Steegborn
    1998. JW Steele
    1999. L Stefanis
    2000. J Steffan
    2001. CM Stellrecht
    2002. H Stenmark
    2003. TM Stepkowski
    2004. ST Stern
    2005. C Stevens
    2006. BR Stockwell
    2007. V Stoka
    2008. Z Storchova
    2009. B Stork
    2010. V Stratoulias
    2011. DJ Stravopodis
    2012. P Strnad
    2013. AM Strohecker
    2014. A-L Ström
    2015. P Stromhaug
    2016. J Stulik
    2017. Y-X Su
    2018. Z Su
    2019. CS Subauste
    2020. S Subramaniam
    2021. CM Sue
    2022. SW Suh
    2023. X Sui
    2024. S Sukseree
    2025. D Sulzer
    2026. F-L Sun
    2027. J Sun
    2028. J Sun
    2029. S-Y Sun
    2030. Y Sun
    2031. Y Sun
    2032. Y Sun
    2033. V Sundaramoorthy
    2034. J Sung
    2035. H Suzuki
    2036. K Suzuki
    2037. N Suzuki
    2038. T Suzuki
    2039. YJ Suzuki
    2040. MS Swanson
    2041. C Swanton
    2042. K Swärd
    2043. G Swarup
    2044. ST Sweeney
    2045. PW Sylvester
    2046. Z Szatmari
    2047. E Szegezdi
    2048. PW Szlosarek
    2049. H Taegtmeyer
    2050. M Tafani
    2051. E Taillebourg
    2052. SWG Tait
    2053. K Takacs-Vellai
    2054. Y Takahashi
    2055. S Takáts
    2056. G Takemura
    2057. N Takigawa
    2058. NJ Talbot
    2059. E Tamagno
    2060. J Tamburini
    2061. C-P Tan
    2062. L Tan
    2063. ML Tan
    2064. M Tan
    2065. Y-J Tan
    2066. K Tanaka
    2067. M Tanaka
    2068. D Tang
    2069. D Tang
    2070. G Tang
    2071. I Tanida
    2072. K Tanji
    2073. BA Tannous
    2074. JA Tapia
    2075. I Tasset-Cuevas
    2076. M Tatar
    2077. I Tavassoly
    2078. N Tavernarakis
    2079. A Taylor
    2080. GS Taylor
    2081. GA Taylor
    2082. JP Taylor
    2083. MJ Taylor
    2084. EV Tchetina
    2085. AR Tee
    2086. F Teixeira-Clerc
    2087. S Telang
    2088. T Tencomnao
    2089. B-B Teng
    2090. R-J Teng
    2091. F Terro
    2092. G Tettamanti
    2093. AL Theiss
    2094. AE Theron
    2095. KJ Thomas
    2096. MP Thomé
    2097. PG Thomes
    2098. A Thorburn
    2099. J Thorner
    2100. T Thum
    2101. M Thumm
    2102. TLM Thurston
    2103. L Tian
    2104. A Till
    2105. JP-yun Ting
    2106. VI Titorenko
    2107. L Toker
    2108. S Toldo
    2109. SA Tooze
    2110. I Topisirovic
    2111. ML Torgersen
    2112. L Torosantucci
    2113. A Torriglia
    2114. MR Torrisi
    2115. C Tournier
    2116. R Towns
    2117. V Trajkovic
    2118. LH Travassos
    2119. G Triola
    2120. DN Tripathi
    2121. D Trisciuoglio
    2122. R Troncoso
    2123. IP Trougakos
    2124. AC Truttmann
    2125. K-J Tsai
    2126. MP Tschan
    2127. Y-H Tseng
    2128. T Tsukuba
    2129. A Tsung
    2130. AS Tsvetkov
    2131. S Tu
    2132. H-Y Tuan
    2133. M Tucci
    2134. DA Tumbarello
    2135. B Turk
    2136. V Turk
    2137. RFB Turner
    2138. AA Tveita
    2139. SC Tyagi
    2140. M Ubukata
    2141. Y Uchiyama
    2142. A Udelnow
    2143. T Ueno
    2144. M Umekawa
    2145. R Umemiya-Shirafuji
    2146. BR Underwood
    2147. C Ungermann
    2148. RP Ureshino
    2149. R Ushioda
    2150. VN Uversky
    2151. NL Uzcátegui
    2152. T Vaccari
    2153. MI Vaccaro
    2154. L Váchová
    2155. H Vakifahmetoglu-Norberg
    2156. R Valdor
    2157. EM Valente
    2158. F Vallette
    2159. AM Valverde
    2160. G Van den Berghe
    2161. L Van Den Bosch
    2162. GR van den Brink
    2163. FG van der Goot
    2164. IJ van der Klei
    2165. LJW van der Laan
    2166. WG van Doorn
    2167. M van Egmond
    2168. KL van Golen
    2169. L Van Kaer
    2170. M van Lookeren Campagne
    2171. P Vandenabeele
    2172. W Vandenberghe
    2173. I Vanhorebeek
    2174. I Varela-Nieto
    2175. MH Vasconcelos
    2176. R Vasko
    2177. DG Vavvas
    2178. I Vega-Naredo
    2179. G Velasco
    2180. AD Velentzas
    2181. PD Velentzas
    2182. T Vellai
    2183. E Vellenga
    2184. MH Vendelbo
    2185. K Venkatachalam
    2186. N Ventura
    2187. S Ventura
    2188. PST Veras
    2189. M Verdier
    2190. BG Vertessy
    2191. A Viale
    2192. M Vidal
    2193. HLA Vieira
    2194. RD Vierstra
    2195. N Vigneswaran
    2196. N Vij
    2197. M Vila
    2198. M Villar
    2199. VH Villar
    2200. J Villarroya
    2201. C Vindis
    2202. G Viola
    2203. MT Viscomi
    2204. G Vitale
    2205. DT Vogl
    2206. OV Voitsekhovskaja
    2207. C von Haefen
    2208. K von Schwarzenberg
    2209. DE Voth
    2210. V Vouret-Craviari
    2211. K Vuori
    2212. JM Vyas
    2213. C Waeber
    2214. CL Walker
    2215. MJ Walker
    2216. J Walter
    2217. L Wan
    2218. X Wan
    2219. B Wang
    2220. C Wang
    2221. C-Y Wang
    2222. C Wang
    2223. C Wang
    2224. C Wang
    2225. D Wang
    2226. F Wang
    2227. F Wang
    2228. G Wang
    2229. H-jie Wang
    2230. H Wang
    2231. H-G Wang
    2232. H Wang
    2233. H-D Wang
    2234. J Wang
    2235. J Wang
    2236. M Wang
    2237. M-Q Wang
    2238. P-Y Wang
    2239. P Wang
    2240. RC Wang
    2241. S Wang
    2242. T-F Wang
    2243. X Wang
    2244. X-jia Wang
    2245. X-W Wang
    2246. X Wang
    2247. X Wang
    2248. Y Wang
    2249. Y Wang
    2250. Y Wang
    2251. Y-J Wang
    2252. Y Wang
    2253. Y Wang
    2254. YT Wang
    2255. Y Wang
    2256. Z-N Wang
    2257. P Wappner
    2258. C Ward
    2259. DM Ward
    2260. G Warnes
    2261. H Watada
    2262. Y Watanabe
    2263. K Watase
    2264. TE Weaver
    2265. CD Weekes
    2266. J Wei
    2267. T Weide
    2268. CC Weihl
    2269. G Weindl
    2270. SN Weis
    2271. L Wen
    2272. X Wen
    2273. Y Wen
    2274. B Westermann
    2275. CM Weyand
    2276. AR White
    2277. E White
    2278. JL Whitton
    2279. AJ Whitworth
    2280. J Wiels
    2281. F Wild
    2282. ME Wildenberg
    2283. T Wileman
    2284. DS Wilkinson
    2285. S Wilkinson
    2286. D Willbold
    2287. C Williams
    2288. K Williams
    2289. PR Williamson
    2290. KF Winklhofer
    2291. SS Witkin
    2292. SE Wohlgemuth
    2293. T Wollert
    2294. EJ Wolvetang
    2295. E Wong
    2296. GW Wong
    2297. RW Wong
    2298. VKW Wong
    2299. EA Woodcock
    2300. KL Wright
    2301. C Wu
    2302. D Wu
    2303. GS Wu
    2304. J Wu
    2305. J Wu
    2306. M Wu
    2307. M Wu
    2308. S Wu
    2309. WKK Wu
    2310. Y Wu
    2311. Z Wu
    2312. CPR Xavier
    2313. RJ Xavier
    2314. G-X Xia
    2315. T Xia
    2316. W Xia
    2317. Y Xia
    2318. H Xiao
    2319. J Xiao
    2320. S Xiao
    2321. W Xiao
    2322. C-M Xie
    2323. Z Xie
    2324. Z Xie
    2325. M Xilouri
    2326. Y Xiong
    2327. C Xu
    2328. C Xu
    2329. F Xu
    2330. H Xu
    2331. H Xu
    2332. J Xu
    2333. J Xu
    2334. J Xu
    2335. L Xu
    2336. X Xu
    2337. Y Xu
    2338. Y Xu
    2339. Z-X Xu
    2340. Z Xu
    2341. Y Xue
    2342. T Yamada
    2343. A Yamamoto
    2344. K Yamanaka
    2345. S Yamashina
    2346. S Yamashiro
    2347. B Yan
    2348. B Yan
    2349. X Yan
    2350. Z Yan
    2351. Y Yanagi
    2352. D-S Yang
    2353. J-M Yang
    2354. L Yang
    2355. M Yang
    2356. P-M Yang
    2357. P Yang
    2358. Q Yang
    2359. W Yang
    2360. WY Yang
    2361. X Yang
    2362. Y Yang
    2363. Y Yang
    2364. Z Yang
    2365. Z Yang
    2366. M-C Yao
    2367. PJ Yao
    2368. X Yao
    2369. Z Yao
    2370. Z Yao
    2371. LS Yasui
    2372. M Ye
    2373. B Yedvobnick
    2374. B Yeganeh
    2375. ES Yeh
    2376. PL Yeyati
    2377. F Yi
    2378. L Yi
    2379. X-M Yin
    2380. CK Yip
    2381. Y-M Yoo
    2382. YH Yoo
    2383. S-Y Yoon
    2384. K-I Yoshida
    2385. T Yoshimori
    2386. KH Young
    2387. H Yu
    2388. JJ Yu
    2389. J-T Yu
    2390. J Yu
    2391. L Yu
    2392. WH Yu
    2393. X-F Yu
    2394. Z Yu
    2395. J Yuan
    2396. Z-M Yuan
    2397. BYJT Yue
    2398. J Yue
    2399. Z Yue
    2400. DN Zacks
    2401. E Zacksenhaus
    2402. N Zaffaroni
    2403. T Zaglia
    2404. Z Zakeri
    2405. V Zecchini
    2406. J Zeng
    2407. M Zeng
    2408. Q Zeng
    2409. AS Zervos
    2410. DD Zhang
    2411. F Zhang
    2412. G Zhang
    2413. G-C Zhang
    2414. H Zhang
    2415. H Zhang
    2416. H Zhang
    2417. H Zhang
    2418. J Zhang
    2419. J Zhang
    2420. J Zhang
    2421. J Zhang
    2422. J-pu Zhang
    2423. L Zhang
    2424. L Zhang
    2425. L Zhang
    2426. L Zhang
    2427. M-Y Zhang
    2428. X Zhang
    2429. XD Zhang
    2430. Y Zhang
    2431. Y Zhang
    2432. Y Zhang
    2433. Y Zhang
    2434. Y Zhang
    2435. M Zhao
    2436. W-L Zhao
    2437. X Zhao
    2438. YG Zhao
    2439. Y Zhao
    2440. Y Zhao
    2441. Y-xia Zhao
    2442. Z Zhao
    2443. ZJ Zhao
    2444. D Zheng
    2445. X-L Zheng
    2446. X Zheng
    2447. B Zhivotovsky
    2448. Q Zhong
    2449. G-Z Zhou
    2450. G Zhou
    2451. H Zhou
    2452. S-F Zhou
    2453. X-jie Zhou
    2454. H Zhu
    2455. H Zhu
    2456. W-G Zhu
    2457. W Zhu
    2458. X-F Zhu
    2459. Y Zhu
    2460. S-M Zhuang
    2461. X Zhuang
    2462. E Ziparo
    2463. CE Zois
    2464. T Zoladek
    2465. W-X Zong
    2466. A Zorzano
    2467. SM Zughaier
    (2016)
    Autophagy 12:1–222.
    https://doi.org/10.1080/15548627.2015.1100356
  33. 33
  34. 34
  35. 35
    Distinct functional domains in Emerin Bind Lamin A and DNA-bridging protein BAF
    1. KK Lee
    2. T Haraguchi
    3. RS Lee
    4. T Koujin
    5. Y Hiraoka
    6. KL Wilson
    (2001)
    Journal of Cell Science 114:4567–4573.
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
    Both emerin and lamin C depend on lamin A for localization at the nuclear envelope
    1. A Vaughan
    2. M Alvarez-Reyes
    3. JM Bridger
    4. JL Broers
    5. FC Ramaekers
    6. M Wehnert
    7. GE Morris
    8. WGF Whitfield
    9. CJ Hutchison
    (2001)
    Journal of Cell Science 114:2577–2590.
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60

Decision letter

  1. Elizabeth A Miller
    Reviewing Editor; MRC Laboratory of Molecular Biology, United Kingdom
  2. David Ron
    Senior Editor; University of Cambridge, United Kingdom
  3. Elizabeth A Miller
    Reviewer; MRC Laboratory of Molecular Biology, United Kingdom
  4. Maurizio Molinari
    Reviewer; Institute for Research in Biomedicine, Switzerland

In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.

Thank you for submitting your article "Selective clearance of the inner nuclear membrane protein emerin by vesicular transport during ER stress" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Elizabeth A Miller as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by David Ron as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Maurizio Molinari (Reviewer #2).

The reviewers have discussed the reviews with one another, and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

This manuscript from the Hetzer lab uses SILAC pulse-chase mass spectrometry to measure the lifetime of nuclear envelope proteins, finding a range of turnover rates. For a short-lived protein, the authors go on to characterize the potential degradation pathways, finding no clear ubiquitination machinery that can be assigned to proteasome-mediated degradation, suggesting redundancy in this pathway. The authors then go on to characterize a second mode of degradation, mediated by vesicle trafficking machineries, and triggered by ER stress. This has hallmarks of the RESET pathway described by others and is exciting in presenting a new substrate for this pathway. The conclusions are largely supported by the data, and the description of a new RESET client is an exciting advance. It would have been nice to also define the proteasome-mediated pathway, but clearly this will require more dissection to overcome problems with redundancy.

The primary shared concern is over the use of chemical compounds (which have potential pleiotropic effects) over long time periods, with additional concern over the potential for gene expression effects to explain observed changes (e.g. Figure 3E). To this end, pulse-chase experiments are preferable for being quantitative and taking into account gene expression effects. Coupled with the glycosylation site addition (as suggested by reviewer 3), this should give a more detailed view of the fate of EMD under ER stress. We do not suggest that all experiments need to be repeated using this type of analysis, but a representative set of experiments covering the key conditions is required to strengthen the authors' model.

Reviewers also propose to more directly visualize the fate of EMD using the tag switching method to more acutely observe the transition of the "old" protein from the INM, to the ER, Golgi and then to the lysosome upon different treatments. A time course of imaging and co-localization would strengthen this argument. Indeed, some co-localization experiments are required even for the steady state observations, most notably for a lysosomal marker in the Baf A1 experiment. Similarly, a control IF experiment of unstressed cells treated with Baf A1 is required to demonstrate the requirement for ER stress in this remobilization.

Reviewer #2:

In this paper, the authors examine the intracellular fate of ectopically expressed emerin (EMD) and of a disease-causing variant thereof. EMD is used as model to investigate proteasomal and lysosomal pathways that regulate turnover of inner nuclear membrane (INM) proteins. They report that both wild type and mutant EMD are ERAD substrates. During acute ER stress, both wild type and mutant EMD are exported from the INM and the ER, via the Golgi and the plasma membrane, to the lysosomes for clearance.

There are few major issues to consider:

1) The authors monitor variations in intracellular level and localization of ectopically expressed EMD proteins in response to cell exposure to various compounds that inhibit ERAD, jeopardize ER to Golgi transport, induce ER stress, block protein synthesis. Note that all these compounds have pleiotropic effects and are to some extent toxic to cells at the concentrations and times (up to 24 hours) used in the experiments. Nevertheless, the authors solely ascribe these drug-induced variations in EMD's intracellular level and localization, to changes in EMD's turnover.

2) At this stage, it cannot be excluded that the various drugs (Figure 2E-G, Figure 3B-D, Figure 4…), or the induction of gene silencing (Figure 3E) modify the expression (rather than the clearance) of the EMDs. For example, it has been reported that MG132 enhances CMV promoter-regulated expression of ectopic genes (and EMDs gene expression is placed here under control of a CMV promoter). I suggest using Bortezomib, a more specific proteasome inhibitor. Also, in Figure 3E I notice that high levels of GFP are expressed only in cells were gene silencing has been activated. GFP expression could reduce expression of the second transgene (EMD), thereby offering an alternative explanation to the one proposed by the authors for the reduction of the EMD level upon E2 ligases knockdown.

All in all, the authors should systematically check synthesis of EMDs in their experiments and how EMDs synthesis changes under the experimental set-up. Moreover, they should measure EMDs stability directly, via quantitative methods such as pulse-chase analyses.

3) A major point of the paper (and the most interesting one) is that changes in cellular (ER) homeostasis trigger lysosomal clearance of proteins from the INM. I am not sure that this is (convincingly enough) supported by the results shown here. To demonstrate that EMD is cleared from the INM, the authors should monitor (by exploiting the epitope-exchange technology) the fate of "old" EMD and show that it re-localizes from the nuclear membrane, to the ER, Golgi and then to the lysosomes (i.e., old EMD should accumulate in the endo-lysosomes (=LAMP1-positive organelle) during ER stress, in the presence of Baf A1). Since EMDs are retained in the INM by association with Lamin A, is EMD:Lamin A complex regulated by ER stress?

4) I miss some experiment with endogenous proteins (e.g., EMD, Sun2, Lamin A). Is their turnover affected by ER stress? Are they delivered to endolysosomes upon ER stress induction?

Reviewer #3:

Buchwalter et al. investigate protein turnover in a mammalian cell system with a focus on proteins of the nuclear envelope and inner nuclear membrane (INM), an area of significant contemporary interest. In brief, the novelty of the manuscript lies in: (i) in the determination of half-lives of INM proteins in a tissue culture model of resting cells, hence minimizing the contribution of "canonical" ERAD via mixing of ER and INM through open mitosis; (ii) the application of RITE analysis in this context to also monitor protein localization, not only half-lives; (iii) chiefly the proposal of a novel route for degradation via trafficking through the Golgi-PM-lysosomal route and a definition a novel role for the LEM domain in this context.

In the opinion of this reviewer, the manuscript should be of considerable interest for the broad readership of eLife. While the identification of the responsible E3 ligase(s) should not be a key requirement for publication, a concern is that many of the key experiments rely solely on pharmacological inhibitors that often have pleiotropic/toxic effects, especially when used in combination. Some relatively straightforward experiments are suggested below that could help to strengthen the authors' proposal of a novel degradation route.

1) It is suggested to append a N-Glycosylation sequence (Asn-X-Ser/Thr) to the C terminus of emerin, a readout that is commonly used by laboratories studying tail-anchored protein biogenesis. This readout would be extremely useful for several reasons:

(i) inserted and preinserted "immature" variants and their degradative fate can be distinguished with ease on immunoblots;

(ii) trafficking from the INM or ER to and through the Golgi can be monitored with ease by monitoring the acquisition of Endo H resistance (vs. PNGase sensitivity), and;

(iii) most importantly, a glycosylation-competent variant is useful to reinforce the interpretation of trafficking to Golgi/lysosome: this EMD variant should accumulate as Endo H-resistant species upon lysosomal deacidification. Moreover, this observation would help to rule out ER-Phagy. In the opinion of this reviewer, it would not be necessary to repeat each and every experiment with this construct, but its application to a few key experiments would considerably strengthen the authors' proposal of a novel degradation route.

2) Can the authors rule out that only a selective sub-pool of "new" EMD variants enter the lysosomal pathway while another "old" subset is locally degraded? Perhaps the authors could consider demonstrating (via RITE) that "old", INM-resident EMD-variants are subject to lysosomal degradation? Alternatively, all formal possibilities could be stated/deconvoluted more clearly in the Discussion section.

https://doi.org/10.7554/eLife.49796.030

Author response

This manuscript from the Hetzer lab uses SILAC pulse-chase mass spectrometry to measure the lifetime of nuclear envelope proteins, finding a range of turnover rates. For a short-lived protein, the authors go on to characterize the potential degradation pathways, finding no clear ubiquitination machinery that can be assigned to proteasome-mediated degradation, suggesting redundancy in this pathway. The authors then go on to characterize a second mode of degradation, mediated by vesicle trafficking machineries, and triggered by ER stress. This has hallmarks of the RESET pathway described by others and is exciting in presenting a new substrate for this pathway. The conclusions are largely supported by the data, and the description of a new RESET client is an exciting advance. It would have been nice to also define the proteasome-mediated pathway, but clearly this will require more dissection to overcome problems with redundancy.

We would like to thank the reviewers for their constructive comments. We have extensively reorganized the manuscript and included new data in response to the reviewers’ critiques. For clarity, we have reorganized the manuscript to focus mostly on the more rapidly degraded EMDΔ95-99 mutant. This makes it possible for us to show more data and controls for this mutant, while we show key comparisons with wild type EMD and the EMDΔLEM mutant. We feel that this more streamlined organization of the manuscript and the new data included with this revision strengthen the manuscript considerably.

The primary shared concern is over the use of chemical compounds (which have potential pleiotropic effects) over long time periods, with additional concern over the potential for gene expression effects to explain observed changes (e.g. Figure 3E).

We now include shorter timepoints of drug treatments (2-8 hours in many cases) which exhibit effects consistent with our observations at longer timepoints.

The reviewers expressed concern that over the time period of RNAi induction, expression of the free GFP encoded by the inducible miR-E RNAi vector might interfere with the synthesis of EMDΔ95-99-GFP. We have included supplemental data (Figure 3—figure supplement 2) showing that two methods of knockdown, siRNA transfection and miR-E RNAi induction, exhibit consistent effects. Neither siRNA transfection (Figure 3—figure supplement 2A-B) nor doxycycline-inducible miRNA expression (Figure 3C) stabilize EMDΔ95-99-GFP. In the siRNA transfection experiments, we observed some decrease of EMDΔ95-99-GFP levels in cells transfected with a scramble RNAi control, but no difference between this condition and specific knockdown conditions.

In the miR-E induction experiments, a GFP marker is co-expressed when the miRNA is induced. In some miR-E knockdown conditions (UBE2G1 or UBE2G2 miR-E, Figure 3C; MARCH6, Figure 3—figure supplement 2D), we observe loss of EMDΔ95-99-GFP. This could indicate that the protein is degraded by another pathway, or alternatively that protein synthesis is suppressed because of promoter competition between the EMDΔ95-99-GFP and the free GFP. We think the latter interpretation is unlikely because an additional knockdown (UBE2J1, Figure 3—figure supplement 2) also had no effect on emerin-GFP levels, even though free GFP is also expressed in this condition. These siRNA and miR-E experiments are overall unified in their outcome: knockdown of individual ERAD-implicated E2 or E3 ubiquitin ligases does not cause emerin-GFP to accumulate within cells.

We agree that it is likely that multiple E2 and/or E3 ligases are redundant in ERAD-mediated degradation of EMD. However, these results were an initial hint that an alternative pathway for EMD degradation exists. We acknowledge this possible redundancy in subsection “Proteasome-dependent and proteasome-independent modes of emerin clearance”:

We depleted MARCH6, Rnf26, and CGRRF1 with siRNA, but observed no effect on EMDΔ95-99 protein levels, suggesting that these ligases do not catalyze EMD turnover, or alternatively that multiple E3 ligases are redundant in this process.”

To this end, pulse-chase experiments are preferable for being quantitative and taking into account gene expression effects. Coupled with the glycosylation site addition (as suggested by reviewer 3), this should give a more detailed view of the fate of EMD under ER stress. We do not suggest that all experiments need to be repeated using this type of analysis, but a representative set of experiments covering the key conditions is required to strengthen the authors' model.

We now include RITE time courses for both wild type EMD and EMDΔ95-99, which show that EMDΔ95-99 disappears more rapidly than wild type EMD, but that both variants are stabilized by proteasome inhibition at the NE (Figure 2E-H).

We also include a cycloheximide time-course showing the relative stabilities of wild type EMD-GFP, EMDΔ95-99-GFP (Figure 3—figure supplement 1C-D), and EMDΔLEM-GFP (Figure 8—figure supplement 1). Importantly, deletion of the LEM domain makes EMD more stable, consistent with our model that the LEM domain mediates targeting of emerin variants to the lysosome.

We now also include a cycloheximide + thapsigargin time-course of EMDΔ95-99-GFP which indicates that under ER stress, EMDΔ95-99-GFP disappears more quickly and is detectable in a higher molecular weight modified form (Figure 3D).

Reviewers also propose to more directly visualize the fate of EMD using the tag switching method to more acutely observe the transition of the "old" protein from the INM, to the ER, Golgi and then to the lysosome upon different treatments.

Unfortunately, the RITE tag switching method lacks the temporal control needed to dissect induced turnover of “old” protein in response to ER stress on timescales of minutes to hours. This is because the tag switching event involves first editing of the plasmid by Cre recombinase within cells, then production of new RNA and finally protein. In the meantime, any remaining RNA that encodes the “old” protein will remain in the cell until it degrades. These factors introduce an inevitable lag time in turnover and make it difficult to pinpoint a clearly defined “old” population of protein for tracking on short timescales.

Using stable cell lines that express GFP-tagged EMD variants at roughly endogenous levels, we observe that NE-localized EMD rapidly decreases, while the protein enriches in the Golgi (Figure 4), is detectable at the plasma membrane (Figure 6) and is found in the lysosome (Figure 5) over time. We infer from this that a significant proportion of EMD leaves the INM and moves through the secretory pathway upon ER stress, but we cannot rule out at this point that some of the “old” protein, or maturely folded protein, is degraded in situ at the INM.

A time course of imaging and co-localization would strengthen this argument. Indeed, some co-localization experiments are required even for the steady state observations, most notably for a lysosomal marker in the Baf A1 experiment.

Figure 4 shows time- and stress-dependent colocalization of EMDΔ95-99-GFP with the Golgi resident protein giantin. We now include costaining with the lysosomal protein LAMP1, which clearly shows that emerin accumulates in lysosomes when lysosome acidification is blocked by bafilomycin A1 treatment (Figure 5D-F). LAMP1, which marks the limiting membrane of the lysosome, can clearly be seen encircling the EMDΔ95-99-GFP signal within the interior of the lysosome.

Similarly, a control IF experiment of unstressed cells treated with Baf A1 is required to demonstrate the requirement for ER stress in this remobilization.

We now include this data in Figure 5E; EMDΔ95-99-GFP does not enrich in LAMP1-marked lysosomes without ER stress induction.

Reviewer #2

[…]

2) At this stage, it cannot be excluded that the various drugs (Figure 2E-G, Figure 3B-D, Figure 4…), or the induction of gene silencing (Figure 3E) modify the expression (rather than the clearance) of the EMDs. For example, it has been reported that MG132 enhances CMV promoter-regulated expression of ectopic genes (and EMDs gene expression is placed here under control of a CMV promoter). I suggest using Bortezomib, a more specific proteasome inhibitor. Also, in Figure 3E I notice that high levels of GFP are expressed only in cells were gene silencing has been activated. GFP expression could reduce expression of the second transgene (EMD), thereby offering an alternative explanation to the one proposed by the authors for the reduction of the EMD level upon E2 ligases knockdown.

All in all, the authors should systematically check synthesis of EMDs in their experiments and how EMDs synthesis changes under the experimental set-up. Moreover, they should measure EMDs stability directly, via quantitative methods such as pulse-chase analyses.

We now include two types of pulse-chase experiments which indicate that EMD is stabilized by proteasome inhibition. In Figure 2, we use the RITE system to directly track the localization and levels of “old” EMD variants in the absence or presence of MG132 and observe that MG132 treatment stabilizes “old” EMD. Secondly, we include representative images of cells stably expressing EMDΔ95-99-GFP and treated with CHX, MG132, or CHX + MG132 (Figure 2—figure supplement 1A). This indicates that MG132 inhibits degradation of mature protein (CHX + MG132 condition). We also observe a widespread increase in EMDΔ95-99-GFP signal throughout cell compartments in the + MG132 alone condition. In this condition, it is possible that MG132 is enhancing expression of EMDΔ95-99-GFP. We think it is more likely that significant amounts of EMDΔ95-99-GFP are cotranslationally degraded, as is known to occur for misfolded tail-anchored proteins (Hessa and Hegde, Nature, 2011). We also observe that MG132 treatment causes the accumulation of higher molecular weight, likely poly-ubiquitinated variants of EMDΔ95-99-GFP (Figure 3C), which we interpret as stalled degradation rather than increased synthesis of the protein.

3) A major point of the paper (and the most interesting one) is that changes in cellular (ER) homeostasis trigger lysosomal clearance of proteins from the INM. I am not sure that this is (convincingly enough) supported by the results shown here. To demonstrate that EMD is cleared from the INM, the authors should monitor (by exploiting the epitope-exchange technology) the fate of "old" EMD and show that it re-localizes from the nuclear membrane, to the ER, Golgi and then to the lysosomes (i.e., old EMD should accumulate in the endo-lysosomes (=LAMP1-positive organelle) during ER stress, in the presence of Baf A1). Since EMDs are retained in the INM by association with Lamin A, is EMD:Lamin A complex regulated by ER stress?

This manuscript shows that a protein that localizes to the INM can also be targeted to the lysosome, which is a surprising and novel finding. We observe that INM-localized EMDΔ95-99-GFP is undetectable at the NE after ~8 hours of ER stress (Figure 3E-F). This clearly indicates that EMDΔ95-99 is quantitatively degraded during ER stress. However, we also see evidence that EMD can be degraded by a proteasome-dependent pathway under some conditions, and we think it is likely that this represents ERAD. We cannot definitively rule out the possibility that some proportion of EMD is degraded by each of these pathways during ER stress. Defining the spectrum of EMD interactions in normal vs. stressed cells will likely help to illuminate this, and future work will address this important question. We do know that disruption of the EMD:lamin A complex is not sufficient to cause EMD to be degraded by the lysosome, as we see in lmna -/- MEFs that EMD-GFP is still stably expressed but loses its affinity for the INM and instead localizes to the peripheral ER (Figure 8—figure supplement 2). Rather, our data suggest that the LEM domain:BAF interface is likely to be the binding interaction that is regulated by ER stress.

4) I miss some experiment with endogenous proteins (e.g., EMD, Sun2, Lamin A). Is their turnover affected by ER stress? Are they delivered to endolysosomes upon ER stress induction?

Our explorations so far suggest that endogenous emerin is not quantitatively degraded during ER stress, although its levels do modestly increase at the NE after brefeldin A treatment. This could be consistent with our LEM domain competition model (see Figure 9 and Discussion); if emerin is expressed more highly than its nucleoplasmic BAF binding partner, more of emerin’s LEM domains may be unbound to BAF and may be able to associate with other factors, including factors that might enable ER export. However, we think it is possible that endogenous wild type or disease-mutant emerin may flux through this pathway at some lower level under certain conditions, and future experiments will explore this possibility.

Reviewer #3

1) It is suggested to append a N-Glycosylation sequence (Asn-X-Ser/Thr) to the C terminus of emerin, a readout that is commonly used by laboratories studying tail-anchored protein biogenesis. This readout would be extremely useful for several reasons:

(i) inserted and preinserted "immature" variants and their degradative fate can be distinguished with ease on immunoblots;

(ii) trafficking from the INM or ER to and through the Golgi can be monitored with ease by monitoring the acquisition of Endo H resistance (vs. PNGase sensitivity);

(iii) most importantly, a glycosylation-competent variant is useful to reinforce the interpretation of trafficking to Golgi/lysosome: this EMD variant should accumulate as Endo H-resistant species upon lysosomal deacidification. Moreover, this observation would help to rule our ER-Phagy. In the opinion of this reviewer, it would not be necessary to repeat each and every experiment with this construct, but its application to a few key experiments would considerably strengthen the authors' proposal of a novel degradation route.

We would like to thank this reviewer for this suggestion, which has provided important supporting data for this revised manuscript. We have generated glycosylation reporter cell lines for EMDΔ95-99-GFP* (Figure 3H, Figure 5G), EMD-WT-GFP* (Figure 7E-F), and EMDΔLEM-GFP* (Figure 8) and performed (i) THG and CHX co-treatments and (ii) THG and Baf A1 cotreatments with each of these lines. We tracked the response of a pool of mature protein during ER stress by co-treating cells with cycloheximide to block new protein synthesis, and thapsigargin to induce ER stress. These experiments clearly indicate that within 2 hours of ER stress induction EMDΔ95-99-GFP* (Figure 3G-H) and EMD-WT-GFP* (Figure 7E) shift from predominantly Endo H-sensitive species to predominantly Endo H-resistant species. This indicates that these proteins progressively leave the ER and enter post-ER compartments.

In a short 4 hour THG + Baf A1 treatment time-course, the Endo H-resistant pool of these proteins also increases over time (EMDΔ95-99-GFP*, Figure 5G; EMD-WT-GFP*, Figure 7F). The conversion from Endo H-sensitive to Endo H-resistant is not as quantitative here, likely because we did not include inhibition of protein synthesis along with these two other treatments. Nevertheless, Endo H-resistant species become more abundant when lysosome acidification is inhibited along with ER stress induction.

Both EMD-WT and EMDΔ95-99 are partially Endo H-resistant under homeostatic conditions. This likely indicates that these proteins are exiting the NE/ER with some frequency and potentially being degraded by the same lysosome-dependent pathway. Importantly, however, EMDΔLEM-GFP* shows a distinct phenotype. EMDΔLEM-GFP* exists in only one modified species that is Endo H-sensitive and does not become Endo H-resistant during ER stress (Figure 8I-J). This outcome indicates, in line with our other data, that the LEM domain is required for EMD variants to exit the NE/ER network and target to lysosomes for degradation.

2) Can the authors rule out that only a selective sub-pool of "new" EMD variants enter the lysosomal pathway while another "old" subset is locally degraded? Perhaps the authors could consider demonstrating (via RITE) that "old", INM-resident EMD-variants are subject to lysosomal degradation? Alternatively, all formal possibilities could be stated/deconvoluted more clearly in the Discussion section.

We infer from our data that a significant proportion of EMD leaves the INM and moves through the secretory pathway upon ER stress, but we cannot rule out at this point that some of the “old” protein, or maturely folded protein, is degraded in situ at the INM. We now address this in the Discussion section:

“While our data indicate that a significant proportion of EMD leaves the NE/ER during ER stress, we cannot rule out the possibility that ERAD-mediated degradation of some proportion of EMD takes place within the NE/ER network in parallel to the lysosome-mediated pathway that we have identified.”

https://doi.org/10.7554/eLife.49796.031

Article and author information

Author details

  1. Abigail Buchwalter

    1. Cardiovascular Research Institute, University of California, San Francisco, San Francisco, United States
    2. Department of Physiology, University of California, San Francisco, San Francisco, United States
    3. Chan Zuckerberg Biohub, San Francisco, United States
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing
    For correspondence
    abigail.buchwalter@ucsf.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7181-6961
  2. Roberta Schulte

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Data curation, Investigation, Methodology, Project administration
    Competing interests
    No competing interests declared
  3. Hsiao Tsai

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Investigation, Methodology
    Competing interests
    No competing interests declared
  4. Juliana Capitanio

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Software, Formal analysis, Methodology
    Competing interests
    No competing interests declared
  5. Martin Hetzer

    The Salk Institute for Biological Studies, La Jolla, United States
    Contribution
    Resources, Supervision, Funding acquisition, Writing—review and editing
    For correspondence
    hetzer@salk.edu
    Competing interests
    No competing interests declared

Funding

NIH Office of the Director (NS096786)

  • Martin Hetzer

National Institute of General Medical Sciences (R01GM126829)

  • Martin Hetzer

National Cancer Institute (P30 014195)

  • Martin Hetzer

Chapman Foundation

  • Martin Hetzer

Helmsley Charitable Trust

  • Martin Hetzer

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Senior Editor

  1. David Ron, University of Cambridge, United Kingdom

Reviewing Editor

  1. Elizabeth A Miller, MRC Laboratory of Molecular Biology, United Kingdom

Reviewers

  1. Elizabeth A Miller, MRC Laboratory of Molecular Biology, United Kingdom
  2. Maurizio Molinari, Institute for Research in Biomedicine, Switzerland

Publication history

  1. Received: June 29, 2019
  2. Accepted: October 9, 2019
  3. Accepted Manuscript published: October 10, 2019 (version 1)
  4. Version of Record published: October 21, 2019 (version 2)

Copyright

© 2019, Buchwalter et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 659
    Page views
  • 137
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Xiaocheng Zhao et al.
    Research Article Updated
    1. Cell Biology
    2. Chromosomes and Gene Expression
    Andrey Poleshko et al.
    Research Article Updated