(A) Diagram of the ER with associated ribosomes, the NE composed of the ONM and INM, the NPCs, and the underlying nuclear lamina. INM proteins are synthesized in the ER, pass through the NPC, and …
Examples of half-life fits for proteins with predicted half-lives of 0.5 days (A), 1 day (B), 2 days (C), 4 days (D), 8 days (E), and 17 days (F).
RITE analysis of INM proteins corroborates protein turnover determined by proteomics. (A) Schematic of recombination-induced tag exchange (RITE) expression cassette for visualizing protein turnover …
(A) EMDΔ95–99-GFP (EMDΔ-GFP) has normal localization at the NE (B) and normal residence time at the NE, based on fluorescence recovery after photobleaching timecourse at the NE (C,D).
(A) C2C12 cells stably expressing EMDΔ-GFP and treated with DMSO vehicle control, CHX alone, CHX and MG132, or MG132 alone for 8 hours. All images were acquired using the same laser power and …
(A–B) C2C12 cells stably expressing EMDΔ-GFP (A) or EMD-WT-GFP (B) and treated with DMSO vehicle control, CHX alone, CHX and MG132, or MG132 alone for 8 hr. All images were acquired using the same …
(A–B) EMDΔ-GFP protein levels do not change in C2C12 cells stably expressing EMDΔ-GFP and transfected in duplicate with 50 nM RNAi targeting the E3 ubiquitin ligases Rnf26, CGRRF1, MARCH6, or a …
Glycosylation reporter variant of EMDΔ-GFP localizes normally to the NE and responds to ER stress induced by THG and secretory pathway disruption caused by BFA (A–B). (C) Pattern of glycosylation …
(A-C) Representative confocal slices of cells stably expressing EMDΔ-GFP, treated with DMSO or THG for the indicated times and costained for giantin to mark the Golgi (magenta). All images were …
(A–B) Representative confocal slices of cells stably expressing EMD-WT-GFP, treated with DMSO or THG for the indicated times and costained for giantin to mark the Golgi (magenta). All images were …
(A) Representative confocal slices of cells stably expressing EMDΔ-GFP after 8 hr of treatment with DMSO vehicle control, THG, co-treatment with THG and BFA, or co-treatment with THG and KU55933. …
(A) Schematic of antibody uptake assay experimental design. If emerin accesses the plasma membrane (PM), it will be detected by anti-GFP antibody (green), which will bind the surface-exposed GFP …
(A) Uptake of anti-GFP antibody (magenta) by cells stably expressing EMD-WT-GFP and treated with DMSO vehicle control or THG for the indicated times. Cells were incubated with anti-GFP antibody for …
(A-C) Representative confocal slices of cells stably expressing NRM-GFP (A), Sun2-GFP (B), or EMD-GFP (C) after 16 hr of treatment with DMSO vehicle control, THG, or co-treatment with THG and BFA. …
(A–B) Glycosylation reporter variant of EMD-WT-GFP localizes normally to the NE and responds to ER stress induced by THG and secretory pathway disruption caused by BFA.
LEM domain is required for stress-dependent clearance from the NE and ER (A) Diagram of emerin domain organization with N-terminal LEM domain deletion indicated (amino acids 1-45). (B-C) …
Western blot detection of EMDΔLEM-GFP protein levels in cells treated with DMSO vehicle control or CHX for the indicated times.
(A) representative immunostaining of WT MEFs or of lmna - /- MEFs with lamin A antibody (red) and Hoechst (blue). (B) Representative immunofluorescence of EMD-GFP stably expressed in WT MEFs (top …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Mus musculus) | emerin | NCBI RefSeq NM_007927 | ||
Gene (Mus musculus) | nurim | NCBI RefSeq NM_134122 | ||
Gene (Mus musculus) | Sun2 | NCBI RefSeq NM_001205346 | ||
Cell line (Mus musculus) | C2C12 | ATCC | CRL-1772 | |
Cell line (Homo sapiens) | U-2-OS | ATCC | HTB-96 | |
Recombinant DNA reagent (plasmid) | pQCXIB vector | Campeau et al. (2009) Addgene | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | Myc/FLAG RITE vector | Toyama et al. (2019) | Lentiviral contruct for stable expression of RITE-tagged protein | |
Recombinant DNA reagent (plasmid) | pQCXIB emerin-GFP | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | pQCXIB emerin-D95-99-GFP | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | pQCXIB emerin-DLEM-GFP | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | pQCXIB emerin-GFP-SSNKTVD | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | pQCXIB emerin-Δ95–99-GFP-SSNKTVD | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | pQCXIB emerin-ΔLEM-GFP-SSNKTVD | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | pQCXIB Sun2-GFP | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | pQCXIB nurim-GFP | This paper | Retroviral construct for stable expression | |
Recombinant DNA reagent (plasmid) | Emerin-RITE | This paper | Lentiviral contruct for stable expression of RITE-tagged protein | |
Recombinant DNA reagent (plasmid) | Nurim-RITE | This paper | Lentiviral contruct for stable expression of RITE-tagged protein | |
Recombinant DNA reagent (plasmid) | Emerin-Δ95–99-RITE | This paper | Lentiviral contruct for stable expression of RITE-tagged protein | |
Antibody | Rabbit polyclonal anti-emerin | Santa Cruz Biotechnology | Sc-15378 | WB (1:1000) |
Antibody | GFP | Abcam | ab290 | Ab uptake (1:500); WB (1:1000) |
Antibody | Mouse monoclonal anti-FLAG | Sigma-Aldrich | F1804 | IF (1:1000) |
Antibody | Mouse monoclonal anti-Myc | Cell Signaling | 2233 | IF (1:1000); Ab uptake (1:500) |
Antibody | Mouse monoclonal anti-tubulin | Sigma-Aldrich | T5168 | WB (1:2500) |
Antibody | giantin | BioLegend | PRB-114C | IF (1:1000) |
Antibody | LAMP1 | Abcam | ab24170 | IF(1:100) |
Other | Alexa-647 WGA | Life Technologies | W32466 | IF (5 ug/ml) |
Commercial assay or kit | PNGase F | NEB | P0704 | |
Commercial assay or kit | Endo H | NEB | P0702 | |
Chemical compound, drug | Thapsigargin | Thermo Fisher | T7459 | Used at 100 nM |
Chemical compound, drug | MG132 | Cayman Chemical | 1211877-36-9 | Used at10 uM |
Chemical compound, drug | Bafilomycin A1 | BioViotica | BVT-0252 | Used at100 nM |
Chemical compound, drug | Brefeldin A | Tocris | 1231 | Used at2.5 uM |
Chemical compound, drug | Leupeptin | Sigma-Aldrich | L5793 | Used at 125 uM |
Chemical compound, drug | cycloheximide | Sigma-Aldrich | C-7698 | Used at200 ug/ml |
Other | 13C6-Lysine | Cambridge Isotopes | CLM-2247 | |
Other | 13C6, 15N4-Arginine | Cambridge Isotopes | CNLM-539 | |
Other | Lysine/arginine free DMEM | Thermo Fisher | 88364 | |
Other | Dialyzed fetal bovine serum | Thermo Fisher | 26400044 | |
Other | Hoechst stain | Molecular Probes | H1399 | Used at 10 ug/ml |
Recombinant DNA reagent (plasmid) | UBE2G1 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGAAAGACAGCTGGCAGAACTCAATAGTGAAGCCACAGATGTATTGAGTTCTGCCAGCTGTCTTCTGCCTACTGCCTCGGA | |
Recombinant DNA reagent (plasmid) | UBE2G2 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGAACCGGGAGCAGTTCTATAAGATAGTGAAGCCACAGATGTATCTTATAGAACTGCTCCCGGTCTGCCTACTGCCTCGGA | |
Recombinant DNA reagent (plasmid) | UBE2J1 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGAAAGGTTGTCTACTTCACCAGATAGTGAAGCCACAGATGTATCTGGTGAAGTAGACAACCTTCTGCCTACTGCCTCGGA | |
Recombinant DNA reagent (plasmid) | MARCH6 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGACTGGATCTTCATTCTTATTTATAGTGAAGCCACAGATGTATAAATAAGAATGAAGATCCAGCTGCCTACTGCCTCGGA | |
Software, algorithm | Fiji | https://fiji.sc/ | ||
Software, algorithm | RStudio | https://rstudio.com/ |
Filtered peptide data for half life calculations.
Peptide turnover data for all peptides passing quality control filters. See R script and Materials and methods for details.
Filtered protein data for half life calculations.
Filtered and averaged protein turnover data. See R script and Materials and methods for details.
Results of half life fits passing quality filters.
Complete list of half life fits.
Half lives and protein topology data.
Selected data related to Figure 1G-H.