Selective clearance of the inner nuclear membrane protein emerin by vesicular transport during ER stress
- University of California, San Francisco, United States
- Chan Zuckerberg Biohub, United States
- The Salk Institute for Biological Studies, United States
Figures
Figure 1 with 1 supplement
Dynamic proteomic analysis of inner nuclear membrane protein turnover.
(A) Diagram of the ER with associated ribosomes, the NE composed of the ONM and INM, the NPCs, and the underlying nuclear lamina. INM proteins are synthesized in the ER, pass through the NPC, and …
Figure 1—figure supplement 1
Example half life fits.
Examples of half-life fits for proteins with predicted half-lives of 0.5 days (A), 1 day (B), 2 days (C), 4 days (D), 8 days (E), and 17 days (F).
Figure 2 with 1 supplement
RITE analysis of INM proteins enables visualization of proteasome-dependent turnover.
RITE analysis of INM proteins corroborates protein turnover determined by proteomics. (A) Schematic of recombination-induced tag exchange (RITE) expression cassette for visualizing protein turnover …
Figure 2—figure supplement 1
Identification of a disease-linked emerin mutant with normal NE localization.
(A) EMDΔ95–99-GFP (EMDΔ-GFP) has normal localization at the NE (B) and normal residence time at the NE, based on fluorescence recovery after photobleaching timecourse at the NE (C,D).
Figure 3 with 3 supplements
Acute stressors destabilize mutant emerin protein levels.
(A) C2C12 cells stably expressing EMDΔ-GFP and treated with DMSO vehicle control, CHX alone, CHX and MG132, or MG132 alone for 8 hours. All images were acquired using the same laser power and …
Figure 3—figure supplement 1
Localization and stability of a disease-linked emerin variant.
(A–B) C2C12 cells stably expressing EMDΔ-GFP (A) or EMD-WT-GFP (B) and treated with DMSO vehicle control, CHX alone, CHX and MG132, or MG132 alone for 8 hr. All images were acquired using the same …
Figure 3—figure supplement 2
siRNA-mediated E2 or E3 ubiquitin ligase knockdowns do not stabilize EMDΔ-GFP.
(A–B) EMDΔ-GFP protein levels do not change in C2C12 cells stably expressing EMDΔ-GFP and transfected in duplicate with 50 nM RNAi targeting the E3 ubiquitin ligases Rnf26, CGRRF1, MARCH6, or a …
Figure 3—figure supplement 3
Glycosylation reporter variants are destabilized by ER stress and recovered by BFA treatment.
Glycosylation reporter variant of EMDΔ-GFP localizes normally to the NE and responds to ER stress induced by THG and secretory pathway disruption caused by BFA (A–B). (C) Pattern of glycosylation …
Figure 4 with 1 supplement
Stress-induced clearance of mutant emerin from the ER and NE involves the secretory pathway.
(A-C) Representative confocal slices of cells stably expressing EMDΔ-GFP, treated with DMSO or THG for the indicated times and costained for giantin to mark the Golgi (magenta). All images were …
Figure 4—figure supplement 1
Colocalization of emerin with the Golgi.
(A–B) Representative confocal slices of cells stably expressing EMD-WT-GFP, treated with DMSO or THG for the indicated times and costained for giantin to mark the Golgi (magenta). All images were …
Figure 5
Mutant emerin trafficking is dependent on lysosomal but not autophagosomal function.
(A) Representative confocal slices of cells stably expressing EMDΔ-GFP after 8 hr of treatment with DMSO vehicle control, THG, co-treatment with THG and BFA, or co-treatment with THG and KU55933. …
Figure 6 with 1 supplement
Mutant emerin traffics through the plasma membrane upon ER stress.
(A) Schematic of antibody uptake assay experimental design. If emerin accesses the plasma membrane (PM), it will be detected by anti-GFP antibody (green), which will bind the surface-exposed GFP …
Figure 6—figure supplement 1
Access of emerin to the plasma membrane.
(A) Uptake of anti-GFP antibody (magenta) by cells stably expressing EMD-WT-GFP and treated with DMSO vehicle control or THG for the indicated times. Cells were incubated with anti-GFP antibody for …
Figure 7 with 1 supplement
Emerin, but not other INM proteins, undergoes stress-dependent clearance from the NE and ER and accesses lysosomes.
(A-C) Representative confocal slices of cells stably expressing NRM-GFP (A), Sun2-GFP (B), or EMD-GFP (C) after 16 hr of treatment with DMSO vehicle control, THG, or co-treatment with THG and BFA. …
Figure 7—figure supplement 1
Glycosylation reporter variants are destabilized by ER stress and recovered by BFA treatment.
(A–B) Glycosylation reporter variant of EMD-WT-GFP localizes normally to the NE and responds to ER stress induced by THG and secretory pathway disruption caused by BFA.
Figure 8 with 2 supplements
A signal within emerin’s.
LEM domain is required for stress-dependent clearance from the NE and ER (A) Diagram of emerin domain organization with N-terminal LEM domain deletion indicated (amino acids 1-45). (B-C) …
Figure 8—figure supplement 1
Stability of EMDΔLEM-GFP over time of cycloheximide treatment.
Western blot detection of EMDΔLEM-GFP protein levels in cells treated with DMSO vehicle control or CHX for the indicated times.
Figure 8—figure supplement 2
Emerin is mislocalized to the ER, but not degraded in lmna - /- MEFs.
(A) representative immunostaining of WT MEFs or of lmna - /- MEFs with lamin A antibody (red) and Hoechst (blue). (B) Representative immunofluorescence of EMD-GFP stably expressed in WT MEFs (top …
Figure 9
Competition model for emerin sorting via its LEM domain competitively binding to BAF or to the ER export machinery.
https://doi.org/10.7554/eLife.49796.020Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | emerin | NCBI RefSeq NM_007927 | ||
| Gene (Mus musculus) | nurim | NCBI RefSeq NM_134122 | ||
| Gene (Mus musculus) | Sun2 | NCBI RefSeq NM_001205346 | ||
| Cell line (Mus musculus) | C2C12 | ATCC | CRL-1772 | |
| Cell line (Homo sapiens) | U-2-OS | ATCC | HTB-96 | |
| Recombinant DNA reagent (plasmid) | pQCXIB vector | Campeau et al. (2009) Addgene | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | Myc/FLAG RITE vector | Toyama et al. (2019) | Lentiviral contruct for stable expression of RITE-tagged protein | |
| Recombinant DNA reagent (plasmid) | pQCXIB emerin-GFP | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | pQCXIB emerin-D95-99-GFP | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | pQCXIB emerin-DLEM-GFP | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | pQCXIB emerin-GFP-SSNKTVD | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | pQCXIB emerin-Δ95–99-GFP-SSNKTVD | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | pQCXIB emerin-ΔLEM-GFP-SSNKTVD | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | pQCXIB Sun2-GFP | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | pQCXIB nurim-GFP | This paper | Retroviral construct for stable expression | |
| Recombinant DNA reagent (plasmid) | Emerin-RITE | This paper | Lentiviral contruct for stable expression of RITE-tagged protein | |
| Recombinant DNA reagent (plasmid) | Nurim-RITE | This paper | Lentiviral contruct for stable expression of RITE-tagged protein | |
| Recombinant DNA reagent (plasmid) | Emerin-Δ95–99-RITE | This paper | Lentiviral contruct for stable expression of RITE-tagged protein | |
| Antibody | Rabbit polyclonal anti-emerin | Santa Cruz Biotechnology | Sc-15378 | WB (1:1000) |
| Antibody | GFP | Abcam | ab290 | Ab uptake (1:500); WB (1:1000) |
| Antibody | Mouse monoclonal anti-FLAG | Sigma-Aldrich | F1804 | IF (1:1000) |
| Antibody | Mouse monoclonal anti-Myc | Cell Signaling | 2233 | IF (1:1000); Ab uptake (1:500) |
| Antibody | Mouse monoclonal anti-tubulin | Sigma-Aldrich | T5168 | WB (1:2500) |
| Antibody | giantin | BioLegend | PRB-114C | IF (1:1000) |
| Antibody | LAMP1 | Abcam | ab24170 | IF(1:100) |
| Other | Alexa-647 WGA | Life Technologies | W32466 | IF (5 ug/ml) |
| Commercial assay or kit | PNGase F | NEB | P0704 | |
| Commercial assay or kit | Endo H | NEB | P0702 | |
| Chemical compound, drug | Thapsigargin | Thermo Fisher | T7459 | Used at 100 nM |
| Chemical compound, drug | MG132 | Cayman Chemical | 1211877-36-9 | Used at10 uM |
| Chemical compound, drug | Bafilomycin A1 | BioViotica | BVT-0252 | Used at100 nM |
| Chemical compound, drug | Brefeldin A | Tocris | 1231 | Used at2.5 uM |
| Chemical compound, drug | Leupeptin | Sigma-Aldrich | L5793 | Used at 125 uM |
| Chemical compound, drug | cycloheximide | Sigma-Aldrich | C-7698 | Used at200 ug/ml |
| Other | 13C6-Lysine | Cambridge Isotopes | CLM-2247 | |
| Other | 13C6, 15N4-Arginine | Cambridge Isotopes | CNLM-539 | |
| Other | Lysine/arginine free DMEM | Thermo Fisher | 88364 | |
| Other | Dialyzed fetal bovine serum | Thermo Fisher | 26400044 | |
| Other | Hoechst stain | Molecular Probes | H1399 | Used at 10 ug/ml |
| Recombinant DNA reagent (plasmid) | UBE2G1 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGAAAGACAGCTGGCAGAACTCAATAGTGAAGCCACAGATGTATTGAGTTCTGCCAGCTGTCTTCTGCCTACTGCCTCGGA | |
| Recombinant DNA reagent (plasmid) | UBE2G2 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGAACCGGGAGCAGTTCTATAAGATAGTGAAGCCACAGATGTATCTTATAGAACTGCTCCCGGTCTGCCTACTGCCTCGGA | |
| Recombinant DNA reagent (plasmid) | UBE2J1 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGAAAGGTTGTCTACTTCACCAGATAGTGAAGCCACAGATGTATCTGGTGAAGTAGACAACCTTCTGCCTACTGCCTCGGA | |
| Recombinant DNA reagent (plasmid) | MARCH6 miR-E LT3GEPIR | Knott et al., 2014 | TGCTGTTGACAGTGAGCGACTGGATCTTCATTCTTATTTATAGTGAAGCCACAGATGTATAAATAAGAATGAAGATCCAGCTGCCTACTGCCTCGGA | |
| Software, algorithm | Fiji | https://fiji.sc/ | ||
| Software, algorithm | RStudio | https://rstudio.com/ |
Additional files
-
Source data 1
Filtered peptide data for half life calculations.
Peptide turnover data for all peptides passing quality control filters. See R script and Materials and methods for details.
- https://doi.org/10.7554/eLife.49796.021
-
Source data 2
Filtered protein data for half life calculations.
Filtered and averaged protein turnover data. See R script and Materials and methods for details.
- https://doi.org/10.7554/eLife.49796.022
-
Supplementary file 1
Results of half life fits passing quality filters.
- https://doi.org/10.7554/eLife.49796.023
-
Supplementary file 2
Complete list of half life fits.
- https://doi.org/10.7554/eLife.49796.024
-
Supplementary file 3
Half lives and protein topology data.
Selected data related to Figure 1G-H.
- https://doi.org/10.7554/eLife.49796.025
-
Transparent reporting form
- https://doi.org/10.7554/eLife.49796.026
