A novel lineage of candidate pheromone receptors for sex communication in moths
- Sorbonne Université, Inra, CNRS, IRD, UPEC, Université Paris Diderot, Institute of Ecology and Environmental Sciences of Paris, France
- Chinese Academy of Agricultural Sciences, China
- CNRS UMR 7196, INSERM U1154, Museum National d’Histoire Naturelle, France
- Swedish University of Agricultural Sciences, Sweden
Figures
Figure 1
SlitOr5 is highly expressed in males but does not belong to the pheromone receptor clade.
(A) Expression levels of SlitOr5 in adult male and female antennae of S. littoralis, as measured by real-time qPCR. Expression levels have been normalized to the expression of SlitRpl13. Plotted …
-
Figure 1—source data 1
Mean normalized expression values of SlitOr5 measured in the three biological replicates.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Alignment of amino acid sequences used to build the phylogeny (FASTA format).
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig1-data2-v1.txt
Figure 2
SlitOR5 is the receptor for the major component of the S. littoralis pheromone blend.
(A) Action potential frequency of Drosophila at1 OSNs expressing SlitOR5 (n = 8) after stimulation with 26 type I pheromone compounds (10 µg loaded in the stimulus cartridge). ***p<0.001, …
-
Figure 2—source data 1
Raw results of electrophysiology experiments.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig2-data1-v1.xlsx
Figure 3 with 1 supplement
Response to the major pheromone component is abolished in SlitOr5 mutants.
(A) Location of the 10 bp deletion induced in the first exon of the SlitOr5 gene by the CRISPR/Cas9 system. The sequence complementary to the RNA guide is indicated in blue, and the protospacer …
-
Figure 3—source data 1
Raw results of the EAG experiment.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Raw results of behavioral experiments.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig3-data2-v1.xlsx
Figure 3—figure supplement 1
Behavioral response of wild-type and homozygous SlitOr5 mutants to the major pheromone component.
Cumulative proportion of S. littoralis males initiating antennal flicking, wing fanning, abdomen curving and extrusion of genitalia in homozygous SlitOr5 mutants (purple, n = 14) stimulated with the …
Figure 4
SlitOR5 may define a novel lineage of candidate pheromone receptors in Lepidoptera.
Maximum likelihood phylogeny of the lepidopteran OR clade that includes all the paralogous lineages containing pheromone receptors. 360 sequences from 34 lepidopteran species were included. …
-
Figure 4—source data 1
Alignment of amino acid sequences used to build the phylogeny (FASTA format).
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig4-data1-v1.txt
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Spodoptera littoralis) | SlitOr5 | GenBank | GB:MK614705 | |
| Gene (Spodoptera littoralis) | SlitOrco | Malpel et al. (2008); PMID:18828844; GenBank | GB:EF395366 | |
| Genetic reagent (Drosophila melanogaster) | Or67dGAL4 | Kurtovic et al. (2007); PMID: 17392786 | FLYB:FBal0210948 | kindly provided by B. Dickson |
| Genetic reagent (Drosophila melanogaster) | y1 M{vas-int.Dm}ZH-2A w*; M{3xP3-RFP.attP}ZH-51C | Bischof et al. (2007); PMID: 17360644; Bloomington Drosophila Stock Center | BDSC:24482 | |
| Genetic reagent (Drosophila melanogaster) | UAS-SlitOr5 | This study | See Materials and methods | |
| Recombinant DNA reagent | pUAST.attB (plasmid) | Bischof et al. (2007); PMID: 17360644; GenBank | GB:EF362409 | kindly provided by J. Bischof |
| Recombinant DNA reagent | pUAST.attB-SlitOr5 (plasmid) | This study | See Materials and methods | |
| Recombinant DNA reagent | pCS2+ (plasmid) | Turner and Weintraub (1994); PMID: 7926743 | kindly provided by C. Héligon | |
| Recombinant DNA reagent | pCS2+-SlitOr5 (plasmid) | This study | See Materials and methods | |
| Recombinant DNA reagent | pCS2+-SlitOrco (plasmid) | This study | See Materials and methods | |
| Sequence-based reagent | Or5up | This study | PCR primers | TCGGGAGAAACTGAAGGACGTTGT |
| Sequence-based reagent | Or5do | This study | PCR primers | GCACGGAACCGCACTTATCACTAT |
| Sequence-based reagent | Rpl13up | This study | PCR primers | GTACCTGCCGCTCTCCGTGT |
| Sequence-based reagent | Rpl13do | This study | PCR primers | CTGCGGTGAATGGTGCTGTC |
| Sequence-based reagent | SlitOr5 guide RNA | This study | gRNA | AGCATAAATACTGGACCCAGTGG |
| Sequence-based reagent | Or5_forward | This study | PCR primers | CCAAAAGGACTTGGACTTTGAA |
| Sequence-based reagent | Or5_reverse | This study | PCR primers | CCCGAATCTTTTCAGGATTAGAA |
Additional files
-
Supplementary file 1
List of synthetic compounds used for electrophysiology experiments.
- https://cdn.elifesciences.org/articles/49826/elife-49826-supp1-v1.docx
-
Supplementary file 2
Functional and sex-biased expression data available for lepidopteran pheromone receptors (as of September 2018).
- https://cdn.elifesciences.org/articles/49826/elife-49826-supp2-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/49826/elife-49826-transrepform-v1.docx
