A novel lineage of candidate pheromone receptors for sex communication in moths
- Sorbonne Université, Inra, CNRS, IRD, UPEC, Université Paris Diderot, Institute of Ecology and Environmental Sciences of Paris, France
- Chinese Academy of Agricultural Sciences, China
- CNRS UMR 7196, INSERM U1154, Museum National d’Histoire Naturelle, France
- Swedish University of Agricultural Sciences, Sweden
Figures
Figure 1
SlitOr5 is highly expressed in males but does not belong to the pheromone receptor clade.
(A) Expression levels of SlitOr5 in adult male and female antennae of S. littoralis, as measured by real-time qPCR. Expression levels have been normalized to the expression of SlitRpl13. Plotted values represent the mean normalized expression values ± SEM (n = 3). Raw results are available in Figure 1—source data 1. (B) Unrooted maximum likelihood phylogeny of lepidopteran ORs, based on 506 amino acid sequences from nine species, each belonging to a different superfamily. The position of SlitOR5 and of receptors for type 0, type I and type II pheromone compounds is highlighted. Circles on the nodes indicate the distinct paralogous OR lineages, supported by a transfer bootstrap expectation (TBE) >0.9. All the PR-containing lineages grouped within a large clade (highlighted in grey) also supported by the bootstrap analysis. The sequence alignment file is available in Figure 1—source data 2.
-
Figure 1—source data 1
Mean normalized expression values of SlitOr5 measured in the three biological replicates.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Alignment of amino acid sequences used to build the phylogeny (FASTA format).
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig1-data2-v1.txt
Figure 2
SlitOR5 is the receptor for the major component of the S. littoralis pheromone blend.
(A) Action potential frequency of Drosophila at1 OSNs expressing SlitOR5 (n = 8) after stimulation with 26 type I pheromone compounds (10 µg loaded in the stimulus cartridge). ***p<0.001, significantly different from the response to solvent (one-way ANOVA followed by a Tukey’s post hoc test). (B) Inward current measured in Xenopus oocytes co-expressing SlitOR5 and SlitOrco (n = 13–16) after stimulation with the same panel of pheromone compounds (10−4 M solution). ***p<0.001, **p<0.01, significantly different from 0 (Wilcoxon signed rank test). (C) Action potential frequency of LT1A OSNs from S. littoralis male antennae (n = 8–16) after stimulation with pheromone compounds (1 µg loaded in the stimulus cartridge). ***p<0.001, *p<0.1, significantly different from the response to solvent (one-way ANOVA followed by a Tukey’s post hoc test). (D) Representative trace showing the response of a Xenopus oocyte co-expressing SlitOR5 and SlitOrco after stimulation with a range of (Z,E)-9,11-14:OAc doses from 10−9 M to 10−5 M. (E) Dose-response curve of SlitOR5/Orco Xenopus oocytes (n = 9) stimulated with (Z,E)-9,11-14:OAc (EC50 = 1.707 × 10−7 M). Plotted values in (A–C and E) are mean responses ± SEM. Raw results for all experiments are available in Figure 2—source data 1.
-
Figure 2—source data 1
Raw results of electrophysiology experiments.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig2-data1-v1.xlsx
Figure 3 with 1 supplement
Response to the major pheromone component is abolished in SlitOr5 mutants.
(A) Location of the 10 bp deletion induced in the first exon of the SlitOr5 gene by the CRISPR/Cas9 system. The sequence complementary to the RNA guide is indicated in blue, and the protospacer adjacent motif (PAM) in red. The frameshift created in the SlitOr5 open-reading frame (ORF) induced a premature stop codon. (B) Electroantennogram (EAG) amplitude measured in S. littoralis male antennae isolated from wild-type animals (light grey, n = 14), heterozygous SlitOr5 mutants (dark grey, n = 18) and homozygous SlitOr5 mutants (purple, n = 8) after stimulation with pheromone compounds (1 µg in the stimulus cartridge) and plant volatiles (10 µg in the stimulus cartridge). Plotted values represent the normalized mean response ± SEM (response to the solvent was subtracted). ***p<0.001, significantly different from the response of the other genotypes; n.s.: not significantly different (one-way ANOVA, followed by a Tukey’s post hoc test). Raw results for the EAG experiment are available in Figure 3—source data 1. (C) Cumulative proportion of S. littoralis males initiating a movement toward the odor source in homozygous SlitOr5 mutants (purple, n = 14) stimulated with the major pheromone component (100 ng in the stimulus cartridge) and in wild-type animals stimulated with the pheromone (blue, n = 36) or with solvent alone (light grey, n = 44). ***p<0.001, significantly different from the other distributions; n.s.: not significantly different (log-rank test). Results obtained for other behavioral items are presented in Figure 3—figure supplement 1. (D) Proportion of wild-type S. littoralis males (light grey, n = 49) and homozygous SlitOr5 mutants (purple, n = 13) that mated with a wild-type female during a period of 6 hr in the scotophase. *p<0.05, significant difference between the two genotypes (Fisher’s exact test). (E) Number of eggs laid (left panel) and of offspring (right panel) obtained per female after the mating experiment. Plotted values represent the mean ± SEM. ***p<0.001, **p<0.005, significant difference between the two genotypes (Mann-Whitney U test). Raw results for all the behavioral experiments are available in Figure 3—source data 2.
-
Figure 3—source data 1
Raw results of the EAG experiment.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Raw results of behavioral experiments.
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig3-data2-v1.xlsx
Figure 3—figure supplement 1
Behavioral response of wild-type and homozygous SlitOr5 mutants to the major pheromone component.
Cumulative proportion of S. littoralis males initiating antennal flicking, wing fanning, abdomen curving and extrusion of genitalia in homozygous SlitOr5 mutants (purple, n = 14) stimulated with the major pheromone component (100 ng in the stimulus cartridge) and in wild-type animals stimulated with the pheromone (blue, n = 36) or with solvent alone (light grey, n = 44). ***p<0.001, significantly different from the other distributions; n.s.: not significantly different (log-rank test). Raw results are available in Figure 3—source data 2.
Figure 4
SlitOR5 may define a novel lineage of candidate pheromone receptors in Lepidoptera.
Maximum likelihood phylogeny of the lepidopteran OR clade that includes all the paralogous lineages containing pheromone receptors. 360 sequences from 34 lepidopteran species were included. Functional and expression data shown on the figure have been compiled from the literature (Supplementary file 2). Branch colors indicate OR function, when characterized: PRs for type I pheromones are depicted in red, those for type II pheromones in blue and those for type 0 pheromones in orange. ORs tuned to plant volatiles are depicted in green. Symbols at the edge indicate expression data: male-biased ORs are highlighted with black squares and female-biased ORs with black dots. Circles on the nodes indicate the distinct paralogous OR lineages. Support values on basal nodes are transfer bootstrap expectation (TBE) values. The tree has been rooted using an outgroup as identified in the lepidopteran OR phylogeny shown in Figure 1. The scale bar indicates the expected number of amino acid substitutions per site. The sequence alignment file is available in Figure 4—source data 1.
-
Figure 4—source data 1
Alignment of amino acid sequences used to build the phylogeny (FASTA format).
- https://cdn.elifesciences.org/articles/49826/elife-49826-fig4-data1-v1.txt
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Spodoptera littoralis) | SlitOr5 | GenBank | GB:MK614705 | |
| Gene (Spodoptera littoralis) | SlitOrco | Malpel et al. (2008); PMID:18828844; GenBank | GB:EF395366 | |
| Genetic reagent (Drosophila melanogaster) | Or67dGAL4 | Kurtovic et al. (2007); PMID: 17392786 | FLYB:FBal0210948 | kindly provided by B. Dickson |
| Genetic reagent (Drosophila melanogaster) | y1 M{vas-int.Dm}ZH-2A w*; M{3xP3-RFP.attP}ZH-51C | Bischof et al. (2007); PMID: 17360644; Bloomington Drosophila Stock Center | BDSC:24482 | |
| Genetic reagent (Drosophila melanogaster) | UAS-SlitOr5 | This study | See Materials and methods | |
| Recombinant DNA reagent | pUAST.attB (plasmid) | Bischof et al. (2007); PMID: 17360644; GenBank | GB:EF362409 | kindly provided by J. Bischof |
| Recombinant DNA reagent | pUAST.attB-SlitOr5 (plasmid) | This study | See Materials and methods | |
| Recombinant DNA reagent | pCS2+ (plasmid) | Turner and Weintraub (1994); PMID: 7926743 | kindly provided by C. Héligon | |
| Recombinant DNA reagent | pCS2+-SlitOr5 (plasmid) | This study | See Materials and methods | |
| Recombinant DNA reagent | pCS2+-SlitOrco (plasmid) | This study | See Materials and methods | |
| Sequence-based reagent | Or5up | This study | PCR primers | TCGGGAGAAACTGAAGGACGTTGT |
| Sequence-based reagent | Or5do | This study | PCR primers | GCACGGAACCGCACTTATCACTAT |
| Sequence-based reagent | Rpl13up | This study | PCR primers | GTACCTGCCGCTCTCCGTGT |
| Sequence-based reagent | Rpl13do | This study | PCR primers | CTGCGGTGAATGGTGCTGTC |
| Sequence-based reagent | SlitOr5 guide RNA | This study | gRNA | AGCATAAATACTGGACCCAGTGG |
| Sequence-based reagent | Or5_forward | This study | PCR primers | CCAAAAGGACTTGGACTTTGAA |
| Sequence-based reagent | Or5_reverse | This study | PCR primers | CCCGAATCTTTTCAGGATTAGAA |
Additional files
-
Supplementary file 1
List of synthetic compounds used for electrophysiology experiments.
- https://cdn.elifesciences.org/articles/49826/elife-49826-supp1-v1.docx
-
Supplementary file 2
Functional and sex-biased expression data available for lepidopteran pheromone receptors (as of September 2018).
- https://cdn.elifesciences.org/articles/49826/elife-49826-supp2-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/49826/elife-49826-transrepform-v1.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
A novel lineage of candidate pheromone receptors for sex communication in moths
eLife 8:e49826.
https://doi.org/10.7554/eLife.49826
