(A) Dorsal and ventral views showing adult dorsal mechanosensory bristles (red arrowheads), ventral chemo- and mechanosensory bristles (blue arrowhead) and dorsal chemosensory bristles (black …
(A) Schematic drawing showing the organization of the AWM bristles on a conceptually unfolded wing. Dorsal mechanosensory bristles (red and white), ventral mechanosensory bristles (blue) and …
Note that the software displays the edges of shapes cut by the bounds of the displayed section as bright areas.
(A–A’) pkpk30 adult wing and equivalent region of a pkpk30 36 hr pupal wing stained for Su(H) and actin. (B–B’) 3D views of RFP clones in a pkpk30 36 hr pupal wing revealing reversed orientation of …
(A) Complete set of rose plots for control and pkpk30 socket cell orientations at times sampled (control - 115 sockets from six wings (24 hr), 105 sockets from seven wings (28 hr), 103 sockets from …
(A) Reconstructed 3D images from varying angles of 24 hr, 28 hr, 32 hr and 36 hr shaft-socket clones marked with RFP and stained with Su(H). (B) Cartoon interpretation of images from panel A), …
(A–D) For pkpk30 (panel B) and >>sple (panel E), socket cell images (Su(H)) are from regions corresponding to those demarcated by the arrowheads. (C’, D’, E’) Quantification of socket cell rotation …
(A–B’’) V5::Pk (A–A’’) and V5::Sple (B–B’’) in pupal wings of ages indicated. Red arrowheads mark AWM and yellow arrowheads mark veins L3 and L4. (C–D’) Surface views of V5::Pk at 24 hr (C–C’) or …
(A) Western blot from wing extracts from homozygous V5::Pk and V5::Sple eyes, and wings at various developmental stages, stained with anti-V5 and then anti-Pk[C] antibodies, validating the specific …
(A, B) V5::Pk and V5::Sple surface views at the margin of 24 hr, 28 hr and 32 hr pupal wings showing declining expression of Pk, first in socket cells and then in margin cells, and increasing …
(A–D) Reversed bristle polarity in pkpk mutant compared to control is abrogated in pk fz and pk vang double mutants, demonstrating requirement for core PCP activity for polarity reversal in pkpk …
Vang::EYFP expression clones were induced in pkpk mutant wings (32h). In the distal region of the AWM, where bristle polarity is reversed, Vang::EFYP is enriched on the distal side of both socket …
3D reconstructed views of a Fz::EGFP wing (32 hr) with fz knockdown clones, stained for actin to mark wing hairs and bristle shafts, Su(H) to mark socket cells and RFP to indicate knockdown clones. …
3D reconstructed views of a Vang::EYFP wing (32h) with vang knockdown clone, stained for Su(H) to mark socket cells and RFP to indicate knockdown clone. A clone involving 2 bristles (red arrowheads) …
(A) A control (w1118) wing showing normally oriented bristles and rotated socket cells, and proximal V5::Sple. (B) A pkpk mutant wing with reversal of distal bristles, counter-rotated socket cells …
(A–D) Quantification of socket cell rotation for the genotypes (32 hr) from Figure 7C–F: w118, MS1096 >dsRNAi ((A), 74 sockets from four wings), pkpk, MS1096 >dsRNAi ((B), 72 sockets from three …
W1118 | 24 hr 5.0° | 28 hr 28.4° |
---|---|---|
24 hr 5.0° | ||
28 hr 28.4° | <0.0001 | |
32 hr 54.588° | <0.0001 | <0.0001 |
CSD = Circular Standard Deviation.
Genotype | Time | Grand Mean Vector (GM) | Length of Grand Mean Vector (r) | Number of means (wings) | Mean CSD |
---|---|---|---|---|---|
W1118 | 24 hr | 5.04° | 0.996 | 6 | 4.14 |
28 | 28.368° | 0.995 | 7 | 4.075 | |
32 | 54.588° | 0.981 | 6 | 2.940333 | |
pkpk30 | 24 hr | 0.63° | 0.988 | 3 | 7.781333 |
32 hr | 348.482° | 0.946 | 7 | 15.09 | |
pkpk-sple13 | 24 hr | 1.061° | 0.997 | 3 | 3.687 |
32 hr | 47.59° | 0.993 | 3 | 6.582 | |
pksple1 | 24 hr | 17.8° | 0.979 | 3 | 7.244667 |
32 hr | 59.288° | 0.99 | 4 | 4.24425 | |
MS1096 >> sple | 24 hr | 358.057° | 0.994 | 3 | 5.796 |
32 hr | 333.296° | 0.964 | 3 | 13.31267 | |
fzR52 | 24 hr | 3.351° | 0.998 | 3 | 3.923333 |
32 hr | 20.471° | 0.905 | 6 | 23.5668 | |
dsh1 | 24 hr | 5.684° | 0.996 | 2 | 5.023 |
32 hr | 20.144° | 0.944 | 6 | 14.316 | |
fmi RNAi | 24 hr | 1.15° | 0.996 | 3 | 4.78 |
32 hr | 19.291° | 0.978 | 4 | 11.741 | |
vangstbm6 | 24 hr | 1.51° | 0.967 | 3 | 11.52167 |
32 hr | 25.447° | 0.94 | 6 | 14.21117 | |
w1118 MS1096 > dsRNAi | 32 hr | 16.593° | 0.79 | 4 | 33.10867 |
pkpk MS1096 > dsRNAi | 32 hr | 29.323° | 0.961 | 3 | 14.37067 |
pksple MS1096 > dsRNAi | 32 hr | 6.596° | 0.97 | 3 | 12.63867 |
pkpk-sple MS1096 > dsRNAi | 32 hr | 40.297° | 0.99 | 3 | 6.219667 |
Source data for w1118.
Source data for pk30.
Source data for pkpk-sple13.
Source data for pksple1.
Source data for MS1096-GAL4; UAS-pksple.
Source data for fzR52.
Source data for dsh1.
Source data for fmiRNAi.
Source data for vangstbm6.
Source data for w1118; MS1096-GAL4; UAS-dsRNAi.
Source data for pkpk; MS1096-GAL4; UAS-dsRNAi.
Source data for pksple; MS1096-GAL4; UAS-dsRNAi.
Source data for pkpk-sple; MS1096-GAL4; UAS-dsRNAi.
32 hr angles | W1118 54.6° | pksple1 59.3° | pkpk-sple13 47.6° | pkpk30 348.5° |
---|---|---|---|---|
W1118 54.6° | ||||
pksple1 59.3° | (ns) 0.0702 | |||
pkpk-sple13 47.6° | 0.0143 | 0.0343 | ||
pkpk30 348.5° | <0.0001 | <0.0001 | 0.0004 | |
>>Pksple 333.2° | 0.0012 | <0.0001 | 0.001 | (ns) 0.1826 |
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Genetic reagent (Drosophila melanogaster) | pkpk-sple13 | Gubb et al., 1999, PMID: 10485852 | BDSC:41790; FLYB:FBal0060943; RRID:BDSC_41790 | FlyBase symbol: pkpk-sple-13 |
Genetic reagent (Drosophila melanogaster) | pkpk-sple14 | Gubb et al., 1999, PMID: 10485852 | FLYB:FBal0035401 | FlyBase symbol: pkpk-sple-14 |
Genetic reagent (Drosophila melanogaster) | pkpk30 | Gubb et al., 1999, PMID: 10485852 | BDSC:44229; FLYB:FBal0101223; RRID:BDSC_44229 | FlyBase symbol: pk30 |
Genetic reagent (Drosophila melanogaster) | pksple1 | Gubb et al., 1999, PMID: 10485852 | BDSC:422; FLYB:FBal0016024; RRID:BDSC_422 | FlyBase symbol: pksple-1 |
Genetic reagent (Drosophila melanogaster) | vangA3 | Taylor et al., 1998, PMID: 9725839 | FLYB:FBal0093183 | FlyBase symbol: VangA3 |
Genetic reagent (Drosophila melanogaster) | vangstbm6 | Wolff and Rubin, 1998, PMID: 9463361 | BDSC:6918; FLYB:FBal0062424; RRID:BDSC_6918 | FlyBase symbol: Vangstbm-6 |
Genetic reagent (Drosophila melanogaster) | fzR52 | Krasnow and Adler, 1994, PMID: 7924994 | FLYB:FBal0004939 | FlyBase symbol: fz23 |
Genetic reagent (Drosophila melanogaster) | dsh1 | Bloomington Drosophila Stock Center | BDSC:5298; FLYB:FBal0003138; RRID:BDSC_5298 | FlyBase symbol: dsh1 |
Genetic reagent (Drosophila melanogaster) | UAS-pksple | Bloomington Drosophila Stock Center | BDSC:41780; FLYB:FBti0148928; RRID:BDSC_41780 | FlyBase symbol: P{UAS-sple+}3 |
Genetic reagent (Drosophila melanogaster) | UAS-pkRNAi | Vienna Drosophila Resource Center | VDRC:v101480; FLYB:FBst0473353; RRID:FlyBase_FBst0473353 | FlyBase symbol: P{KK109294}VIE-260B |
Genetic reagent (Drosophila melanogaster) | UAS-fmiRNAi | Bloomington Drosophila Stock Center | BDSC:26022; FLYB:FBti0114752; RRID:BDSC_26022 | Flybase symbol: P{TRiP.JF02047}attP2 |
Genetic reagent (Drosophila melanogaster) | UAS-fzRNAi | Bloomington Drosophila Stock Center | BDSC:34321; FLYB:FBti0140932; RRID:BDSC_34321 | Flybase symbol: P{TRiP.HMS01308}attP2 |
Genetic reagent (Drosophila melanogaster) | UAS-vangRNAi | Bloomington Drosophila Stock Center | BDSC:34354; FLYB:FBti0140967; RRID:BDSC_34354 | Flybase symbol: P{TRiP.HMS01343}attP2 |
Genetic reagent (Drosophila melanogaster) | UAS-dsRNAi | Bloomington Drosophila Stock Center | BDSC:32964; FLYB:FBti0140473; RRID:BDSC_32964 | Flybase symbol: P{TRiP.HMS00759}attP2 |
Genetic reagent (Drosophila melanogaster) | UAS-ds | Matakatsu and Blair, 2004, PMID: 15240556 | FLYB:FBtp0019964 | Flybase symbol: P{UAS-ds.T} |
Genetic reagent (Drosophila melanogaster) | dll-GAL4 | Bloomington Drosophila Stock Center | BDSC:3038; FLYB:FBti0002783; RRID:BDSC_3038 | Flybase symbol: P{GawB}Dllmd23 |
Genetic reagent (Drosophila melanogaster) | MS1096-GAL4 | Bloomington Drosophila Stock Center | BDSC:8860; FLYB:FBti0002374; RRID:BDSC_8860 | Flybase symbol: P{GawB}BxMS1096 |
Genetic reagent (Drosophila melanogaster) | armP-fz::EGFP | Strutt, 2001, PMID:11239465 | FLYB:FBtp0014592 | Flybase symbol: P{arm-fz.GFP} |
Genetic reagent (Drosophila melanogaster) | actP-vang::EYFP | Strutt, 2002, PMID: 12137731 | FLYB:FBtp0015854 | Flybase symbol: P{Act5C(-FRT)stbm-EYFP} |
Genetic reagent (Drosophila melanogaster) | actP > CD2>vang::EYFP | Strutt, 2002, PMID: 12137731 | FLYB:FBtp0084387 | Flybase symbol: P{Act5C(FRT.polyA)stbm-EYFP} |
Genetic reagent (Drosophila melanogaster) | ci-GAL4 | Croker et al., 2006, PMID: 16413529 | FLYB:FBtp0057188 | Flybase symbol: P{ci-GAL4.U} |
Genetic reagent (Drosophila melanogaster) | UAS-mCherry | Bloomington Drosophila Stock Center | BDSC:38424; FLYB:FBti0147460; RRID:BDSC_38424 | Flybase symbol: P{UAS-mCherry.NLS}3 |
Genetic reagent (Drosophila melanogaster) | actP > CD2>Gal4 | Bloomington Drosophila Stock Center | BDSC:30558; FLYB:FBti0012408; RRID:BDSC_30558 | Flybase symbol: P{GAL4-Act5C(FRT.CD2).P}S |
Genetic reagent (Drosophila melanogaster) | UAS-RFP | Bloomington Drosophila Stock Center | BDSC:30558; FLYB:FBti0129814; RRID:BDSC_30558 | Flybase symbol: P{UAS-RFP.W}3 |
Antibody | goat polyclonal anti-Su(H) | Santa Cruz | Santa Cruz:sc-15183 RRID:AB_672840 | 1/200 (immunolabelling) |
Antibody | Mouse monoclonal anti-V5 | Thermo-Fisher | Thermo_Fisher:R960-25, RRID:AB_2556564 | 1/200 (immunolabelling) 1/1000 (Western blotting) |
Antibody | Guinea pig polyclonal anti-Pk[C] | Olofsson et al., 2014, PMID: 25005476 | N/A | 1/800 (immunolabelling) 1/1000 (Western blotting) |
Antibody | Rat monoclonal anti-dEcad | DSHB | RRID:AB_528120 | 1/200 (immunolabelling) |
Antibody | Mouse monoclonal anti-γ-Tubulin | Sigma-Aldrich | Sigma-Aldrich: T6557 RRID:AB_477584 | 1/1000 (Western blotting) |
Recombinant DNA reagent | pCFD4 | Addgene | RRID:Addgene_49411 | CRISPR gRNA backbone |
Recombinant DNA reagent | pDsRedattp | Addgene | RRID:Addgene_51019 | Donor recombinant DNA backbone |
Recombinant DNA reagent | pCR-Blunt-II-TOPO | Thermo-Fisher | RRID:Addgene_29705 | Backbone for sub-cloning |
Sequence-based reagent | pkpk gRNA 1 | This paper | gRNA sequence in PCR primers | ATGGCTCAGGCCCGATCTAG |
Sequence-based reagent | pkpk gRNA 2 | This paper | gRNA sequence in PCR primers | GTGGATCAACCCCTGGAAAC |
Sequence-based reagent | pksple gRNA 1 | This paper | gRNA sequence in PCR primers | CTCGTAAATTTAGCTTCGAG |
Sequence-based reagent | pksple gRNA 2 | This paper | gRNA sequence in PCR primers | AGATGCAATTTGGCCGCCCT |