Mature oligodendrocytes bordering lesions limit demyelination and favor myelin repair via heparan sulfate production
- Aix Marseille Univ, CNRS, IBDM, France
- MRC Centre for Regenerative Medicine, Multiple Sclerosis Society Centre for Translational Research, University of Edinburgh, United Kingdom
- Institute of Physiological Chemistry and Pathobiochemistry and Cells-in-Motion Cluster of Excellence (EXC1003-CiM), University of Münster, Germany
- Max Planck Institute for Molecular Biomedicine, Germany
Figures
Figure 1 with 2 supplements
Ndst1 up-regulation upon LPC-induced demyelination of the corpus callosum.
(A) Scheme showing the site of LPC injection (red point) in the adult corpus callosum and the location of picture shown in C (red rectangle). (B) Ndst1 expression levels (RT-qPCR) in the corpus callosum of healthy or demyelinated mice, contralateral (contra) and ipsilateral (ipsi) to the lesion site showing the Ndst1 up-regulation in the ipsilateral side. Tissues from five mice were pooled in each condition. Error bars represent S.E.M. *p<0.05, non-parametric ANOVA followed by Kruskal-Wallis test (independent two group comparisons). (C–H) Ndst1 in situ hybridization performed at 5 (C-F, n = 4), 8 (G, n = 4) and 14 (H, n = 4) dpi illustrating the Ndst1 expression pattern at different time points of demyelination (C–F) and remyelination (G–H). (D–E) Enlarged views of the CC in (C) corresponding to contralateral side (D) and positive cells at the margin of the demyelinated area at the site of LPC injection (E). CC, corpus callosum; Cx, cortex; SVZ, sub-ventricular zone; V, ventricle (structures are delineated by brown dotted lines, lesion with white dotted lines). Scale bars: 50 µm in F, G and H; 20 µm in D, F, H; 10 µm in D and E Asterisk in G indicates the site of injection since the demyelinated lesion is no longer visible at 14 dpi.
Figure 1—figure supplement 1
Ndst1 is up-regulated by the Olig2+ cell population in close proximity to inflammation sites in corpus callosum, in the experimental autoimmune encephalomyelitis mouse model of demyelination.
Ndst1 is not expressed in control brain (A) (n = 2) while it is up-regulated by Olig2+ cells after experimental autoimmune encephalomyelitis induction (B) (n = 3) in close proximity to lesions in the corpus callosum (C). Enlarged views correspond to boxed region. CC, corpus callosum. Scale bars: 50 µm in A-B; 20 µm in C.
Figure 1—figure supplement 2
PlpGFP mice (n = 3) were used to detect demyelinated lesions (A, B, D, E).
Demyelination was clearly visible in the corpus callosum around the injection site by the lack of GFP fluorescence (B, E). Hoechst staining shows a high cell density (C, F) correlating with the loss of myelin (A, D). CC, corpus callosum, Cx, cortex, V, ventricle, St, Striatum. Scale bars: 100 µm.
Figure 2
N-sulfate-enriched microenvironment forms a belt around the demyelinated lesion.
HS (10E4) labeling on the contra- (A) and ipsi- (B–C) lateral side to the lesion illustrates the generation of a N-sulfated microenvironment surrounding the lesion (delimited by white dashed lines) at five dpi (n = 3). No immunoreactivity was found after Heparinase I treatment (D) thus validating the 10E4 antibody specificity. Scale bars: 20 µm in A, B, D; 10 µm in C. CC, corpus callosum; V, ventricle.
Figure 3
Ndst1 expressing cells around the lesion belong to the oligodendroglial lineage.
(A–B) Ndst1 in situ hybridization successively combined with Olig2 immunostaining (A) or Plp in situ hybridization (B) labeling, two OLG markers, illustrating Ndst1 up-regulation in oligodendroglia lineage cells surrounding the lesion site at five dpi (n = 3). (C–D) Representative images of Ndst1/PDGFRα (C) and Ndst1/CC1 (D) co-labeling illustrating that both OPC (C) and mature OLG (D) up-regulate Ndst1 after demyelination at five dpi (n = 4). Inserts in (A–D) illustrate boxed regions at high magnification. Scale bars: 20 µm.
-
Figure 3—source data 1
Source data files of quantitative analysis of Ndst1 expressing cells around demyelination at five dpi with co-labeled with Olig2, CC1 and PDGFRα.
- https://cdn.elifesciences.org/articles/51735/elife-51735-fig3-data1-v2.xlsx
Figure 4 with 1 supplement
Ndst1 inactivation in oligodendrocyte lineage cells in Olig2-Cre+/-; Ndst1 Flox/Flox mice.
(A–B) Representative images of the lesion site (delineated by white dashed lines) in the corpus callosum of control (A) (n = 2) and mutant (B) (n = 2) mice at eight dpi illustrating the enlargement of the lesion size in mutant mice compared to control mice. Olig2 (in red) is used to label oligodendrocyte lineage cells. In situ hybridization revealed a marked reduction in Ndst1 expression surrounding the lesion site in mice with conditional inactivation in the oligodendroglial lineage cells (B, D, F) compared to control mice (A, C, E). C and D are high magnifications of the squares in A and B respectively. E and F are high magnifications of the squares in C and D respectively. Representative images of 10E4 immunostaining at the lesion site (delineated by white dashed lines. 8dpi) in the corpus callosum of control (G) and mutant (H) mice showing a strong reduction of heparan sulfate labeling in absence of Ndst1 in oligodendrocytes. (I) Quantitative analysis of heparan sulfate labeling area fraction in control and Mutant conditions (n = 4 mice per condition). Error bars represent S.E.M. *p<0.05, non-parametric Mann-Whitney test (independent two group comparisons). CC, corpus callosum, V, ventricle, St, Striatum. Scale bars: 100 µm in A-; 20 µm in C-D. 30 µm in G-H. Source files of the quantitative analyses are available in the Figure 4—source data 1.
-
Figure 4—source data 1
Source data for graph in panel I.
- https://cdn.elifesciences.org/articles/51735/elife-51735-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Myelin content and glial density in adult unlesioned Olig2-Cre+/-; Ndst1 Flox/Flox mice.
(A–B) Representative images of the myelin content in the corpus callosum of control (A) and Olig2-Cre; Ndst1 Flox/Flox (B) mice. (C) Quantitative analysis of the myelin content by double blind scoring of PLP staining in control (n = 3) and mutant mice (n = 3). Results are expressed in percentage of the control. (D–E) Astrocyte labeling by GFAP immunofluorescence in the corpus callosum of control (D) (n = 2) and mutant (n = 3) mouse brain (E). (G–H, J–K) Phenotype of oligodendroglia in the corpus callosum of control (G, J) (n = 5) and mutant (H, K) (n = 5) mice by triple immunostaining for Olig2/PDGFRα/CC1. (F, I) Quantification of mean cell density of astrocytes (GFAP+ cells) (n = 2 and 3) (F) and oligodendroglia (Olig2+ cells) (I) in the corpus callosum of control and mutant mice (n = 5 in each group). (L) Quantitative analysis of the percentage of Olig2+/CC1+ and Olig2+/PDGFRα+ in the corpus callosum of control and mutant mice (n = 3). No significant difference was observed between the two groups using non-parametric Mann-Whitney test (independent two group comparisons). Error bars represent S.E.M. Scale bars: 10 µm. Source files of the quantitative analyses are available in the Figure 4—figure supplement 1—source data 1.
-
Figure 4—figure supplement 1—source data 1
Source data for graphs in panels C, F, I and L.
- https://cdn.elifesciences.org/articles/51735/elife-51735-fig4-figsupp1-data1-v2.xlsx
Figure 5
Deletion of Ndst1 in Olig2+ cells affects lesion size and OPC mobilization after LPC-induced demyelination of the corpus callosum.
(A–B) Representative images of the lesion site (delineated by white dashed lines) in the corpus callosum of control (A) and mutant (B) mice at eight dpi illustrating the enlargement of the lesion size in mutant mice compared to control mice. (C) Quantitative analysis of the lesion size at 4, 8 and 14 dpi (n = 8,9,4 control and n = 9,12,6 mutant mice respectively). (D–E) Oligodendroglia labeled by Olig2 staining within the demyelinated area at eight dpi (E) compared to control mice (D). (F) Olig2 mean cell density in healthy (CTL) or demyelinated control and mutant mice at 4, 8, 14 dpi. (G–H) Mature OLG co-labeled by Olig2/CC1 within the demyelinated lesion at eight dpi in control (G) and mutant (H) mice. (I) Quantification of mean cell density of Olig2+/CC1+ cells within the demyelination lesion in healthy (CTL) or demyelinated control and mutant mice at 4, 8, 14 dpi. (J–K) Ki67+ immunolabeling shows the proliferation status of cells within the lesion 8dpi in control (J) and mutant (K) mouse. (L) Graph represents the cell proliferation (Ki67+ cells) in mutant relative to control mice at 4 and 8 dpi (n = 9,12 control and n = 8,16 mutant mice respectively). (M–N) Co-immunolabelling of Olig2 and Ki67 showing OPC proliferation in control (M) and mutant (N) mouse 8dpi. (I) Quantification of proliferating OPC (Ki67+/olig2+ cells) in lesion sites at 4 and 8 dpi (n = 6,11 control and n = 7,13 mutant mice respectively). Error bars represent S.E.M. *p<0.05, ***p<0.001, non-parametric Mann-Whitney test (independent two group comparisons). Scale bars: 50 µm in A, B, D, E and 10 µm in, G, H, J, K, M and N. Source files of quantitative analyses are available in the Figure 4—source data 1.
-
Figure 5—source data 1
Source data for graphs in panels C, F, I, L, and O.
- https://cdn.elifesciences.org/articles/51735/elife-51735-fig5-data1-v2.xlsx
Figure 6
Effect of Ndst1 deletion on microglia/macrophage activation.
(A–B) CD68+/Ki67+ co-immunolabeling shows the proliferation status of activated microglia/macrophages. (C) Quantification of proliferating microglia/macrophages (Ki67+/CD68+ cells) in lesion sites at 4 and 8 dpi (n = 3,7 control and n = 3,7 mutant mice respectively). Iba1 (D–E) and CD68 immunolabeling (F–G) shows the increase in rhomboid-polarized microglia/macrophages in the demyelinated area of mutant mice at eight dpi. (H) Quantification of the ratio of rhomboid/branched CD68+ cells in lesion sites at 4 and 8 dpi (n = 3,4 control and n = 3,6 mutant mice respectively) showing a switch of the microglia/macrophage polarization in favor of the rhomboid phenotype in mutant mice at eight dpi. (I–J) Cox2 immunolabeling shows an increase in this M1 phenotype marker at 8dpi in mutant mice. (K) Quantification of Cox2+ cells in lesion sites at 8dpi (n = 4 control and n = 5 mutant mice). Error bars represent S.E.M. *p≤0.05, non-parametric Mann-Whitney test (independent two group comparisons). Scale bars: 50 µm in I-J and 10 µm in A-B, D-E, F-G. Source file of quantitative analyses are available in the Figure 5—source data 1.
-
Figure 6—source data 1
Source data for graphs in panels C, H and K.
- https://cdn.elifesciences.org/articles/51735/elife-51735-fig6-data1-v2.xlsx
Figure 7
AP-tagged Shh protein binds to HS concentrated around LPC-induced lesions in the corpus callosum.
Representative images of adjacent serial coronal sections derived from control mice 4 days after LPC injection and incubated with the fusion proteins AP-Shh-WT (A–B’) or AP-Shh-CW in which the CW sequence responsible for HS binding is absent (C–D) (n = 4). The lesion site is delineated by dashed lines. Staining using B-gal is clearly visible around the lesion after AP-Shh incubation (B–B’), while no staining is observed when the AP-Shh-CW deleted protein is used (D). These data show that Shh is concentrated around the lesion and that this distribution depends on the integrity of the HS binding motif. (E) Quantification of Ptch1 expression at 8dpi in control and mutant mice reported in number of dots per cell (n = 4 control and n = 5 mutant mice, p=0.07). (F–G) Illustration of Ptch1 expression in peri-lesional areas in control (F) and mutant (G) mice after labeling as detected by RNAscope technology. CC, corpus callosum; Cx, cortex. Scale bars: 100 µm in A-D. 10 µm in F and G. Source file of quantitative analysis is available in the Figure 6—source data 1.
-
Figure 7—source data 1
Source data for graph in panel E.
- https://cdn.elifesciences.org/articles/51735/elife-51735-fig7-data1-v2.xlsx
Figure 8 with 2 supplements
NDST1 is highly expressed in MS tissue and NDST1+OLIG2+ cell density negatively correlates with lesion size.
(A–B) Representative images of NDST1 staining in control (A) and MS (B) WM. (C) Quantification of NDST1 labeling shows a significant over-expression of NDST1 in MS lesions (n = 9) compared to control tissue (n = 4) (Kruskal-Wallis test, H = 13.09, n = 4,9,9, p<0.01, means plus standard deviation). The colors represent paired samples from the same patients. (D–G) Representative images of immunostaining against NDST1 successively co-labeled with OLIG2+ for oligodendroglia (D), GFAP+ for astrocytes (E), NEUN+ for neurons (F), and IBA1+ for microglia/macrophages (G). (H) Quantification of the proportions of different NDST1+ cell types in normal appearing WM and various MS lesions shows that NDST1 expressing cells are mainly oligodendroglia. (I) The proportion of OLIG2+ cells which is NDST1+ is significantly increased in active lesions compared to control (Kruskal-Wallis test, H = 13.92, n = 7,21,4,14,14 p<0.05). Overall, the majority of OLIG2+ cells are NDST1+ in MS lesions and NAWM while this is not true in control brain tissue. (J) The number of oligodendroglia expressing NDST1 is inversely correlated to lesion size. (K) NDST1+ cell numbers positively correlate with the remyelination score assigned to each patient, summing all lesions within blocks from the same MS patients (see Materials and methods). NAWM, normal appearing white matter; RM, remyelinated lesion; A, active lesion; CA, chronic active lesion; CI, chronic inactive lesion. Scale bars represent 50 µm (A–B) or 10 µm (D–G). Source files of quantitative analyses are available in the Figure 7—source data 1.
-
Figure 8—source data 1
Source data for graphs in panels C, I, J and K.
- https://cdn.elifesciences.org/articles/51735/elife-51735-fig8-data1-v2.xlsx
Figure 8—figure supplement 1
Comparisons of Ndst1 expression levels in control and MS brain tissue from all nuclei (A), or just oligodendroglia (B) showing a tendency to increased levels in MS samples.
Data extracted from snRNA seq (Carrasco et al., 2005).
Figure 8—figure supplement 2
NDST1 staining is specific and no lesion belt effect is observed in human brain.
(A) Staining with NDST1 antibody in MS WM (B) There is no staining of MS WM with NDST1 antibody in in the presence of human recombinant NDST1. (C) LFB stain of MS tissue with the lesion delineated in red. (D) Representative NDST1+ staining in lesion (delineated with red line) shows uniform NDST1+ cell distribution. Scale bars: 100 µm.
Tables
Table 1
Classification and characteristic of human post-mortem samples.
| Patient | Sex | Age (years) | MS type | Disease duration (years) | Time to post mortem (h) | Number of lesions | Active | Chronic active | Chronic inactive | Remyeli-nating | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS | MS100 | M | 46 | SP | 8 | 7 | 6 | 0 | 0 | 4 | 2 |
| MS121 | F | 49 | SP | 14 | 24 | 2 | 1 | 0 | 1 | 0 | |
| MS122 | M | 44 | SP | 10 | 16 | 2 | 1 | 1 | 0 | 0 | |
| MS136 | M | 40 | SP | 9 | 10 | 9 | 1 | 0 | 3 | 5 | |
| MS154 | F | 34 | SP | 21 | 12 | 4 | 2 | 0 | 1 | 1 | |
| MS176 | M | 37 | PP | 27 | 12 | 7 | 0 | 0 | 2 | 5 | |
| MS187 | F | 57 | SP | 27 | 13 | 4 | 0 | 0 | 0 | 4 | |
| MS207 | F | 46 | SP | 25 | 10 | 8 | 0 | 3 | 3 | 2 | |
| MS230 | F | 42 | SP | 19 | 31 | 4 | 2 | 0 | 0 | 2 | |
| Control | CO14 | M | 64 | - | - | 26 | - | - | - | - | - |
| CO25 | M | 35 | - | - | 22 | - | - | - | - | - | |
| CO28 | F | 60 | - | - | 13 | - | - | - | - | - | |
| CO39 | M | 82 | - | - | 21 | - | - | - | - | - | |
| Total | 46 | 7 | 4 | 14 | 21 | ||||||
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Olig2Cre | PMID:18046410 | B6D2F1J/Rj genetic background | |
| Genetic reagent (M. musculus) | Ndst1flox/flox | PMID:16020517 | Dr. Kay Grobe (University of Münster, Münster, Germany) | |
| Genetic reagent (M. musculus) | Plpgfp | PMID:15906234 PMID:11756747 | Dr. Bernard Zalc (University of Sorbonne, Paris, France) | |
| Biological sample (H. sapiens) | Brain tissue from 9 MS patients | UK Multiple Sclerosis Tissue Bank (MREC/02/2/39) | Postmortem unfixed frozen | |
| Biological sample (H. sapiens) | Brain tissue from 4 Control patients | UK Multiple Sclerosis Tissue Bank (MREC/02/2/39) | Postmortem unfixed frozen | |
| Cell line (H. sapiens) | 293T HEK | ATCC | CRL3216 | |
| Transfected construct (M. musculus) | pWiz-AP-SHH | PMID:16020517 | Production of AP-tagged SHH recombinant protein | |
| Transfected construct (M. musculus) | pWiz-AP-SHH-CWdeleted | PMID:11959830 | Production of AP-tagged deleted SHH recombinant protein | |
| Antibody | Rabbit polyclonal anti-OLIG2 | Millipore | AB9610 | IF (1/1000) |
| Antibody | Rabbit polyclonal anti-OLIG2 | Sigma-Aldrich | HPA003254 | IF (1/100) |
| Antibody | Mouse monoclonal anti-APC (clone CC1) | Calbiochem | OP-80 | IF (1/400) |
| Antibody | Rat monoclonal anti-PDGFRa (clone APA5) | Millipore | CBL1366 | IF (1/250) |
| Antibody | Mouse monoclonal anti-MBP | Millipore | MAB384 | IF (1/500) |
| Antibody | Mouse monoclonal anti-Ki67 | BD Pharmingen | 556003 | IF (1/500) |
| Antibody | Rabbit polyclonal anti-Caspase 3 | Cell Signalling | 9661 | IF (1/200) |
| Antibody | Rabbit polyclonal anti-GFAP | Dako | Z0334 | IF (1/400) |
| Antibody | Goat polyclonal anti-IBA1 | Abcam | Ab5076 | IF (1/500) |
| Antibody | Rabbit polyclonal anti-IBA1 | Wako Chemicals | 019–19741 | IF (1/500) |
| Antibody | Rat monoclonal Anti-CD68 | Abcam | Ab53444 | IF (1/400) |
| Antibody | Rabbit polyclonal anti-COX2 | Abcam | Ab15191 | IF (1/400) |
| Antibody | Mouse monoclonal IgM anti-N-sulfated motifs on HS chains (clone10E4) | Amsbio | 370255–1 | IF (1/500) |
| Antibody | Mouse monoclonal anti-NDST1 | Abcam | ab55296 | IF (1/50) |
| Antibody | Rabbit polyclonal anti-NeuN | Abcam | Ab104225 | IF (1/500) |
| Sequence-based reagent | Ndst1_F | Eurofins Genomics | RT-qPCR primers | gctggacaagatcatcaatgg |
| Sequence-based reagent | Ndst1_R | Eurofins Genomics | RT-qPCR primers | acacagtacttctacgactatcc |
| Sequence-based reagent | Gapdh_F | Eurofins Genomics | RT-qPCR primers | gggttcctataaatacggactgc |
| Sequence-based reagent | Gapdh_R | Eurofins Genomics | RT-qPCR primers | ctggcactgcacaagaagat |
| Sequence-based reagent | plp/dm20 | PMID:9373029 | Probe for ISH | |
| Sequence-based reagent | Ndst1 | PMID:16020517 | Probe for ISH | |
| Sequence-based reagent | Ptch1 | Advanced Cell Diagnostics | 402811-C2 | Probe for RNAScope |
| Peptide, Recombinant Protein | Human NDST1 | Abcam | ab116875 | |
| Commercial assay or kit | RNAscope Multiplex Fluorescent kit | Advanced Cell Diagnostics | 323133 | |
| Commercial assay or kit | DAB Peroxidase (HRP) Substrate Kit (with Nickel) | Vector Laboratories | SK-4100 | |
| Commercial assay or kit | VECTOR Blue AP Substrate Kit | Vector Laboratories | SK-5300 | |
| Commercial assay or kit | ImmPRESS-AP Anti-Rabbit IgG Polymer Detection Kit | Vector Laboratories | MP-5401 | |
| Commercial assay or kit | ImmPRESS HRP Anti-Mouse IgG Polymer Detection Kit | Vector Laboratories | MP-7402 | |
| Chemical compound, drug | Lysolecithin | Sigma-Aldrich-Merck | L1381 | |
| Chemical compound, drug | Heparinase | Amsbio | 100700 | |
| Chemical compound, drug | Lipofectamine 2000 | Invitrogen | 11668–030 | |
| Chemical compound, drug | Vector Bloxall | Vector Laboratories | SP-6000 | |
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij/ | ||
| Software, algorithm | Zen two lite | Zeiss | ||
| Software, algorithm | GraphPad Prism | https://graphpad.com |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Mature oligodendrocytes bordering lesions limit demyelination and favor myelin repair via heparan sulfate production
eLife 9:e51735.
https://doi.org/10.7554/eLife.51735
