Figures and data in Drosophila TRIM32 cooperates with glycolytic enzymes to promote cell growth

Figures
Tables
Additional files

9 figures, 2 tables and 1 additional file

Figures

Figure 1 with 1 supplement

Download asset Open asset

The NHL region of *Drosophila* TRIM32 is structurally conserved.

(A) Schematic showing the RING, B-box, coiled-coil, and NHL domains in TRIM32. (B) Superimposed protein structures of the six NHL repeats in *Drosophila* (magenta) and *Mus musculus* (blue) TRIM32. Each NHL repeat consists of four antiparallel beta sheets that are arranged toroidally around a central axis. Mouse NHL has two additional loops (asterisks) not present in the fly protein. The positions and orientation of both R394/R1114 and D487/D1211 are identical between *Mus musculus* and *Drosophila* (orange). (C) The glycolytic pathway. Peptides corresponding to enzymes that co-purified with TRIM32_NHL are shown in blue.

Figure 1—source data 1 X-ray diffraction data collection and refinement statistics.: https://cdn.elifesciences.org/articles/52358/elife-52358-fig1-data1-v1.docx
Download elife-52358-fig1-data1-v1.docx
Figure 1—source data 2 Proteins identified via MS that co-purify with TRIM32-NHL Experiment #1 (1418) Experiment #2 (1426.1) Experiment #3 (1426.2).: https://cdn.elifesciences.org/articles/52358/elife-52358-fig1-data2-v1.docx
Download elife-52358-fig1-data2-v1.docx

Figure 1—figure supplement 1

Download asset Open asset

Crystal structure of the *Drosophila* TRIM32_NHL domain.

(**A,B**) Representative electron density maps. Two images showing regions of the final 2Fo-Fc electron density map (grey cage) corresponding to the NHL region of *Drosophila* TRIM32, contoured at 1.2 σ. The polypeptide is drawn in ball and stick convention (carbon atoms in purple). (C) Ribbon diagrams corresponding to the TRIM32_NHL domain are rendered in rainbow colors from red at the N-terminus to blue at the C-terminus. Top view (top panel) reveals six NHL repeats, each consisting of four antiparallel beta sheets that together are arranged toroidally around a central axis. Side view (bottom panel) shows that the NHL repeats form a compact structure with few extended loops.

Figure 2 with 1 supplement

Download asset Open asset

*Drosophila* TRIM32 physically interacts with the glycolytic enzymes Ald and Pglym78.

(**A,B**) In vitro binding assays. Untagged TRIM32_NHL was incubated with either the His-tagged SCIN control protein or the His-tagged candidate proteins Ald (A) or Pglym (B). After washing in 300 mM NaCl and 0.1% Triton, each of these protein complexes was separated by SDS-PAGE followed by Coomassie staining. Ald and Pglym proteins directly bind the NHL region of TRIM32, while no interaction with the His-SCIN control protein is observed. (**C,D**) Western blotting with antibodies against *Drosophila* Ald (dAld; C) or *Drosophila* Pglym (dPglym; D) detects higher molecular weight bands (asterisk) upon immunoprecipitation of *Drosophila* TRIM32, but not in control lanes. The observed molecular weights of Ald or Pglym in input larval lysates (~30 µg) is predominant over a higher migrating form that can be visualized after overexposure of blots with concentrated lysate (~300 µg). (**E,F**) Western blots showing that mutations in tn reduce Ald (E) or Pglym (F) protein levels ~ 50% quantitated relative to ATP5α in L3 larvae. N = 3. Mean +/- SD (*, p<0.05).

Figure 2—figure supplement 1

Download asset Open asset

TRIM32 co-purifies with Tm2 and other proteins.

(A) In vitro binding assay shows that His-tagged Tm2, but not the His-tagged SCIN control protein, directly binds untagged TRIM32_NHL. (B) Tm is found to co-immunoprecipitate with TRIM32 in L3 larval lysates. (C) Western blot depicting overall protein levels in WT or *tn-/-* whole larvae quantitated relative to ATP5α. Tm protein levels are increased in *tn-/-* mutants compared to WT controls. N = 3. (**D,E**) Immunoprecipitation of TRIM32 from L3 larval lysates co-purifies with Ald or Pglym. The glycolytic proteins are detected using antibodies against human ALD or PGAM1. Asterisk denotes the high molecular weight band that was also detected with *Drosophila* antibodies in Figure 2. (**F,G**) qPCR shows there is no decrease in the mRNA levels of *Ald* (F) or *Pglym* (G) in *tn-/-* at the L3 stage. mRNA was normalized to *rp49* transcripts. N = 3 biological replicates and three technical replicates for each genotype. Mean +/- SD (*, p<0.05; n.s., not significant).

Figure 3 with 1 supplement

Download asset Open asset

Loss of TRIM32 decreases glycolytic flux and reduces muscle tissue size.

(A) Volcano plot illustrating fold change (FC) (log base 2) compared with p-value (- log base 10) between WT and *tn-/-* L3 larvae. Vertical line represents FC >1.5. Horizontal line depicts a significance level p<0.05. Metabolites that are reduced in *tn-/-* larvae include indicators of glycolytic flux (green) and amino acids (blue). Metabolites in gray are significant, but exhibit a FC <1.5. (B) Box and whisker plot of terminal glycolytic metabolites significantly reduced upon loss of TRIM32. N = 6. (**C–F**) Ventral longitudinal muscles 3 (VL3) and 4 (VL4) stained with phalloidin to visualize F-actin (green). (**C,D**) The stereotypical morphology of WT muscles is not altered as overall muscle size increases from the L2 (C) to the L3 (D) stage. (**E,F**) In addition to sarcomeric disorganization, the VL3 and VL4 muscles are noticeably smaller in *tn-/-* larvae during L2 (E) and L3 (F) development. Muscle attachment sites (MASs) are denoted by yellow lines. (G) Scatter plot depicting VL3 muscle diameter. The diameter of WT muscles increase from the L2 to the L3 stage. This cell size increase is abolished in *tn-/-.* N ≥ 8. (H) Bar graph shows that ECAR measurements are decreased in isolated *tn-/-* muscle carcasses compared to WT. N ≥ 4. (I) Analysis of the glycolytic rate in WT or *tn-/-* muscle tissue after subtraction of mitochondrial-produced acidification. This PER is diminished upon loss of TRIM32. N = 4. (J) NADH lifetime image comparison of WT and *tn-/-* muscles. Box and whisker plot shows WT muscles have significantly lower NADH lifetime, indicative of higher glycolytic flux, than *tn-/-*. N = 5. Mean +/- SD. (****, p<0.001; ***, p<0.01; *, p<0.05; n.s., not significant). Scale bars: 25 µm (**C,E**), 50 µm (**D,F**).

Figure 3—figure supplement 1

Download asset Open asset

Metabolite analysis upon loss of TRIM32.

(A) PCA analysis depicting metabolite variances between WT (green) and *tn-/-* (magenta) L3 larvae. PC1, principal component 1. PC2, principal component 2. (B) Scatter plot reveals CO₂ production is slightly elevated upon loss of TRIM32 in all tissues. N = 5. (C) Bar graph depicts reduction in ATP levels in *tn-/-*L3 larvae. N = 25. (D) Pathway analysis reveals a large proportion of amino acid biosynthetic pathways are impacted upon loss of TRIM32. p-Value significance is plotted on the y-axis (yellow to red depict increased p-values). More metabolites affected in a particular pathway increase from left to right along the x-axis. Mean +/- SD (****, p<0.001; *, p<0.05).

Figure 4

Download asset Open asset

Muscle defects are cell autonomous and can be rescued upon stabilization of glycolytic enzyme levels.

(**A–E**) Knockdown of TRIM32 in muscle tissue decreases muscle size and reduces lactate levels. (**A–C**) Phalloidin-labeled VL1-4 muscles in a representative hemisegment of the indicated genotypes. (A) *mef2>+* control muscles appear WT. (**B,C**) RNAi knockdown of tn in all muscles with *mef2*-Gal4 (B) or only muscle VL1 using the *5053*-Gal4 driver (C) show a reduction in muscle size (asterisk). (D) Knockdown of tn mRNA transcripts with three independent UAS-*tn RNAi* constructs in muscle tissue under control of the *mef2* promoter (*mef2 >tn RNAi*) show reduced VL3 muscle diameter compared to *mef2/+* VL3 muscles. N ≥ 10. (E) Bar graph reveals a cell autonomous role for TRIM32 in muscle tissue. L-lactate levels in muscle carcasses are decreased upon loss of TRIM32 in all tissues. Induction of *tn RNAi* in muscle, but not neuronal tissue, reduces the concentration of muscle-derived lactate. N > 8. (**F–J**) Muscle-specific expression of TRIM32 (*tn-/-, mef >TRIM32*) or ERR (*tn-/-, mef >ERR*) in a *tn-/-* background attenuates the loss of muscle size, muscle contraction, and stabilizes glycolytic protein levels. (F) Scatter plot shows that the reduced VL3 muscle diameter upon loss of TRIM32 is restored upon expression of TRIM32 or ERR in muscle tissue. N ≥ 10. (**G,H**) The inability to contract body wall muscles in *tn-/-* causes elongated pupae. Muscle-specific expression of TRIM32 or ERR restores muscle contraction. (G) Representative pupal cases of the indicated genotypes. (H) Quantitation of pupal axial ratios represented by a box and whisker plot. N = 10. (**I,J**) Western blots showing the relative amounts of Ald or Pglym protein relative to the ATP5α loading control. Both Ald and Pglym protein levels are stabilized upon TRIM32 or ERR expression in muscle tissue compared to *tn-/-.* N = 3. Mean +/- SD (****, p<0.001; ***, p<0.01; **, p<0.05; *, p<0.01; n.s., not significant).

Figure 5

Download asset Open asset

Amino acid supplementation is sufficient to improve *tn-/-* muscle mass.

(A) Box and whisker plots showing the relative abundance of individual amino acids in L3 larvae with a FC >1.5 (left panel) or FC <1.5 (right panel) that are significantly reduced upon loss of TRIM32. N = 6. (**B–E**) Maximum intensity projections of WT (B) or *tn-/-* (**C–E**) L3 muscles stained for F-actin. Upper panel depicts two complete hemisegments and lower panel focuses on the VL3 and VL4 muscles. MASs are denoted by yellow lines. (B) An example of thinner WT musculature reared on agar as a sole nutritional source. (C) Muscles in larvae deficient for TRIM32 are substantially thinner when raised on agar alone. (**D,E**) Suppression of the reduced muscle diameter is observed in *tn-/-* muscles supplemented with total yeast extract (D) or amino acids (E) compared to *tn-/-* muscles alone. (F) Scatter plot showing the diameter of muscle VL3 in WT or *tn-/-* exposed to the indicated nutritional diets. N ≥ 32. (G) Average body mass measurements of WT or *tn-/-* L3 larvae. Ten individuals were weighed for each biological replicate that was performed in triplicate. (H) Representative pupal cases grown on the indicated diets. (I) The axial ratio (length/width) of pupal cases represented by box and whisker plots. N ≥ 10. Mean +/- SD. (****, p<0.001; *, p<0.05; n.s., not significant). Scale bars: 100 µm (**A-D**, upper panel), 50 µm (**A-D**, lower panel), 1 mm (H).

Figure 6 with 1 supplement

Download asset Open asset

TRIM32 maintains glycolytic-mediated growth in the larval brain.

(**A–F**) L3 larval brains labeled with DAPI (blue) and F-actin (green). (A) A representative micrograph of a WT larval brain showing the individual brain lobes (BL) and the ventral nerve cord (VNC). (B) The overall size of *tn-/-* brains is reduced due to mutations in tn. (C) Control brains expressing the pan-neuronal *elav*-Gal4 driver. (D) RNAi knockdown of tn in neurons under control of the *elav* promoter causes smaller brains. (**E,F**) Expression of *mef2*-Gal4 alone (E) or *mef2 >tn RNAi* in muscle tissue does not alter brain size (F). (G) Scatter plot depicting the entire brain area (including the BL and VNC) of WT, *tn-/-,* Gal4 driver controls, or tissue-specific *tn RNAi* knockdown brains. N ≥ 9. (H) Glycolytic rate assay shows a reduction in the proton efflux rate (PER) upon loss of TRIM32 in isolated L3 larval brains. The glycolytic rate is calculated after subtraction of mitochondrial-produced acidification. N = 4. (I) Bar graph representing L-lactate levels in isolated larval brain tissue. Only loss of TRIM32 in brain, but not muscle tissue, caused a reduction in L-lactate levels. N ≥ 15. Scale bar: 100 µm (**A–F**). Mean +/- SD. (****, p<0.001; ***, p<0.01; n.s., not significant).

Figure 6—figure supplement 1

Download asset Open asset

Cell proliferation or cell death are not affected in *tn-/-*.

(A) Endogenous LDH-GFP (green) expression in the somatic muscles of whole larvae (left) and isolated larval brain (right). DAPI (blue) is used to visualize the entire brain lobe. (**B,C**) EdU incorporation (green) in whole larval brains (left panels) or individual brain lobes (right panels) reveals no difference in the proliferative capacity of neuroblasts. DAPI (blue) demarcates the outlines of each tissue. (D) Scatter plot depicting the average number of EdU(+) cells normalized to the brain lobe area. N ≥ 9. (**E–I**) Individual brain lobes (white dotted outline) visualized with TUNEL (**E–G**) or cleaved caspase3 immunostaining (**H,I**) to assay apoptotic cells. There is no difference in the number of TUNEL(+) or Caspase3(+) cells in WT or *tn-/-.* Tissue treated with DNase served as a positive control for TUNEL labeling (E). (**J–M**) Analysis of cell size in the larval brain lobe. (J) Schematic of larval brain. Blue box indicates region of brain lobe images. (**K,L**) Representative micrograph of phalloidin-stained cells in the lobe region of WT (K) or *tn-/-* brains (L). (M) Quantification reveals various sizes of neuroblasts in brain lobe tissue. Overall cell size is reduced upon loss of TRIM32. N ≥ 300 cells in 10 independent brain lobes of each genotype. Mean +/- SD (****, p<0.001; n.s., not significant).

Figure 7 with 2 supplements

Download asset Open asset

Loss of TRIM32 reduces Pvr-induced glycolytic tumor growth.

(**A–C**) Either intact (upper panel; red) or isolated (lower panel, blue) wing discs from L3 larvae of the indicated genotypes. LDH-GFP is high in somatic muscles (white arrow). Wing discs are outlined (white dotted outlines). (A) The normal size and shape of control *dpp-Gal4/+* wing discs. (B) Overexpression of the activated Pvr receptor (*dpp >Pvr^act*) causes tissue overgrowth and an increase in LDH-GFP expression (green). (C) Tumor growth in a *tn-/-* host is dramatically reduced in size. (D) Overall wing disc volumes are represented in this column plot. N ≥ 15. (E) Approximately 50% of LDH-GFP(+) cells induced by activated Pvr expression is reduced upon loss of TRIM32. N = 20. (F) Representative fluorescence lifetime micrographs of control (WT or *tn-/-*) or tumorous (*dpp >Pvr^act* or *tn-/-; dpp >Pvr^act*) wing discs. (G) Box and whisker plot confirms no difference in the glycolytic profile between WT or *tn-/-* discs. The decreased lifetime in *dpp >Pvr^act* discs, indicative of higher glycolytic flux, is reduced upon loss of TRIM32. N = 6. Mean +/- SD. (****, p<0.001; *, p<0.05; n.s., not significant). Scale bars: 0.5 mm (A-C, upper panels), 100 µm (A-C, lower panels).

Figure 7—figure supplement 1

Download asset Open asset

Wing disc size and glycolysis are not altered in *tn-/-*.

(**A,B**) Isolated L3 wing discs are the same size when isolated from WT (A) or *tn-/-* (B) L3 larvae. (C) Scatter plot depicting the relative wing disc area in the indicated genotypes. N ≥ 20. (D) PER, a measure of the glycolytic rate, between WT and *tn-/-* wing discs appear similar. N = 10. Mean +/- SD. (****, p<0.001; *, p<0.05; n.s., not significant).

Figure 7—figure supplement 2

Download asset Open asset

Glucose uptake and feeding behavior upon whole animal or tissue-specific loss of TRIM32.

(**A–D**) Incubation of the fluorescent glucose analog 2-NBDG with isolated larval brains (**A,B**) or *Pvr^act* tumors (**C,D**) from L3 larvae show no visible difference in glucose uptake. (E) Mount hook contractions, a proxy for feeding behavior, is decreased in *tn-/-* larvae. N = 9. (**F,G**) Isolated L3 midguts from WT (F) or *tn-/-* (G) stained with phalloidin. (H) Quantitation of total midgut area is not significantly different between WT and *tn-/-.* N = 8. (I) L3 larvae after feeding dye for 24 hr. (J) Bar graph shows measured absorbance readings from L3 isolated midguts after for 3 hr or 24 hr of feeding. *tn-/-* show differential food intake, while tissue-specific knockdown of TRIM32 in muscle or brain after 24 hr does not alter food intake. Mean +/- SD. (***, p<0.005; **, p<0.01; n.s., not significant).

Figure 8

Download asset Open asset

Model for TRIM32 function in the regulation of cell size.

Biochemical interactions between TRIM32 and glycolytic enzymes such as Ald or Pglym cooperate in maintaining glycolytic activity for the synthesis of macromolecules required for cell growth. Loss of TRIM32 results in reduced levels of glycolytic enzymes, reduced glycolytic pathway intermediates, and compromises cell growth.

Author response image 1

Download asset Open asset

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Drosophila melanogaster)	thin (tn)	LaBeau-DiMenna et al., 2012	FLYB:FBgn0265356
Gene (D. melanogaster)	Aldolase 1 (Ald)		FLYB:FBgn0000064
Gene (D. melanogaster)	Phosphogylcerate mutase 78 (Pglym)		FLYB:FBgn0014869
Genetic reagent (D. melanogaster)	w¹¹¹⁸	Bloomington Drosophila Stock Center (BDSC)	BL3605
Genetic reagent (D. melanogaster)	tnΔA	LaBeau-DiMenna et al., 2012
Genetic reagent (D. melanogaster)	CyO, Tb/Sco	BDSC	BL36335
Genetic reagent (D. melanogaster)	mef-Gal4	BDSC	BL27390
Genetic reagent (D. melanogaster)	elav-Gal4	BDSC	BL458
Genetic reagent (D. melanogaster)	5053Gal4	BDSC	BL2702
Genetic reagent (D. melanogaster)	UAS-tn RNAi-A	Vienna Drosophila Resource Center (VDRC)	v19290
Genetic reagent (D. melanogaster)	UAS-tn RNAi-B	BDSC	BL31588
Genetic reagent (D. melanogaster)	UAS-tn RNAi-C	VDRC	v19291
Genetic reagent (D. melanogaster)	dpp-UAS-mcherry, LDH-GFP	Wang et al., 2016
Genetic reagent (D. melanogaster)	UAS-Pvr^act	Wang et al., 2016
Genetic reagent (D. melanogaster)	LDH-optGFP	Materials and methods
Genetic reagent (D. melanogaster)	UAS-TRIM32	LaBeau-DiMenna et al., 2012
Genetic reagent (D. melanogaster)	UAS-ERR-FLAG	Materials and methods
Antibody	anti-TRIM32 (guinea pig polyclonal)	LaBeau-DiMenna et al., 2012		(1:500)
Antibody	anti-Pglym (rabbit polyclonal)	Sullivan, 2003		(1:1000) from Jim Vigoreaux
Antibody	anti-Ald (rabbit polyclonal)	Sullivan, 2003		(1:1000) from Jim Vigoreaux
Antibody	anti-Tm (rat monoclonal)	Babraham Institute	MAC141	(1:500)
Antibody	anti-hALD	Biorad	VPA00226	(1:1000)
Antibody	anti-hPGAL1	Cell Signaling	D3J9T	(1:1000)
Antibody	anti-ATP5α (mouse monoclonal)	Abcam	Catalog# ab14748	(1:10000)
Antibody	anti-Cleaved Caspase-3	Cell Signaling	Catalog# 9661	(1:100)
Antibody	Alexa 488 secondaries	Thermo Fisher	Catalog# A12379	(1:400)
Antibody	Rabbit IgG HRP Linked Whole Ab	GE Healthcare	NA934-1ML	(1:3000-1:5000)
Antibody	Mouse IgG HRP Linked Whole Ab	GE Healthcare	NA931-1ML	(1:3000-1:5000)
Recombinant DNA reagent	pGEX-5X-2_TRIM32_NHL	Materials and methods		nucleotides 3231–4062
Recombinant DNA reagent	pT7HMT_Ald	Materials and methods		His-tagged Ald
Recombinant DNA reagent	pT7HMT_Pglym	Materials and methods		His-tagged Pglym
Recombinant DNA reagent	pT7HMT_SCIN	Ricklin et al., 2009		His-tagged SCIN
Sequence-based reagent	pGEX-5X-2_NHL_5’F	Integrated DNA Technologies (IDT)		Oligonucleotide GGGATCCCCGGAATTCCCCTGCGCAAGCGCCAGCAGCTGTTC
Sequence-based reagent	pGEX-5X-2_NHL_5’R	Integrated DNA Technologies (IDT)		Oligonucleotide ATAAGAATGCGGCCGCCTGGCGCTTGCGCAGGTACACCTG
Sequence-based reagent	pT7HMT_Tm2_5’F	Integrated DNA Technologies (IDT)		Oligonucleotide ACAGGATCCATGGACGCCATCAAGAAGAAG
Sequence-based reagent	pT7HMT_Tm2_5’R	Integrated DNA Technologies (IDT)		Oligonucleotide AAGGAAAAAAGCGGCCGCTTAGTAGCCAGCCAATTCGGC
Sequence-based reagent	pT7HMT_Ald_5’F	Integrated DNA Technologies (IDT)		Oligonucleotide ACAGGATCCATGACGACCTACTTCAACTACC
Sequence-based reagent	pT7HMT_Ald_5’R	Integrated DNA Technologies (IDT)		Oligonucleotide AAGGAAAAAAGCGGCCGCTCAATACCTGTGGTCATCCAC
Sequence-based reagent	pT7HMT_Pglym_5’F	Integrated DNA Technologies (IDT)		Oligonucleotide CAGGGGTCGACAATGGGCGGCAAGTACAAGATC
Sequence-based reagent	pT7HMT_Pglym_5’R	Integrated DNA Technologies (IDT)		Oligonucleotide AAGGAAAAAAGCGGCCGCTTACTTGGCCTTGCCCTGGGC
Sequence-based reagent	UAS—2xFLAG-ERR_5’F	Integrated DNA Technologies (IDT)		Oligonucleotide AGCGGCCGCCATGGACTACAAGGACGACGATGACAAGGGTGACTACAAGGACGACGATGACAAGGGTATGTCCGACGGCGTCAGCATC
Sequence-based reagent	UAS—2xFLAG-ERR_3’F	Integrated DNA Technologies (IDT)		Oligonucleotide AGCGGCCGCTTATCACCTGGCCAGCGGCTCGAGC
Commercial assay or kit	ATP Determination Kit	Molecular Probes	Catalog# A22066
Commercial assay or kit	Bradford Assay kit	Bio-Rad	Catalog# 5000001
Commercial assay or kit	RNAeasy Mini Kit (50)	Qiagen	Catalog# 74104
Commercial assay or kit	DeadEnd Fluorometric TUNEL System	Promega	Catalog# G3250
Commercial assay or kit	Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 488 dye	Thermo Fisher	Catalog# C10337
Commercial assay or kit	ECL Plus Western Blotting Detection kit	Thermo Fisher	Catalog# 32132
Commercial assay or kit	SuperScript VILO cDNA Synthesis Kit	Invitrogen	Catalog# 11754050
Commercial assay or kit	EnzyChromTM L-Lactate Assay Kit	BioAssay Systems	Catalog# ECLC-100
Commercial assay or kit	Power UP SYBR Green Master mix	Applied Biosystems	Catalog# A25741
Chemical compound, drug	DAPI (4′,6-diamidino-2-phenylindole, Dihydrochloride)	Thermo Fisher	Catalog# D1306
Chemical compound, drug	2-NBDG	Cayman Chemicals	Catalog# 186689-07-6
Chemical compound, drug	Erioglaucine disodium salt	Milipore Sigma	Catalog# 861146
Chemical compound, drug	Formaldehyde, 16% Methanol-free, ultra-pure EM Grade	Polyscience	Catalog# 1881lawr4
Chemical compound, drug	Triton X-100	Sigma-Aldrich	Catalog# 9002-93-1
Chemical compound, drug	Tween20	Sigma-Aldrich	Catalog# 9005-64-5
Chemical compound, drug	Glycerol	Fisher	Catalog# BP229-1
Chemical compound, drug	Methanol	Fisher	Catalog# A412P-4
Chemical compound, drug	Bromophenol-blue	Amresco	Catalog# 0449–25G
Chemical compound, drug	DTT (1,4-Dithiothreitol)	Sigma-Aldrich	Catalog# 3483-12-3
Chemical compound, drug	Tris base	Fisher	Catalog# BP152-5
Chemical compound, drug	Sodium Chloride	Fisher	Catalog# BP358-212
Chemical compound, drug	Hydrochloric acid	Fisher	Catalog# A144-50/A144S212
Chemical compound, drug	Potassium Chloride	Fisher	Catalog# BP366-500
Chemical compound, drug	Magnesium Chloride	Fisher	Catalog# M-33
Chemical compound, drug	Sodium Bicarbonate	Fisher	Catalog# S233-500
Chemical compound, drug	Calcium Chloride Dihydrate	Fisher	Catalog# C-79
Chemical compound, drug	Sodium Dodecyl Sulphate	Fisher	Catalog# BP166-500
Chemical compound, drug	Sucrose	Fisher	Catalog# S3-500
Chemical compound, drug	Agar,Powder/Flakes	Fisher Scientific	Catalog# BP1423-500
Chemical compound, drug	L-amino acids	Sigma-Aldrich	Catalog# 200-157-7
Chemical compound, drug	Yeast Extract Hy-Yest 412	Kind gift from Dr. Lawrence Davis	N/A
Chemical compound, drug	HEPES	Fisher	Catalog# BP310-100
Chemical compound, drug	TEMED	Santa Cruz	Catalog# SC-29111
Chemical compound, drug	Ammonium Persulfate	Fisher	Catalog# BP179-100
Chemical compound, drug	HisPur Ni-NTA Magnetic Beads	Thermo Fisher	Catalog# 88831
Chemical compound, drug	Cyanogen bromide activated Sepharose 4B	Sigma-Aldrich	Catalog# 68987-32-6
Software, algorithm	Graphpad Prism 7.00	GraphPad Software	https://www.graphpad.com/
Software, algorithm	ImageJ	NIH	https://imagej.nih.gov/ij/
Software, algorithm	Adobe Photoshop	Adobe	N/A
Software, algorithm	Zen black	Zeiss	N/A
Other	Zeiss 700 confocal microscope	Zeiss	N/A

Table 1

Statistics Summary.

Panel	Graph type	N value	Statistical test used	Precision	p-value
Figure 2E,F	Bar graphs	Pool of 5 larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	Unpaired t-test	Mean +/- SD	p<0.05
Figure 3A	Volcano plot	Pool of 25 larvae per genotype (N = 6 biological replicates)	Univariate fold change and t-test analysis	N/A	FC > 1.5 p<0.05
Figure 3B	Box and whisker plot	Pool of 25 larvae per genotype (N = 6 biological replicates)	Unpaired t-test	Min to max	p<0.05
Figure 3G	Scatter plot	N ≥ 8	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001, p<0.01
Figure 3H	Bar graph	N = 4	Unpaired t-test	Mean +/- SD	p<0.05
Figure 3I	Mean and error plot	N = 4	Holm-Sidak t-test	Mean +/- SEM	p<0.05
Figure 3J	Box and whisker plot	N = 5	Unpaired t-test	Min to max	p<0.05
Figure 4D	Scatter plot	N ≥ 10	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001
Figure 4E	Bar graph	Pool of at least eight larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.005, p<0.01, n.s.
Figure 4F	Scatter plot	N ≥ 10	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001
Figure 4H	Box and whisker plot	N = 10	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001
Figure 4I,J	Bar graph	Pool of 5 larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001, p<0.005, p<0.05, p<0.01
Figure 5A	Box and whisker plot	Pools of 25 larvae (N = 6 biological replicates)	Unpaired t-test	Min to max	p<0.05
Figure 5F	Scatter plot	N ≥ 32	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.05, p<0.001, n.s.
Figure 5G	Column graph	Pool of 10 larvae per genotype subjected to each condition (N = 3)	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.05, p<0.001, n.s.
Figure 5I	Box and whisker plot	N ≥ 10	One-Way ANOVA Kruskal-Wallis test	Min to max	p<0.001
Figure 6G	Scatter plot	N ≥ 9	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001, n.s.
Figure 6H	Mean and error plot	N = 4	Holm-Sidak t-test	Mean +/- SEM	p<0.05
Figure 6I	Bar graph	Pool of at least 15 larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.005, p<0.01, n.s.
Figure 7D	Scatter plot	N = 15	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001, p<0.05, n.s.
Figure 7E	Bar graph	N = 20	Unpaired t-test	Mean	N/A
Figure 7G	Box and whisker plot	N = 6	One-Way ANOVA Kruskal-Wallis test	Min to max	p<0.05, n.s.
Figure 2—figure supplement 1C	Bar graph	Pool of 5 larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	Unpaired t-test	Mean +/- SD	p<0.05
Figure 2—figure supplement 1F,G	Bar graph	Pool of 5 larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	Unpaired t-test	Mean +/- SD	n.s.
Figure 3—figure supplement 1B	Box and whisker plot	N = 6 chambers with five larvae per genotype	Unpaired t-test	Min to max	p<0.05
Figure 3—figure supplement 1C	Bar graph	Pool of 25 larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	Unpaired t-test	Mean +/- SD	p<0.001
Figure 6—figure supplement 1D	Scatter plot	N ≥ 9	Unpaired t-test	Mean +/- SD	n.s.
Figure 6—figure supplement 1M	Scatter plot	N > 300 cells measured in 10 brains of each genotype	Unpaired t-test	Mean +/- SD	p<0.001
Figure 7—figure supplement 1C	Scatter plot	N ≥ 20	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.001, n.s.
Figure 7—figure supplement 1D	Mean and error plot	N = 10	Holm-Sidak t-test	Mean +/- SEM	n.s.
Figure 7—figure supplement 2E	Bar graph	N = 9	Unpaired t-test	Mean +/- SD	p<0.005
Figure 7—figure supplement 2H	Scatter plot	N = 8	Unpaired t-test	Mean +/- SD	n.s.
Figure 7—figure supplement 2J	Bar graph	Pool of at least 15 larvae per genotype (N = 3 biological replicates and N = 3 technical replicates)	One-Way ANOVA Kruskal-Wallis test	Mean +/- SD	p<0.05, n.s.