Figures and data in Dissecting transcriptional amplification by MYC

Figures
Tables
Additional files

8 figures, 1 table and 2 additional files

Figures

Figure 1 with 3 supplements

Download asset Open asset

MYC amplifies glucocorticoid receptor-primed gene expression.

(A) Cells were transfected with plasmids (top to bottom) expressing MYC-EGFP driven by the CMV-enhancer promoter, firefly luciferase (luc) driven by a glucocorticoid response element (GRE) from a Herpes thymidine kinase (TK) minimal promoter, and renilla luciferase (ren) driven by the basal thromboxane synthase promoter. (B) MYC-EGFP protein expression parallels the transfected amount of MYC-EGFP plasmid. Note that the linear fit of immunoreactive MYC vs. transfected plasmid indicates that negligible MYC is expressed below 13 ng of plasmid. The endogenous MYC is calculated to equal ≈2.5 ng of MYC plasmid. Therefore, zero total MYC is calculated (Chow and Simons, 2018) to be ≈10 ng of plasmid (=13–2.5). Top: Immunoblot of cells transfected with different amounts of *MYC-EGFP* plasmid. (**C and D**). Total Renilla or Luciferase activity with EtOH or high Dex concentrations (50 or 100 nM) in U2OS cells transiently transfected with 2 ng of GR plasmid, 100 ng GREtkLUC reporter, and the indicated amounts of MYC plasmid, without (C) or with (D) 50 µM F4 were determined as described in Materials and methods, averaged, and plotted ± SEM (n = 2 or 4). R² values for polynomial curve fits were all ≥0.96. Note that GR-induction using endogenous MYC is sensitive to F4 (red brackets on Y-axes of C and D).

Figure 1—figure supplement 1

Download asset Open asset

MYC acutely increases cellular RNA levels.

Comparison of RNA/cell in HO15.19-MYC-ER cells in the presence or absence of 4-OH tamoxifen (200 nM). The cells were grown in 0.1% of serum starvation for 5 days and then stimulated or not with 4-OH-tamoxifen. Error bars show the standard deviation. Comparing + vs. – tamoxifen, p-values for the progressive time points are 0.062, 0.029 and 0.022, respectively. Mean and SD are indicated for triplicates. Experiment performed twice.

Figure 1—figure supplement 2

Download asset Open asset

E-box-like sequences and base composition of transient and stable reporters.

(A) Disposition of perfect and 5/6-E-boxes within the reporter plasmids used in these studies. Perfect E-boxes are in boxes. Red-boxes enclose perfect E-boxes engineered into reporter promoters. Blue-boxes enclose the perfect E-boxes that occur within the LTR of the lentivirus vectors. Blue text indicates all sequences that match CACGTG at 5/6 bases. In 50% G-C, a 5/6 match is expected to occur randomly once every 228 bases. (B) G-C content of the reporter plasmids, sliding 50 bp window. Gal4UASs or GREs are just upstream of reporters as indicated.

Figure 1—figure supplement 3

Download asset Open asset

MYC amplification of steroid receptor activity.

(A) Effect of MYC is greater when genes are more actively expressed. Augmentation by MYC (10 or 80 ng) of maximal LUC induction from transfected GREtkLUC by the indicated amounts of transfected GR with EtOH or Dex (60 or 20 nM) in U2OS cells (Ave ± range, n = 2). (B) MYC augmentation of transactivation by progesterone receptor B (PR-B). In both B and C, the maximal LUC or Renilla induction by 1.5 ng PR-B and 1 nM R5020 from transfected GREtkLUC or Renilla-TS respectively in U2OS cells is augmented by the indicated amounts of transfected (B) MYC and (C) MbIII and MbI+III.The data are normalized to the value for 10 ng of each *MYC* plasmid, averaged and plotted ±range (n = 2).

Figure 2 with 1 supplement

Download asset Open asset

E-boxes assist but are not essential for MYC amplifier activity.

(A) Dex-inducible reporter plasmids without or with E-boxes (top and middle, respectively) were co-transfected with a basal and uninducible Renilla-expressing reporter (bottom). (B) Without Dex induction, MYC marginally influences reporter expression with or without E-boxes. (C). With Dex, E-boxes depressed and then augmented reporter expression at low and high levels of MYC, respectively. Graphs are averages of 4 paired experiments ± S.E.M. in U2OS cells transiently transfected with 2 ng of GR plasmid, 100 ng GREtkLUC reporter without or with an E-box. All data were normalized to the value for 10 ng *MYC* with Dex on GREtkLUC reporter before averaging (R² values for polynomial curve fits are ≥0.98).

Figure 2—figure supplement 1

Download asset Open asset

MYC operates most effectively when bound within a couple of hundred bases of a transcription start site (Nie et al., 2012).

If the net action of MYC at a gene reflects its overall avidity for the given promoter, then an E-box will augment MYC activity by ~1.5 x, as shown in Figure 2.

Figure 3

Download asset Open asset

Cooperation between Myc Boxes (MBs) is required for amplifier activity.

(A) Summary of mutations introduced into the MBs of transfected *MYC*. B-H. Effect of various mutations in MBs, individually or in combination, on MYC amplifier activity. Total Renilla or Luciferase activity with EtOH or high Dex concentrations (50 or 100 nM) in U2OS cells, transiently transfected with 2 ng of GR plasmid, 100 ng GREtkLUC reporter, and the indicated amounts of MYC plasmid, were determined as described in Materials and methods, normalized to that for 10 ng plasmid, averaged, and plotted ± SEM (n = 2, 3, or 4) for B) wild-type, (C) MBI mutation, (D) MBII mutation, (E) MBIII mutation, (F) MBIV mutation, (G) MBI+III mutation, and H) MBI+IV mutation. R² values for polynomial fits of Dex/Luc curves were all ≥0.96 except for E and F, which were fit to smooth curves. (I). MYC protein levels (immunoblot) of transfected wild-type (WT) and mutant plasmids. (J) Inverse relationship between MYC protein level and amplifier activity for wild-type and mutant proteins. Data are averages ± S.E.M. from 2 to 5 experiments (n = 9 for wt MYC).

Figure 4

Download asset Open asset

MYC-Box mutations change both non-E and E-box promoter-output at the RNA level.

(**A and B**) Cells were transfected as noted with 80 ng of empty vector, MYC, MBII or MBIII expressing vectors, 100 ng of non-E-box or E-box reporter and 2 ng of GR plasmids . Luciferase and renilla luciferase were assayed. (C). Transfected cells as in B were harvested and RNA extracted for RT-qPCR using Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Experiments were performed in biological triplicate. Standard deviations are indicated. *,** and *** indicate p≤0.05, 0.01, 0.001, respectively, one-tailed t-test. Experiments performed in triplicate (A and B, n = 3; C, n = 1).

Figure 5

Download asset Open asset

MYC amplifies synthetic transcription factor GAL4/VP16 output.

(A) Cells were co-transfected with varying amounts of plasmids expressing the GAL4/VP16 chimeric protein that includes the DNA binding domain of GAL4 and the transactivation domain of VP16, as well as Gal4UAS-luc and *tsRen*. (B) GAL4/VP16 transactivation of Gal4UAS-luc (10 ng) saturates at ≈2 ng of transfected *GAL4/VP16*. Renilla TS was present at 10 ng. Activity is relative to 10 ng *GAL4/VP16*. Data points are averages of triplicate determinations ± SD of one experiment. (C) MYC amplifies GAL4/VP16 output. (D) Mutation of MBIII unrestrains the gain of MYC amplification of GAL4/VP16. (E). Unrestrained amplification of GAL4/VP16 activation by MBIII-mutant MYC requires intact MBI. In C-D, total amount of *MYC* vector was kept constant by addition of decreasing amounts of pd4EGFP plasmid. Data were normalized to that for 30 ng (C), 20 ng (D), or 10 ng (E) of *MYC* construct plasmid, each with 10 ng each of GAL4/VP16 and of GAL4UAS-luc plasmid, averaged, and plotted ±range (n = 2).

Figure 6

Download asset Open asset

MYC amplifies the expression of chromosomally-integrated integrated reporters.

(A) Lentiviruses encoding a fluorescent reporter driven by a TATA-box and a single Gal4UAS (top) or a single Gal4UAS and an E-box (middle) were inserted into cells bearing a doxycycline-inducible MYC-EGFP (bottom). Expression was monitored microscopically in single-cells. (B) Expression without an E-box requires both Gal4/VP16 and induced-MYC-EGFP. (C) E-boxes supplement but are not essential for MYC amplification. (D). MYC-amplification is resilient to single MB mutation. Lentivirus-expressed WT or MB-mutant MYC-EGFP induced by doxycycline were and transfected GAL4/VP16 were used to activate mCherry driven by a GAL4UAS and a single E-box. Error bars along the graphed lines indicate SEM and the shaded areas indicate the SD. (E) Western blot of uninduced and doxycycline-induced WT and MB-mutant MYC-EGFP relative to the endogenous MYC. Representative experiments are shown. For all experiments n ≥ 3.

Figure 7

Download asset Open asset

MYC-EGFP binding at chromosomally integrated-reporters parallels activity and emulates native promoters.

Top: diagram of integrated-lentivirus CFP reporters. (A) Left-ChIP-PCR to assay MYC-EGFP binding in the absence of activator of uninduced (lanes 2 and 6) versus doxycycline-induced (lanes 4 and 8) MYC-EGFP, at non-E-box (lanes 2 and 4) versus E-box-bearing (lanes 6 and 8) lentivirus-integrated reporter promoters. Right-ChIP-PCR to assay MYC-EGFP binding in the presence of GAL4/VP16 of uninduced (lanes 10 and 14) versus doxycycline-induced (lanes 12 and 16) MYC-EGFP at non-E-box (lanes 10 and 12) versus E-box bearing (lanes 14 and 16) lentivirus integrated reporter-promoters. (B) *EZH2* RNA levels from cells expressing non-induced or doxycycline induced MYC-EGFP(WT) or MYC-EGFP-mutants MBI, MBII, MBIII or MBIV and assayed by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (New England Biolabs). (C) Binding of uninduced and induced MYC-EGFP to endogenous promoters. The asterisk (*) indicates that binding to *BEX* in heterochromatin was so low as to be virtually unexpressed as previously reported (Nie et al., 2012). (D). Uninduced or doxycycline-induced MYC-EGFP(WT) or MYC-EGFP-mutants (MBI, MBII, MBIII, or MBIV) binding to the native EZH2 promoter assayed by ChIP-PCR. The mean and SD for representative experiments performed in triplicate are shown, n ≥ 2.

Figure 8 with 1 supplement

Download asset Open asset

Competition assays reveal site of MYC action in the transcription-cycle in relation to other factors.

(**A – C**) Competition of MYC vs 10058-F4. Double reciprocal plots (averaged) showing A_max (A), A_max/EC₅₀ (B), and 1/EC₅₀ (C) of MYC with varying inhibitor 10058-F4 from competition assays (as described in Materials and methods) in U2OS cells with *MYC* and co-transfected F4, GR, and GREtkLUC. Data from each experiment (n = 4) were normalized to the value for the lowest amounts of *MYC* and 10058-F4 and the averages (± SEM) were plotted. (**D–F**) Competition of MYC vs sSMRT. Double reciprocal (averaged) plots of A_max (D), A_max/EC₅₀ (E), and 1/EC₅₀ (F) with varying *sSMRT* were made for the competition assays, as in A-C, of *MYC* and decelerator *sSMRT* along with co-transfected GR and GREtkLUC. Data from each experiment (n = 5) were normalized to the value for the lowest amount of *MYC* and *sSMRT* and the averages (± SEM) were plotted. It should be noted that these plots require that the amounts transfected plasmid shown on the X-axis must correspond to the total amount of protein (endogenous plus exogenous) or added chemical. As shown in Figures 1B, 10 ng of MYC cDNA corresponds to zero total MYC protein. Therefore, the X-axis origin corresponds to 0 MYC protein, which equals 10 ng MYC cDNA. The data of the competition experiments of MYC vs 10058-F4 of Fig. 8A-C were expressed as EC₅₀/A_max, averaged, and plotted as averaged ± SEM (n = 4). The R² for the curve fits are all > 0.99. (G) Cartoon of sites and modes of action of MYC and 10058-F4 (F4). Starting with the Dex-bound GR (GRS), the induction of LUC protein (P) proceeds through numerous, undefined steps (arrows and ". . .”) both before and after the CLS. After the CLS, each step can either proceed to protein or involve another regulatory cofactor before ending in the production of protein. The top panel depicts F4 acting as a competitive decelerator at two steps before or at the CLS while MYC acts as an accelerator at two steps after the CLS. The bottom panel is for MYC acting at two sites as an activator of GRE as it enters the CLS with F4 inhibiting MYC at two sites.

Figure 8—figure supplement 1

Download asset Open asset

Competition assays reveal site of MYC action in the transcription cycle in relation to other factors.

The data of the competition experiments of MYC vs 10058-F4 of Figure 8A–C were expressed as EC₅₀/A_max, averaged, and plotted as averag ± SEM (n = 4). The R² for the curve fits are all >0.99.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Homo sapiens)	c-Myc	GeneBank
strain, strain background (Escherichia coli)	DH5a	NEB	Catalog #C2987I	High efficiency competent cells
strain, strain background (Escherichia coli)	XL-10-Gold	Agilent	Catalog #200314	Ultracompetent Cells
genetic reagent (include species here)
cell line (Homo sapiens)	U-2 OS	ATCC	ATCC HTB-96	Lack glucorticoid response
cell line (Homo sapiens)	Lentivirus-expressed MYC, mCherry-reporter double-stable cell lines in U-2OS	This paper	bone osteosarcoma	Cells maintained in D.Levens lab
cell line (Rattus norvegicus (Rat))	Myc-ER HO15.19	RRID:CVCL_0311 O'Connell et al., 2003
transfected construct	Palmitoyl-turquoise2	gift from Dorus Gadella;	Addgene plasmid # 36209	http://n2t.net/addgene Goedhart et al., 2012
transfected construct	Pd4EGFP-c-Myc and Myc mutants	This Paper
transfected construct	PTripZ-EGFP-cMyc and mutant	This paper
transfected construct	PLVX-PKG-GAL4USA-(Ebox)-E1bTATA-mcherry-hygro (Plasmid)	This Paper
biological sample (include species here)
antibody	anti-cMyc (rabbit monoclonal)	Abcam	Catalog #ab-32072	1:5000
antibody	anti-GFP rabbit polyclonal	Abcam	Catalog #ab-32146	1:1000
antibody	anti-GAPDH	Abcam	Catalog #ab-9485	1:2500
recombinant DNA reagent	Pd4EGFP	This paper
recombinant DNA reagent	PTripZ-EGFP	This paper
recombinant DNA reagent	pLVX-mCherry-N1	Takara	Catalog #632562
sequence-based reagent	PKG-F	This Paper	CR primer	GTGAGCGGCCGCGACTCTGAGTAATTCTACCGGGTAGG
sequence-based reagent	PKG-R	This Paper	PCR primer	GTGAGCGGCCGCGACTCTGAGTAATTCTACCGGGTAGG
sequence-based reagent	Hygro1-F	This Paper	PCR primer	GCCCAAGCTTACCATGAAAAAGCCTGAACTCACC
sequence-based reagent	Hygro1-R	This Paper	PCR primer	TGTTGGAGCCGAAATCCGCGTGCA
sequence-based reagent	Hygro2-F	This Paper	PCR primer	GGATTTCGGCTCCAACAATGTCCTGACGGACAATG
sequence-based reagent	Hygro2-R	This Paper	PCR primer	GGATTTCGGCTCCAACAATGTCCTGACGGACAATG
peptide, recombinant protein
commercial assay or kit	Direct-zol RNA miniprep kit	Zymo Research	Catalog #R2051
commercial assay or kit	Luna Cell Ready One-Step RT-qPCR Kit	NEB	Catalog #E3031, #E3005, #E3006
commercial assay or kit	Lipofectamine 2000,3000 transfection kit	Thermo-Fish (Invitrogen)	Catalog #L2000, L3000-008
commercial assay or kit	Lenti-X Accelerator kit	Takara	Catalog #631257
commercial assay or kit	Lenti-X Packaging Single Shot kit	Takara	Catalog #631275
commercial assay or kit	the ChIP-IT High Sensitivity kit	Active Motif	Catalog #53040
chemical compound, drug	Dexamethasone (Dex)	Sigma
chemical compound, drug	Promegestone	PerkinElmer Life Sciences	R5020
chemical compound, drug	10058-F	Sigma	Catalog #F3680
chemical compound, drug	4-OH tamoxifen	Sigma-Aldrich	Catalog #94873
chemical compound, drug	All the restriction enzymes and DNA polymerase	NEB
software, algorithm	KaleidaGraph	Synergy Software, Reading, PA
software, algorithm	NIS-Element	Nikon
software, algorithm	MATLAB	Mathworks
software, algorithm	LightCycler 480 Probes master	Roche-applied Science	ref number 04707494001
other