A fully automated high-throughput workflow for 3D-based chemical screening in human midbrain organoids
- Department for Cell and Developmental Biology, Max Planck Institute for molecular Biomedicine, Germany
- Westfälische Wilhelms-Universität Münster, Germany
- Max Planck Research Group for RNA Biology, Max Planck Institute for molecular Biomedicine, Germany
- Research Group for RNA Biochemistry, Department of Chemistry and Biochemistry, University of Bern, Switzerland
- Department of Cardiovascular Medicine, Institute for Genetics of Heart Diseases, University Hospital Münster, Germany
- Electron Microscopy Unit, Max Planck Institute for molecular Biomedicine, Germany
- Cellular Biophysics Group, Institute for Medical Physics and Biophysics, Westfälische Wilhelms-Universität Münster, Germany
Figures
Figure 1 with 1 supplement
Automation enables high-throughput-compatible production and analysis of homogenous midbrain organoids.
(a) Schematic overview of the automated HTS workflow including organoid generation and optical analysis. (b) Measurement of AMO size (area of the largest cross section) reveals low variation and …
Figure 1—figure supplement 1
Benzyl alcohol and benzyl benzoate (BABB) tissue clearing of organoids is significantly more effective than other protocols.
(a) BABB clearing enables the detection of fluorescent signals like DAPI by confocal microscopy approximately three times deeper in organoids than other clearing protocols. (Error bars = SEM, n = 10 …
Figure 2 with 3 supplements
Automated midbrain organoids express typical neural and midbrain markers and show signs of structural organization.
(a) Expression of the dopaminergic midbrain marker TH as well as the precursor markers nestin and Sox2 is evenly distributed throughout the entire aggregate at day 25, as shown by single confocal …
Figure 2—figure supplement 1
Automated midbrain organoids express synaptic and midbrain markers.
Single optical confocal slices of whole mount stained and cleared AMOs. (a/b) AMOs highly express the synaptic protein Synapsin frequently colocalizing with the neural marker Map2 (day 75). Shown in …
Figure 2—figure supplement 2
Characterization of AMOs generated from a second, independent patient iPSC-derived smNPC line.
(a-i) AMOs derived from a second smNPC line (AMO line 2) express the same neural precursor, neuron/synaptic, and midbrain markers as AMO line 1 (compare to Figure 2 and Figure 2—figure supplement 1).…
Figure 2—figure supplement 3
Electron microscopy displays ultrastructural morphology of neuronal phenotypes.
(a/b) Ultrastructural analysis of AMOs reveals a dense lattice of neuronal cells. The neuronal cell bodies are frequently surrounded by cellular projections commensurate with nerve fibers. (c) …
Figure 3 with 1 supplement
Quantitative real-time PCR shows maturation of automated midbrain organoids over time.
Changes in gene expression during the development of AMOs shown by qPCR. AMO's continuing maturation is indicated by the increase of neural maturation (MAP2, NeuN, NEFL, TUBB3, TBR2, DCX, Syt1), …
Figure 3—figure supplement 1
Comparative quantitative real-time PCR analysis between AMOs from two different cell lines and hiPSC organoids confirms correct differentiation toward their respective fates.
Changes in gene expression during the development of AMOs and hiPSCs shown by qPCR. Their continuing maturation is indicated by the increase of neural maturation (MAP2, NeuN, NEFL, TUBB3, TBR2, DCX, …
Figure 4 with 1 supplement
Calcium imaging reveals spontaneous and synchronized activity throughout entire organoids.
(a) AMOs show spontaneous, aggregate-wide spikes of calcium activity. (b) Division of the optical cross-section into quadrants shows that this calcium activity is occurring synchronously throughout …
Figure 4—figure supplement 1
AMOs display typical neuron-like electrical activity as early as day 25.
(a) Representative recordings of transmembrane currents elicited by stepping the membrane potential from −70 to +60 mV in 10 mV increments (the schematic of stimulation is in the left panel above). S…
Figure 5 with 1 supplement
RNA sequencing supports differentiation toward a human midbrain-like fate and homogeneous, predictable gene expression of automated midbrain organoids.
(a/b) The global gene expression of AMOs correlates with that of fetal human brain and spinal cord tissue (a) as well as published midbrain organoids, 2D dopaminergic (DA) neurons, and prenatal …
Figure 5—figure supplement 1
RNA sequencing reveals less intra- and inter-batch variability in AMOs compared to established cerebral organoids.
(a) AMOs from three independently cultured batches cluster more closely together than iPSC-derived cerebral organoids from one batch derived according to the protocol by Lancaster et al., 2013 in a …
Figure 6 with 1 supplement
Automated whole mount immunostaining is quantitative and reveals high homogeneity of automated midbrain organoids.
(a) The optical analysis workflow allows quantification of cell numbers in 3D aggregates. The correlation between the number of fluorescent cells in an aggregate and its brightness measured with our …
Figure 6—figure supplement 1
High-content imaging analysis reveals edge effects for Map2 but not Sox2.
AMOs on the edge of the plate (column 1 and 12 in a) and row A and H in (b) contain approximately 10% more Map2 (by brightness) than the ones more toward the inside of the plate. For Sox2, there is …
Figure 7 with 2 supplements
smNPC-derived AMOs are morphologically, structurally, and functionally more homogeneous than automated hiPSC-derived organoids.
(a/b) Light microscopy images of hiPSC-derived organoids (a) and AMOs (b) generated from the same cell line demonstrating the higher morphological homogeneity of AMOs at day 30 of differentiation.(c/…
Figure 7—figure supplement 1
Overview of the protocol for the automated generation of hiPSC-based organoids and modifications from the published original.
Schematic overview of the automated HTS workflow for the generation and maintenance of the automated hiPSC-organoids. The right half of the Figure details the modifications made from the original …
Figure 7—figure supplement 2
The expression of typical neural and cortical markers confirms the correct differentiation of automated hiPSC-derived organoids.
(a/b) Single optical confocal slices of whole mount stained and tissue-cleared organoids showing the expression of the early cortical neuron marker CTIP2, precursor marker Pax6, and general neuronal …
Figure 8 with 1 supplement
Automated midbrain organoids possess functional characteristics of midbrain tissue and allow assessment of neural subpopulations for high-throughput screening.
(a/b) The combination of AMOs and our automated whole mount staining and clearing workflow allows the quantification of dopaminergic neuron-specific toxicity in 3D. 6-Hydroxy dopamine and MPP+ …
Figure 8—figure supplement 1
AMOs allow HTS-compatible toxicity evaluation in whole organoids or specific cellular subpopulations.
(a) Higher toxin concentrations resulted in increased cCasp3+ apoptotic signal in AMOs. Panel shows representative single plane confocal micrographs from our high-content analysis pipeline after …
Videos
Video 1
The combination of whole mount staining and clearing allows confocal imaging of 3D cellular architecture at single-cell resolution.
3D rendering of a confocal stack showing the 3D organization of neural precursors (Sox2, green) and mature neurons (Map2, red) within AMOs. The video shows a cube-shaped volume with edge length of …
Video 2
Automated midbrain organoids display spontaneous and aggregate-wide synchronized calcium activity.
Single plane spinning disc confocal time lapse series showing fluctuations in Fluo-4 AM fluorescence of a near-surface tangential optical slice. Images were acquired at 10 Hz for a total of 4 min. …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | AMO line 1 | Reinhardt et al., 2013b | PMID:23533608 | smNPCs used for the derivation of AMOs designated ‘AMO line 1’ |
| Cell line (Homo sapiens) | AMO line 2 | Reinhardt et al., 2013a | PMID:23533608 | smNPCs used for the derivation of AMOs designated ‘AMO line 2’ |
| Cell line (Homo sapiens) | hIPSCs | Reinhardt et al., 2013a | PMID:23472874; PMID:23533608 | hIPSCs giving rise to hIPSC organoids in this paper; cell line of origin to generate smNPCs for AMO line 2 |
| Antibody | Anti-Brn2 (Rabbit monoclonal) | Cell Signaling | Cat#:12137 | (1:2000) |
| Antibody | Anti-Cleaved Caspase-3 (Rabbit monoclonal) | Cell Signaling | Cat#:9664 | (1:100) |
| Antibody | Anti-Ctip2 (Rat monoclonal) | Abcam | Cat#:ab18465 | (1:750) |
| Antibody | Anti-DCX (Goat polyclonal) | Santa Cruz | Cat#:sc-8066 | (1:500) |
| Antibody | Anti-FoxA2 (Mouse monoclonal) | Santa Cruz | Cat#:sc-101060 | (1:100) |
| Antibody | Anti-FoxG1 (Rabbit polyclonal) | Abcam | Cat#:ab18259 | (1:500) |
| Antibody | Anti-GFAP (Chicken polyclonal) | Merck Millipore | Cat#:AB5541 | (1:500) |
| Antibody | Anti-Lmx1a (Rabbit polyclonal) | Abcam | Cat#:ab139726 | (1:100) |
| Antibody | Anti-Homer (Mouse monoclonal) | Synaptic Systems | Cat#:160 011 | (1:250) |
| Antibody | Anti-Map2 (Chicken polyclonal) | Abcam | Cat#:ab5392 | (1:500) |
| Antibody | Anti-Map2 (Mouse monoclonal) | Merck Millipore | Cat#:MAB3418 | (1:1000) |
| Antibody | Anti-Map2 (Rabbit polyclonal) | Abcam | Cat#:ab32454 | (1:500) |
| Antibody | Anti-Nestin (Mouse monoclonal) | Life Technologies | Cat#:MA1-110 | (1:250) |
| Antibody | Anti-Nurr1 (Mouse monoclonal) | Santa Cruz | Cat#:sc-376984 | (1:100) |
| Antibody | Anti-Pax6 (Rabbit polyclonal) | BioLegend | Cat#:901301 | (1:500) |
| Antibody | Anti-Pitx3 (Rabbit polyclonal) | Merck Millipore | Cat#:AB5722 | (1:100) |
| Antibody | Anti-S100b (Rabbit polyclonal) | Dako | Cat#:Z031129-2 | (1:500) |
| Antibody | Anti-Satb2 (Mouse monoclonal) | Abcam | Cat#:ab51502 | (1:500) |
| Antibody | Anti-Sox2 (Goat polyclonal) | R and D Systems | Cat#:AF2018 | (1:200) |
| Antibody | Anti-Synapsin1 (Mouse monoclonal) | Synaptic Systems | Cat#:106 001 | (1:1000) |
| Atibody | Anti-Synaptophysin1 (Rabbit polyclonal) | Synaptic Systems | Cat#:101 002 | (1:200) |
| Antibody | Anti-Tbr1 (Rabbit polyclonal) | Abcam | Cat#:ab31940 | (1:500) |
| Antibody | Anti-Tbr2 (Chicken polyclonal) | Merck Millipore | Cat#:AB15894 | (1:500) |
| Antibody | Anti-TUBB3 (Mouse monoclonal) | BioLegend | Cat#:801202 | (1:500) |
| Antibody | Anti-TH (Chicken polyclonal) | Abcam | Cat#:ab76442 | (1:1000) |
| Antibody | Anti-TH (Rabbit polyclonal) | Abcam | Cat#:ab112 | (1:500) |
| Antibody | Anti-vGAT (Mouse monoclonal) | Synaptic Systems | Cat#:131 011 | (1:100) |
| Antibody | Anti-vGLUT1 (Rabbit polyclonal) | Synaptic Systems | Cat#:135 303 | (1:100) |
| Sequence-based reagent | AADC_F | This paper | PCR primers | TGCGAGCAGAGAGGGAGTAG |
| Sequence-based reagent | AADC_R | This paper | PCR primers | TGAGTTCCATGAAGGCAGGATG |
| Sequence-based reagent | Brn2_F | This paper | PCR primers | CGGCGGATCAAACTGGGATTT |
| Sequence-based reagent | Brn2_R | This paper | PCR primers | TTGCGCTGCGATCTTGTCTAT |
| Sequence-based reagent | DCX_F | This paper | PCR primers | AGGGCTTTCTTGGGTCAGAGG |
| Sequence-based reagent | DCX_R | This paper | PCR primers | GCTGCGAATCTTCAGCACTCA |
| Sequence-based reagent | EN1_F | This paper | PCR primers | CCCTGGTTTCTCTGGGACTT |
| Sequence-based reagent | EN1_R | This paper | PCR primers | GCAGTCTGTGGGGTCGTATT |
| Sequence-based reagent | GAPDH_F | This paper | PCR primers | CTGGTAAAGTGGATATTGTTGCCAT |
| Sequence-based reagent | GAPDH_R | This paper | PCR primers | TGGAATCATATTGGAACATGTAAACC |
| Commercial assay or kit | Biomark 48.48integrated fluidic circuit Delta Gene assay | Fluidigm | Cat#:101–0348 | Complete bundle for 10 assays |
| Commercial assay or kit | CellTiter-Glo 3D Cell Viability Assay | Promega | Cat#:G9682 | |
| Commercial assay or kit | Dopamine ELISA Kit | Abnova | Cat#:KA3838 | |
| Commercial assay or kit | CellTracker deep red dye | Life Technologies | Cat#:C34565 | |
| Commercial assay or kit | Fluo-4 AM | Thermo Fisher | Cat#:F14201 | |
| Chemical compound, drug | Cobalt(II) chloride | Sigma-Aldrich | Cat#:232696 | |
| Chemical compound, drug | G418 | Sigma-Aldrich | Cat#:G8168 | |
| Chemical compound, drug | 6-Hydroxydopamine hydrochloride (6OHD) | Sigma-Aldrich | Cat#:H4381 | |
| Chemical compound, drug | 1-Methyl-4-phenylpyridinium iodide (MPP+) | Sigma-Aldrich | Cat#:D048 | |
| Chemical compound, drug | Dopamine hydrochloride | Sigma-Aldrich | Cat#:H8502 | |
| Chemical compound, drug | Risperidone | Sigma-Aldrich | Cat#:R3030 | |
| Chemical compound, drug | GABA | Sigma-Aldrich | Cat#:A2129 | |
| Chemical compound, drug | Bicuculline | Sigma-Aldrich | Cat#:14340 | |
| Chemical compound, drug | Glutamate | Sigma-Aldrich | Cat#:49621 | |
| Chemical compound, drug | Glycine | Sigma-Aldrich | Cat#:50046 | |
| Chemical compound, drug | Ketamine | Sigma-Aldrich | Cat#:K2753 | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | PMID:22743772 | |
| Software, algorithm | GraphPad Prism | Graphpad Software Inc | RRID:SCR_002798 | |
| Software, algorithm | Harmony | Perkin Elmer | Version:‘4.1, Revision 128972’ | |
| Software, algorithm | Columbus | Perkin Elmer | Version:2.6.0.127073 |
Additional files
-
Supplementary file 1
Source data for the calculation of sample retention efficiency shown in Figure 1d.
- https://cdn.elifesciences.org/articles/52904/elife-52904-supp1-v1.docx
-
Supplementary file 2
Complete List of gene ontology (GO) terms for genes significantly (p<0.001) upregulated (log2 fold change >2) in AMOs compared to published midbrain organoids (Jo et al., 2016).
- https://cdn.elifesciences.org/articles/52904/elife-52904-supp2-v1.docx
-
Supplementary file 3
List of primary antibodies in this study.
- https://cdn.elifesciences.org/articles/52904/elife-52904-supp3-v1.docx
-
Supplementary file 4
List of quantitative real-time PCR primers in this study.
- https://cdn.elifesciences.org/articles/52904/elife-52904-supp4-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/52904/elife-52904-transrepform-v1.docx
