Defining the role of pulmonary endothelial cell heterogeneity in the response to acute lung injury
- Department of Medicine, University of Pennsylvania, United States
- Department of Cell and Developmental Biology, University of Pennsylvania, United States
- Penn-Children's Hospital of Philadelphia Lung Biology Institute, University of Pennsylvania, United States
- Penn Cardiovascular Institute, University of Pennsylvania, United States
- Penn Institute for Regenerative Medicine, University of Pennsylvania, United States
Figures
Figure 1 with 3 supplements
scRNA-seq analysis reveals heterogeneity of ECs in the adult mouse lung and identifies a distinct cell population high in Car4 and Cd34 expression.
(A) Experimental strategy for identifying heterogeneity in adult mouse pulmonary endothelium. A representative FACS plot demonstrates gating used to isolate CD31+/CD45- cells from adult mouse lung. …
Figure 1—figure supplement 1
Isolation of CD45-/CD31+ cells results in capture of some mesenchymal and epithelial cells.
Identification of the top three differentially expressed genes in (A) cluster five and (B) cluster six by average log2 fold change in gene expression indicates that these clusters are likely …
Figure 1—figure supplement 2
Distinct contributions of individual mice to the integrated EC-specific scRNA-seq dataset.
UMAP dimension reduction plots for scRNA-seq datasets generated from each individual C57BL/6J mouse analyzed (A–C) and the overlay demonstrating the contribution of each individual to the integrated …
Figure 1—figure supplement 3
Isolation and qRT-PCR analysis of CD34-high ECs confirms their transcriptional distinction from other ECs.
(A) Gating strategy for isolating Car4-high (CD34-high) ECs, other CD34-low ECs, and non-ECs (CD45-/CD31- cells) by FACS. After isolation of each cell population, RNA extraction and subsequent …
-
Figure 1—figure supplement 3—source data 1
Relative expression of endothelial cell genes in lung cell subpopulations isolated by FACS.
- https://cdn.elifesciences.org/articles/53072/elife-53072-fig1-figsupp3-data1-v2.xlsx
Figure 2
Gene ontology and localization of EC subtypes elucidates known functions and confirms divergence of clusters 2 and 4.
(A) Circos plot shows gene expression and gene ontology (GO) overlap between distinct clusters of pulmonary ECs. A purple line connecting two clusters indicates expression of the same gene in both …
Figure 3 with 4 supplements
CD34-expressing ECs respond robustly to H1N1 influenza injury.
In comparison to (A) normal adult mouse lung, (B) influenza-injured lungs demonstrate heterogeneous, regional alveolar damage, including regions of mild (zone 1/2) (B’) and severe (zone 3) (B’’) …
Figure 3—figure supplement 1
Response of CD34-expressing cells to bleomycin injury is comparable to their response to influenza injury.
H and E stained sections of adult mouse lung, either untreated (A) or treated with 2 U/kg bleomycin via intratracheal (IT) administration and examined 7 days post injury (dpi) (B) or 14 dpi (C). …
Figure 3—figure supplement 2
Car4-expressing ECs are increased in regions of mild to severe injury during the response to H1N1 influenza infection in the lung.
(A–A’’’) At homeostasis, Car4-expressing ECs (Car4+/Pecam1+, outlined in blue) are distributed throughout the alveolar space, but are not present in large vessels (orange dotted line). Many Pecam1+ …
-
Figure 3—figure supplement 2—source data 1
Cell counts for total number of Car4-expressing, Pecam1-expressing cells, normalized to total number of nuclei.
- https://cdn.elifesciences.org/articles/53072/elife-53072-fig3-figsupp2-data1-v2.xlsx
Figure 3—figure supplement 3
Localization of Car4-high ECs and other ECs with alveolar type 1 and type two epithelial cells.
(A, A’) RNAscope for Hopx demonstrates that Car4-high ECs (Car4+/Pecam1+) can be found adjacent to Hopx+ alveolar type 1 (AT1) cells in the distal lung (inset in A); yellow circles in A’). Other …
-
Figure 3—figure supplement 3—source data 1
Percentage of Car4-high EC within 3 microns of Hopx-expressing AT1 cells or Sftpc-expressing AT2 cells.
- https://cdn.elifesciences.org/articles/53072/elife-53072-fig3-figsupp3-data1-v2.xlsx
Figure 3—figure supplement 4
Pulmonary miECs and maECs do not change localization during response to H1N1 influenza infection.
(A) RNAscope for Gpihbp1 indicates that miECs, which also express Pecam1 and Plvap (blue outlines), are located throughout the alveolar space. Gpihbp1-expressing cells are not found within large …
Figure 4 with 6 supplements
scRNA-seq analysis of whole lungs reveals the appearance of a proliferating EC population in the adult mouse lung after influenza injury.
Representative FACS plots demonstrate gating used to isolate CD45- cells from (A) control and (B) influenza-infected adult mouse lungs and indicate an increase in CD45+ cells after influenza …
Figure 4—figure supplement 1
Epithelial cell clusters in control and influenza-infected adult mouse lung.
Clustering and UMAP dimension reduction of scRNA-seq data from (A) control and (B) H1N1-injured lung highlighting common epithelial cell clusters. (C), (D) Violin plots show expression of …
Figure 4—figure supplement 2
Mesenchymal cell clusters in control and influenza-infected adult mouse lung.
Clustering and UMAP dimension reduction of scRNA-seq data from (A) control and (B) H1N1-injured lung highlighting mesenchymal cell clusters. (C), (D) Violin plots show expression of representative …
Figure 4—figure supplement 3
Gene expression of representative genes for each cluster across all clusters.
Dot plots demonstrate relative gene expression level in (A) control and (B) H1N1-injured lung. Gray indicates low expression and dark purple indicates high expression. Circle size indicates the …
Figure 4—figure supplement 4
Proliferating ECs express general EC marker genes, but do not express genes that are highly expressed in Car4-high ECs.
(A) UMAP dimension reduction of H1N1 injury scRNA-seq dataset, with red box enclosing EC clusters and representing areas of increased digital zoom displayed in (B)-(I). Black circle demarcates …
Figure 4—figure supplement 5
An integrated scRNA-seq dataset reveals concordance between cell types identified in individual control and H1N1 injury datasets.
(A) Aggregation of control (N = 1) and influenza (N = 2) scRNA-seq datasets results in an integrated dataset composed of similar clusters to those identified in individual datasets. (B) Overlay of …
Figure 4—figure supplement 6
Analysis of transcriptional changes within EC clusters after H1N1 influenza injury.
(A) Violin plots show change in expression of 12 of the top significantly differentially expressed genes in Car4-high ECs between control and H1N1 influenza scRNA-seq datasets. Genes with …
Figure 5 with 6 supplements
Proliferation of lung ECs increases dramatically during the regenerative response to H1N1 influenza infection.
(A) Outline of the experimental strategy used to assess EC proliferation. Mice given intranasal H1N1 or PBS (control) were given EdU ad libitum in their drinking water (0.2 g/L) either from days 0–7 …
Figure 5—figure supplement 1
Assessment of proliferation by IHC for phospho-histone H3 reveals no differences between EdU-treated and EdU-untreated mice.
(A–C) Representative images of (A) a proliferating non-endothelial cell (white dotted line, pHH3+/Car4-/Pecam1-), (B) a proliferating Car4-high EC (white dotted line, pHH3+/Car4+/Pecam1+), and (C) a …
-
Figure 5—figure supplement 1—source data 1
Cell counts for total number of proliferating cells, normalized to total number of nuclei.
- https://cdn.elifesciences.org/articles/53072/elife-53072-fig5-figsupp1-data1-v2.xlsx
Figure 5—figure supplement 2
ECs proliferate very little in uninjured mice.
(A) 14 days after intranasal PBS, a single-cell suspension isolated from the lungs of a representative mouse given EdU from days 7–14 had 73.9% CD45-negative non-immune cells, (B) of which 40.8% …
Figure 5—figure supplement 3
Proliferation in CD34-low ECs increases in the first seven days following H1N1 injury.
(A) 7 days after intranasal H1N1 administration, a single-cell suspension isolated from the lungs of a representative mouse given EdU from days 0–7 following injury had 21.3% CD45-negative …
Figure 5—figure supplement 4
Endothelial proliferation continues to increase from 14 to 21 days following H1N1 injury.
(A) At 21 days post-H1N1 injury, single cells isolated from the lungs of a representative mouse given EdU from days 14–21 were 32.8% CD45-negative non-immune cells, indicating that immune response …
Figure 5—figure supplement 5
Proliferating ECs are located across regions of mild to severe injury after H1N1 influenza infection.
(A) Proliferating ECs (Top2a+/Pecam1+/Prc1+ triple-positive cells) are rare in the control lung. Orange dotted line indicates a large vessel. (B) 14 days post-H1N1 injury, proliferating Top2a+/Pecam1…
-
Figure 5—figure supplement 5—source data 1
Cell counts for total number of Top2a- and Prc1-expressing endothelial cells and non-endothelial cells, normalized to total number of nuclei.
- https://cdn.elifesciences.org/articles/53072/elife-53072-fig5-figsupp5-data1-v2.xlsx
Figure 5—figure supplement 6
Expression of cell cycle genes in scRNA-seq transcriptomes predicts high levels of proliferation in pulmonary ECs after influenza injury.
Cell cycle scores in scRNA-seq of (A) control and (B) influenza-infected adult lung indicate that there is a high concentration of ECs expressing genes associated with S (green dots) and G2/M …
-
Figure 5—figure supplement 6—source data 1
Percentage of cells predicted to be in G1, G2/M, or S phases based on their gene expression profiles.
- https://cdn.elifesciences.org/articles/53072/elife-53072-fig5-figsupp6-data1-v2.xlsx
Figure 6 with 2 supplements
Proliferating ECs are more closely related to miECs than to Car4-high ECs.
(A) Pseudotime analysis of Car4-high EC, Gpihbp1-high miEC, Ifi47-high miEC, and proliferating EC clusters at 14 dpi using Slingshot identifies putative lineage relationships between the clusters …
Figure 6—figure supplement 1
Feature plots demonstrate the expression level of each of the top 15 differentially expressed genes along curve 1 of the Slingshot pseudotime trajectory, superimposed on UMAP space to demonstrate cluster(s) in which each gene is expressed.
Figure 6—figure supplement 2
Feature plots demonstrate the expression level of each of the top 15 differentially expressed genes along curve 2 of the Slingshot pseudotime trajectory, superimposed on UMAP space to demonstrate cluster(s) in which each gene is expressed.
Figure 7
Car4-high ECs participate in epithelial-endothelial signaling both at homeostasis and after influenza injury.
(A) Ligand-receptor analysis of scRNA-seq data identifies putative AT1- and AT2-EC signaling axes in the adult mouse lung at homeostasis. Car4-high ECs and miECs are predicted to receive signals …
Tables
Table 1
Top 20 differentially expressed genes in Car4-high ECs compared to other ECs in scRNA-seq of FACS-isolated lung endothelium.
| Gene name | Average log fold change | Fraction of Cd34-high, Car4-high cells expressing this gene | Fraction of other ECs expressing this gene |
|---|---|---|---|
| Igfbp7 | 2.678286614 | 0.979 | 0.327 |
| Fibin | 2.574379173 | 0.776 | 0.058 |
| Car4 | 2.424088834 | 0.975 | 0.312 |
| Emp2 | 2.052891168 | 0.861 | 0.149 |
| Ednrb | 1.978598654 | 0.609 | 0.035 |
| AW112010 | 1.934007585 | 0.608 | 0.051 |
| Pmp22 | 1.684929983 | 0.889 | 0.299 |
| Ptp4a3 | 1.634843929 | 0.730 | 0.135 |
| Ccdc184 | 1.500061919 | 0.350 | 0.017 |
| Clu | 1.497660515 | 0.784 | 0.238 |
| Ccdc68 | 1.392943656 | 0.412 | 0.040 |
| Chst1 | 1.391322461 | 0.365 | 0.016 |
| Tmeff2 | 1.389485167 | 0.402 | 0.021 |
| Cd34 | 1.363682377 | 0.737 | 0.197 |
| Enho | 1.359701549 | 0.412 | 0.028 |
| Tbx2 | 1.300007606 | 0.376 | 0.027 |
| Rprml | 1.282823428 | 0.360 | 0.014 |
| Sept4 | 1.281675924 | 0.782 | 0.269 |
| Kdr | 1.233274427 | 0.571 | 0.123 |
| Apln | 1.225917934 | 0.360 | 0.022 |
Table 2
Top 20 differentially expressed genes in proliferating ECs compared to other cell populations in scRNA-seq of whole mouse lung after influenza infection.
| Gene name | Average log fold change | Fraction of proliferating ECs expressing this gene | Fraction of all cells expressing this gene |
|---|---|---|---|
| Ube2c | 2.317853367 | 0.839 | 0.011 |
| Top2a | 2.253705903 | 0.878 | 0.011 |
| Prc1 | 2.162682748 | 0.863 | 0.012 |
| Rrm2 | 2.137769719 | 0.671 | 0.016 |
| Cenpf | 2.120348153 | 0.863 | 0.015 |
| Cks2 | 2.119347813 | 0.886 | 0.064 |
| Pbk | 2.101722647 | 0.788 | 0.008 |
| Cdc20 | 2.055640843 | 0.769 | 0.017 |
| Nusap1 | 2.04083334 | 0.898 | 0.008 |
| Birc5 | 1.983612047 | 0.847 | 0.009 |
| Cdk1 | 1.951263566 | 0.808 | 0.014 |
| Smc4 | 1.830329324 | 0.878 | 0.124 |
| Spc25 | 1.79466608 | 0.769 | 0.012 |
| Cenpa | 1.78639737 | 0.753 | 0.027 |
| Smc2 | 1.74071554 | 0.808 | 0.051 |
| Ccnb2 | 1.7002509 | 0.745 | 0.013 |
| Lockd | 1.699667491 | 0.784 | 0.024 |
| Lmnb1 | 1.640231709 | 0.792 | 0.04 |
| Fam64a | 1.620370016 | 0.741 | 0.005 |
| Racgap1 | 1.579862823 | 0.725 | 0.009 |
Table 3
Top 20 differentially expressed genes in Car4-high ECs compared to other cell populations in scRNA-seq of whole mouse lung following influenza infection.
| Gene name | Average log fold change | Fraction of Car4-high ECs expressing this gene | Fraction of all cells expressing this gene |
|---|---|---|---|
| Car4 | 2.647460241 | 0.981 | 0.281 |
| Fibin | 2.226759092 | 0.83 | 0.133 |
| Ednrb | 2.153211962 | 0.834 | 0.057 |
| AW112010 | 2.041819815 | 0.934 | 0.259 |
| Cyp4b1 | 1.822454969 | 0.986 | 0.515 |
| Emp2 | 1.774097564 | 0.957 | 0.439 |
| Ptp4a3 | 1.704881479 | 0.83 | 0.161 |
| Kitl | 1.522369803 | 0.87 | 0.258 |
| Ly6c1 | 1.517128641 | 0.993 | 0.546 |
| Kdr | 1.514651153 | 0.835 | 0.194 |
| Cd34 | 1.465370921 | 0.92 | 0.372 |
| Apln | 1.450197164 | 0.567 | 0.032 |
| Icam2 | 1.438572854 | 0.981 | 0.478 |
| Tspan13 | 1.437697131 | 0.993 | 0.585 |
| Ly6a | 1.420070001 | 0.997 | 0.647 |
| Clu | 1.398326741 | 0.905 | 0.343 |
| Ecscr | 1.346567228 | 0.953 | 0.446 |
| Nrp1 | 1.310196884 | 0.974 | 0.639 |
| Chst1 | 1.303951311 | 0.517 | 0.028 |
| Ccdc184 | 1.272517358 | 0.44 | 0.021 |
Table 4
Top 12 predicted ligand-receptor pairs for AT1-Car4-high EC signaling at homeostasis and after H1N1 influenza injury.
| Receptor | Ligand | Evidence | Receptor cluster | Ligand cluster |
|---|---|---|---|---|
| Itgb5 | Adam9 | literature supported | Car4-high EC | AT1 |
| Flt1 | Vegfa | literature supported | Car4-high EC | AT1 |
| Kdr | Vegfa | literature supported | Car4-high EC | AT1 |
| Itgb1 | Col4a1 | literature supported | Car4-high EC | AT1 |
| Itgb1 | Npnt | literature supported | Car4-high EC | AT1 |
| Itgb1 | Lamc2 | literature supported | Car4-high EC | AT1 |
| Itgb1 | Adam9 | literature supported | Car4-high EC | AT1 |
| Nrp1 | Sema3b | literature supported | Car4-high EC | AT1 |
| Nrp1 | Vegfa | literature supported | Car4-high EC | AT1 |
| Nrp1 | Sema3a | literature supported | Car4-high EC | AT1 |
| Bmpr2 | Bmp4 | literature supported | Car4-high EC | AT1 |
| Fgfr3 | Fgf1 | literature supported | Car4-high EC | AT1 |
Table 5
Primer sequences.
| Gene | Primer type | Forward sequence (5’ to 3’) | Reverse sequence (5’ to 3’) |
|---|---|---|---|
| Cd34 | qRT-PCR | TGGGTAGCTCTCTGCCTGAT | TGGTAGGAACTGATGGGGAT |
| Car4 | qRT-PCR | CAGCTCCTTCTTGCTCTGCT | CCCCAAGCAACTGCTTCTA |
| Ednrb | qRT-PCR | CCCTAAGGGTCTGCATGCTT | GGCCACTTCTCGTCTCTGC |
| Kdr | qRT-PCR | TGTGCGACCCCAAATTCCAT | ACTGGGCATCATTCCACCAA |
| Cd31 | qRT-PCR | CTGGTGCTCTATGCAAGCCT | AGTTGCTGCCCATTCATCAC |
| Gpihbp1 | qRT-PCR | CACAGCGGAACCGACAAAG | ACTGGCAACAGGTCTGAGTC |
| Plvap | qRT-PCR | CGTCAAGGCCAAGTCGCT | AGGGTTGACTACAGGGAGCC |
| Vwf | qRT-PCR | GTGTAAACGGGCATCTCCTC | CCGTCTTCAGTAGCTGGCAT |
| Gapdh | qRT-PCR | CGTCCCGTAGACAAAATGGT | TTGATGGCAACAATCTCCAC |
Key resources table
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, male, female) | C57BL/6J | Jackson Laboratory | Stock #000664 | |
| Antibody | anti-CD31(rat monoclonal) | HistoBioTec | DIA-310; RRID:AB_2631039 | IHC (1:200) |
| Antibody | anti-CD31 (rabbit monoclonal) | Thermo Fisher | MA5-16337; RRID:AB_2537856 | IHC (1:50) |
| Antibody | anti-Vwf (rabbit polyclonal) | Dako | A0082; RRID:AB_2315602 | IHC (1:500) |
| Antibody | anti-Vcam1 (CD106) (rat monoclonal) | eBioscience | 14–1061; RRID:AB_467419 | IHC (1:100) |
| Antibody | anti-Gpihbp1 (rabbit polyclonal) | Thermo Fisher | PA1-16976; RRID:AB_2294825 | IHC (1:100) |
| Antibody | anti-Plvap (rat monoclonal) | Bio-Rad | MCA2539T; RRID:AB_1102821 | IHC (1:50) |
| Antibody | anti-CD34 (rat monoclonal) | PharMingen | 553731; RRID:AB_395015 | IHC (1:25) |
| Antibody | anti-Car4 (rat monoclonal) | R and D Systems | MAB2414; RRID:AB_10718416 | IHC (1:100) |
| Antibody | anti-Sftpc (goat polyclonal) | Santa Cruz Biotechnology | sc-7706; RRID:AB_2185507 | IHC (1:50) |
| Antibody | anti-Hopx (mouse monoclonal) | Santa Cruz Biotechnology | sc-398703; RRID:AB_2687966 | IHC (1:100) |
| Antibody | anti-Ki67 (rabbit monoclonal) | Abcam | ab16667; RRID:AB_302459 | IHC (1:50) |
| Antibody | anti-phospho-histone H3 (mouse monoclonal) | Cell Signaling Technology | 9706; RRID:AB_331748 | IHC (1:200) |
| Antibody | CD45-PE-Cy7 (rat monoclonal) | Thermo Fisher | 25-0451-82; RRID:AB_2734986 | Flow cytometry (1:200) |
| Antibody | CD45-APC (rat monoclonal) | Thermo Fisher | 17-0451-83; RRID:AB_469393 | Flow cytometry (1:200) |
| Antibody | CD45-PerCP-Cy5.5 (rat monoclonal) | Thermo Fisher | 45-0451-82; RRID:AB_1107002 | Flow cytometry (1:200) |
| Antibody | CD31-PE (rat monoclonal) | Thermo Fisher | 12-0311-83; RRID:AB_465633 | Flow cytometry (1:200) |
| Antibody | CD31-PE-Cy7 (rat monoclonal) | Thermo Fisher | 25-0311-82; RRID:AB_2716949 | Flow cytometry (1:200) |
| Antibody | CD31-APC (rat monoclonal) | Thermo Fisher | 17-0311-82; RRID:AB_657735 | Flow cytometry (1:200) |
| Antibody | CD34-eF450 (rat monoclonal) | Thermo Fisher | 48-0341-80; RRID:AB_2043838 | Flow cytometry (1:50) |
| Chemical compound, drug | PR8-GP33 H1N1 influenza virus | PMID:23516357 | Dr. E. John Wherry | |
| Chemical compound, drug | Pharmaceutical-grade bleomycin | Hospira | Prescription only | 15U/vial |
| Commercial assay or kit | Click-iT Plus EdU Cell Proliferation Kit | Thermo Fisher | C10632 | |
| Other | RNAscope probe mm-Vegfc | Advanced Cell Diagnostics | 492701 | |
| Other | RNAscope probe mm-Cxcl12 | Advanced Cell Diagnostics | 422711 | |
| Other | RNAscope probe mm-Car4-C3 | Advanced Cell Diagnostics | 468421-C3 | |
| Other | RNAscope probe mm-Prc1-C3 | Advanced Cell Diagnostics | 577121-C3 | |
| Other | RNAscope probe mm-Top2a | Advanced Cell Diagnostics | 491221 | |
| Other | RNAscope probe mm-Gpihbp1-C3 | Advanced Cell Diagnostics | 540631-C3 | |
| Other | RNAscope probe mm-Plvap | Advanced Cell Diagnostics | 440221 | |
| Other | RNAscope probe mm-Pecam1-C2 | Advanced Cell Diagnostics | 316721-C2 | |
| Other | RNAscope probe mm-Sftpc | Advanced Cell Diagnostics | 314101 | |
| Other | RNAscope probe mm-Hopx | Advanced Cell Diagnostics | 405161 |
