1. Developmental Biology
Download icon

Fibrodysplasia ossificans progressiva mutant ACVR1 signals by multiple modalities in the developing zebrafish

  1. Robyn S Allen
  2. Benjamin Tajer
  3. Eileen M Shore
  4. Mary C Mullins  Is a corresponding author
  1. Department of Cell and Developmental Biology University of Pennsylvania Perelman School of Medicine, United States
  2. Departments of Orthopaedic Surgery and Genetics University of Pennsylvania Perelman School of Medicine, United States
Research Article
  • Cited 9
  • Views 1,106
  • Annotations
Cite this article as: eLife 2020;9:e53761 doi: 10.7554/eLife.53761


Fibrodysplasia ossificans progressiva (FOP) is a rare human genetic disorder characterized by altered skeletal development and extraskeletal ossification. All cases of FOP are caused by activating mutations in the type I BMP/TGFβ cell surface receptor ACVR1, which over-activates signaling through phospho-Smad1/5 (pSmad1/5). To investigate the mechanism by which FOP-ACVR1 enhances pSmad1/5 activation, we used zebrafish embryonic dorsoventral (DV) patterning as an assay for BMP signaling. We determined that the FOP mutants ACVR1-R206H and -G328R do not require their ligand binding domain to over-activate BMP signaling in DV patterning. However, intact ACVR1-R206H has the ability to respond to both Bmp7 and Activin A ligands. Additionally, BMPR1, a type I BMP receptor normally required for BMP-mediated patterning of the embryo, is dispensable for both ligand-independent signaling pathway activation and ligand-responsive signaling hyperactivation by ACVR1-R206H. These results demonstrate that FOP-ACVR1 is not constrained by the same receptor/ligand partner requirements as WT-ACVR1.


Fibrodysplasia ossificans progressiva (FOP) is a rare human genetic disorder characterized by altered skeletal development and extraskeletal bone formation. Patients with FOP have pathognomonic malformation of the great toes and progressive spontaneous and injury-induced heterotopic ossification (HO) that eventually leads to loss of mobility (Kaplan et al., 2009; Cohen et al., 1993; Connor and Evans, 1982). Most cases of FOP are caused by a single amino acid substitution, R206H, in the type I BMP/TGFβ cell surface receptor ACVR1 (also known as ALK2), which over-activates signaling through phospho-Smad1/5 (pSmad1/5) (Shore et al., 2006; Shen et al., 2009; van Dinther et al., 2010; Fukuda et al., 2009). A small subset of patients with variant presentation of the classical FOP phenotype have distinct activating mutations in the ACVR1 gene, including the substitution G328R (Kaplan et al., 2009; Haupt et al., 2018). While the phenotypic consequences of increased ACVR1 signaling have been well characterized in both patients and animal models (Casal et al., 2019; Pignolo et al., 2011; Chakkalakal and Shore, 2019), the mechanism by which ACVR1 mutations lead to over-active signaling is less well understood.

ACVR1 and its signaling partners belong to the transforming growth factor beta (TGFβ) superfamily. The activity of ACVR1 is critical to several developmental processes including embryonic patterning and skeletal formation (Derynck and Akhurst, 2007; Little and Mullins, 2006). In the presence of ligand, ACVR1 complexes with other BMP receptors to signal. In zebrafish, Acvr1l (also known as Alk8), the zebrafish paralog to human and mouse ACVR1 (Yelick et al., 1998), forms a tetrameric receptor complex with one other type I BMP receptor, Bmpr1a or Bmpr1b (also known as Alk3 and Alk6, respectively), and two type II BMP receptors (Little and Mullins, 2006; Ehrlich et al., 2011; Yadin et al., 2016). Receptor complex assembly allows the type II BMP receptors to phosphorylate the type I receptors at serine/threonine residues within the GS domain (Schmierer and Hill, 2007; Shi and Massagué, 2003). Phosphorylation of the type I BMP receptors results in a conformational change, allowing them to bind ATP and phosphorylate Smad1/5 to initiate downstream transcription (Feng and Derynck, 2005; Chaikuad et al., 2012; Liu et al., 1996).

The zebrafish embryo is an excellent genetically tractable in vivo vertebrate model for investigating the signaling mechanism of the ACVR1-FOP receptor (Shen et al., 2009; Mucha et al., 2018). In the early zebrafish embryo, BMP acts as a morphogen to pattern the dorsoventral (DV) axis in a process that is conserved throughout the animal kingdom (Zinski et al., 2018). High levels of BMP signaling specify ventral cell fates and intermediate signaling specifies lateral fates, while absence of signaling allows dorsal cell fate specification. The DV pattern is generated through a quantifiable pSmad1/5 signaling gradient within the gastrulating embryo that peaks ventrally and decreases dorsally (Little and Mullins, 2006; Zinski et al., 2017; Zinski et al., 2019; Tucker et al., 2008; Mintzer et al., 2001). Perturbations to this BMP signaling gradient in the developing embryo result in distinct, dose-dependent patterning phenotypes (Figure 1b). Over-activation of the BMP signaling pathway by FOP-ACVR1 causes ventralization, an excess of ventral cell fate specification at the expense of dorsal fates (Shen et al., 2009; Mucha et al., 2018), while loss of endogenous acvr1l expression leads to an opposite dorsalization. Loss of acvr1l in the zebrafish can be rescued by human ACVR1, demonstrating their conserved activity (Shen et al., 2009).

Figure 1 with 2 supplements see all
ACVR1-R206H and -G328R over-activate BMP signaling in the absence of an intact ligand-binding domain.

(a) Embryos expressing ACVR1 HA-tagged constructs were immunostained for HA at the shield stage (early gastrula); ACVR1 domain schematics of the constructs are above each set of corresponding images. Nuclei (yellow), βcatenin (cyan), ACVR1-HA (magenta). Scale bars = 40 μm. ΔAcvr1 constructs lack residues 35–100, which contain the cysteine-rich ligand binding motifs. Uninjected (N = 6) and embryos injected with: Acvr1 (N = 6), ΔAcvr1 (N = 5), Acvr1-R206H (N = 9), ΔAcvr1-R206H (N = 4), Acvr1-G328R (N = 5), and ΔAcvr1-G328R (N = 5). (b) BMP signaling dose-dependent 12–30 hpf zebrafish embryo phenotypes: severe dorsalization (C5-C4, dark blue), mild dorsalization (C3-C1, light blue), wild-type development (WT, violet), mild ventralization (V1-V3, light orange), and severe ventralization (V4-V5, dark orange). (c) Bubble plot circle sizes correspond to the percent of total embryos within a condition that are in a particular phenotypic category. Examples are shown for: 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% and 10%. (d) Representative phenotypes of wild-type embryos (evaluated at 12 and 30 hpf) and embryos injected with acvr1l MO (evaluated at 12 hpf; none survive to 30 hpf). (e–g) DV phenotypes of 12–30 hpf embryos injected with Acvr1 or ΔAcvr1 mRNA alone or together with acvr1l MO. Data are from four pooled experiments. (e) Acvr1 or ΔAcvr1 injected embryos. Columns: 1, N = 240; 2, N = 121; 3, N = 140; 4, N = 153; 5, N = 96; 6, N = 118. (e’) Representative 12 or 30 hpf phenotypes. (f) Acvr1-R206H or ΔAcvr1-R206H injected embryos. Columns: 1, N = 240; 2, N = 70; 3, N = 84; 4, N = 153; 5, N = 73; 6, N = 91. (f’) Representative 30 hpf phenotypes. (g) Acvr1-G328R or ΔAcvr1-G328R injected embryos. Columns: 1, N = 240; 2, N = 88; 3, N = 79; 4, N = 153; 5, N = 78; 6, N = 71. (g’) Representative 30 hpf phenotypes.

Some aspects of ACVR1-R206H signaling have been investigated. Previous work by our lab demonstrated that expression of ACVR1-R206H in the zebrafish embryo over-activates BMP signaling in the absence of Bmp2 and Bmp7, the obligatory patterning ligands of the developing zebrafish (Shen et al., 2009; Little and Mullins, 2009; Nguyen et al., 1998; Dick et al., 2000; Schmid et al., 2000). Surprisingly, ACVR1-R206H shows acquired responsiveness to novel ligands in cell culture and mouse models; most notably Activin A, a TGFβ superfamily ligand that normally signals through ACVR1b (also called ALK4) and pSmad2/3 (Hatsell et al., 2015; Lees-Shepard et al., 2018; Hino et al., 2015). While ACVR1-R206H has been shown to require its normal type II BMP receptor partners, BMPR2 and ACVR2a (Hino et al., 2015; Bagarova et al., 2013), it is unknown whether it retains a requirement for its type I BMP receptor partner, BMPR1. ACVR1-R206H has been shown to signal in the absence of BMPR1a or BMPR1b individually (Hino et al., 2015). However, the ability of FOP-ACVR1 to function in the absence of both BMPR1a and BMPR1b, which largely function redundantly (Yoon et al., 2005; Wine-Lee et al., 2004), has not been tested.

In this study, we used BMP-pSmad1/5 dose-dependent DV patterning of the developing zebrafish to assay for signaling activity of ACVR1-R206H and ACVR1-G328R in vivo. We show that ligand-binding domain-deficient ACVR1-R206H and -G328R can over-activate pSmad1/5 signaling, demonstrating that these mutant receptors have enhanced signaling activity in the absence of ligand binding. However, intact ACVR1-R206H shows hyperactive pSmad1/5 signaling in response to Bmp7 and Activin A ligands. We further determined that neither the ligand-independent nor the ligand-responsive signaling modalities of ACVR1-R206H require the partner type I BMP receptors that are necessary for signaling by wild-type ACVR1. These results demonstrate that the ACVR1-R206H and G328R receptors have acquired a fundamentally altered signaling mechanism.


ACVR1-R206H and -G328R over-activate BMP signaling in the absence of an intact ligand binding domain

Previous work by our lab showed that ACVR1-R206H can signal independently of Bmp2/7 heterodimers, the only functional DV patterning ligand in the zebrafish embryo (Little and Mullins, 2009), suggesting that the mutant receptor can signal independently of all BMP ligand (Shen et al., 2009). More recent studies have reported that ACVR1-R206H has an acquired response to the TGFβ family ligand, Activin A (Hatsell et al., 2015; Lees-Shepard et al., 2018; Hino et al., 2017). This ligand response has been implicated in inciting heterotopic ossification in patients with FOP (Hino et al., 2017; Alessi Wolken et al., 2018). Interestingly, however, ACVR1-R206H can signal without its ligand-binding domain in Drosophila and murine cell culture systems (Haupt et al., 2018; Le and Wharton, 2012; Hildebrand et al., 2017; Haupt et al., 2014).

To investigate the FOP-ACVR1 signaling mechanism, we used a zebrafish DV patterning assay. For this assay, we microinjected one-cell stage wild-type or BMP component mutant zebrafish embryos to introduce mRNAs and/or anti-sense knockdown morpholinos that replicate null mutant phenotypes. The mRNAs and morpholinos were never mixed together, but instead each mRNA and morpholino was injected using separate needles, so that controls could be done to show the efficacy of each component on its own. Within one experiment, each mRNA or morpholino was always injected through the same calibrated needle on its own injection apparatus to ensure consistent amounts were injected among all the controls and experimental conditions.

To test if the FOP-ACVR1 receptor requires ligand binding to signal in a vertebrate animal model, we first compared the signaling function of the mouse wild-type ACVR1 to mouse ACVR1 lacking 65 residues containing the cysteine-rich ligand-binding motifs of the extracellular domain (ΔACVR1) (Haupt et al., 2014). We injected one-cell stage embryos with Acvr1 or ΔAcvr1 mRNA and tested if the exogenously expressed ACVR1 protein correctly localized to the cell membrane by immunostaining for the HA-epitope tag present on these receptors. We found that all the ACVR1 protein variants, regardless of their signaling activity, were expressed and localized to the cell membrane within the developing embryo (Figure 1a).

To determine if the ligand-binding domain mutant ΔACVR1 receptor was sufficient to pattern the zebrafish embryo, we knocked down endogenous zebrafish Acvr1l with morpholinos (MOs), which replicate the phenotype of acvr1l null maternal-zygotic mutant embryos (Mintzer et al., 2001). Although we have previously generated maternal-zygotic acvr1l mutant embryos that lack both maternally and zygotically expressed acvr1l, are deficient in all BMP signaling, and exhibit a C5 severely dorsalized phenotype (Mintzer et al., 2001), generating these maternal-zygotic acvr1l mutant embryos required producing acvr1l homozygous mutant adults, an arduous accomplishment due to other requirements for Acvr1l later in development (Mintzer et al., 2001). Therefore, we used MO knockdown in the current study to deplete Acvr1l on a large scale and in combination with other mutant genotypes. As previously demonstrated and re-confirmed here, knockdown of Acvr1l generates the identical, severely dorsalized C5 phenotype as the maternal-zygotic acvr1l null mutant, consistent with the loss of all BMP pathway activity (Figure 1d and column four in Figure 1e–f; Figure 1—figure supplement 1Mintzer et al., 2001; Little and Mullins, 2009; Bauer et al., 2001). At 12 to 14 hr post fertilization (hpf), the C5 phenotype is characterized by an elongated body axis and by expansion of the normally dorsally-located somites around the circumference of the embryo. By 30 hpf, these embryos lyse due to presumptive pressure from the radialized somites. Importantly, injection of wild-type mouse Acvr1 mRNA can fully rescue this phenotype (Figure 1e,e’, compare to d), demonstrating the specificity of the knockdown for Acvr1l. All these control experiments adhere to the recently published guidelines by leaders in the zebrafish field for the use of MOs and their validity to substitute for a mutant allele (Stainier et al., 2017).

We next expressed Acvr1 or ΔAcvr1 mRNAs in acvr1l-knockdown (acvr1l-KD) embryos to test their function. We evaluated rescue of BMP signaling activity in these embryos by assaying for DV patterning phenotypes (Figure 1b) and quantifying the proportion of embryos in each phenotypic category (Figure 1c). Neither Acvr1 nor ΔAcvr1 mRNA perturbed normal development in the presence of endogenous Acvr1l (Figure 1e columns 2 and 3, Figure 1e’; Figure 1—figure supplement 1). While ACVR1 rescued loss of endogenous Acvr1l, primarily to wild-type or mildly dorsalized phenotypes (Figure 1e column 5, Figure 1e’; Figure 1—figure supplement 1), ΔAcvr1 did not (Figure 1e column 6, and Figure 1e’; Figure 1—figure supplement 1). By contrast, both Acvr1-R206H and ΔAcvr1-R206H ventralized WT and acvr1l-KD zebrafish embryos (Figure 1f columns 2, 3, 5 and 6, Figure 1f’; Figure 1—figure supplement 1). Likewise, both Acvr1-G328R and ΔAcvr1-G328R ventralized WT and acvr1l-KD embryos (Figure 1g columns 2, 3, 5 and 6, Figure 1g’; Figure 1—figure supplement 1). These results in an in vivo vertebrate model support that ACVR1-R206H and ACVR1-G328R, unlike wild type ACVR1, exhibit ligand-independent signaling activity.

To test if our results could be influenced by differences in expression levels of injected mRNA, we determined the relative amounts of receptor in our injected embryos, using immunofluorescence to measure the cell surface expression of our Acvr1-HA-tagged mutant receptors in confocal sections of mid-gastrula embryos. Mid-gastrula embryos were collected for immunofluorescence and the remaining embryos were allowed to develop to 30 hpf for phenotyping. As described above, Acvr1, but not ΔAcvr1 could rescue Acvr1l-KD embryos, and all FOP mutant receptors ventralized embryos regardless of the presence of a ligand-binding domain (Figure 1—figure supplement 2). The amount of WT-Acvr1 that partially to fully rescued Acvr1l KD was determined per μm2 of β-catenin fluorescence surface area (Figure 1—figure supplement 2). This receptor amount should reflect the amount of receptor expression that is required to pattern the zebrafish embryo. The amounts of Acvr1-R206H and Acvr1-G328R fluorescence that ventralized the embryo were similar to or significantly lower than WT-Acvr1, respectively. The levels of ΔAcvr1-G328R and ΔAcvr1-R206H fluorescence were also similar to or significantly lower than ΔAcvr1, respectively. These results show that the amount of Acvr1-R206H or -G328R required to ventralize the zebrafish embryo is similar to or lower than the amount of Acvr1 required to pattern the wild-type zebrafish, regardless of the presence of a ligand-binding domain. Altogether, the results indicate that the ventralization is not due to overexpression of the FOP mutant receptors.

ACVR1-R206H and -G328R over-activate pSmad1/5 signaling with or without the presence of a ligand-binding domain

During early embryonic development, a nuclear gradient of pSmad1/5 activity forms across the DV axis of the zebrafish embryo in response to BMP signaling (Zinski et al., 2017; Zinski et al., 2019; Tucker et al., 2008Figure 2a). This gradient persists throughout gastrulation and specifies DV axial fates. To test the ability of the ligand-binding domain mutant ΔAcvr1 to signal through pSmad1/5, we knocked down endogenous Acvr1l, injected embryos with mouse Acvr1 or ΔAcvr1 mRNAs, and then immunostained early-gastrula embryos (shield-65% epiboly stage) for pSmad1/5.

ACVR1-R206H and -G328R over-activate pSmad1/5 signaling with or without the presence of a ligand-binding domain.

(a,a’–g,g’) Animal pole view of relative pSmad1/5 intensities (using arbitrary units (AU)) within each nucleus of the embryo in representative WT early-gastrula embryos (shield-65% epiboly stage) with endogenous Acvr1l present (a–g) or knocked down (a’–g’). Injected mRNAs are noted above for b-g and b’-g’. (a–c, a’–c’) Embryos are oriented with ventral (V) side to the left and the dorsal (D) side to the right. (d–g, d’–g’) Dorsal side of the embryo could not be identified due to loss of the shield structure with severe ventralization. Scale bars = 100 μm. (a, a’) Wild-type and Acvr1l-KD embryos, respectively (N = 18 and 15). (b, b’) Acvr1 injected embryos (N = 10 and 9). (c, c’) ΔAcvr1 injected embryos (N = 9 and 7). (d, d’) Acvr1-R206H injected embryos (N = 14 and 17). (e, e’) ΔAcvr1-R206H injected embryos (N = 8 and 11). (f, f’) Acvr1-G328R injected embryos (N = 12 and 9). (g, g’) ΔAcvr1-G328R injected embryos (N = 12 and 12). (h) Mean nuclear pSmad1/5 fluorescence of injected embryos. Each dot represents the mean nuclear fluorescence for an individual embryo. Mean and standard deviation of each condition are shown by bars. * indicates p<0.05, ** indicates p<0.001, ns indicates no significance.

While wild-type embryos formed a gradient of pSmad1/5 expression that peaks ventrally and decreases dorsally (Figure 2aMucha et al., 2018), Acvr1l-KD embryos lacked detectable pSmad1/5 signal (Figure 2a’). The mean nuclear pSmad1/5 fluorescence of Acvr1l-KD embryos was significantly decreased compared to WT embryos (Figure 2h). Injected mouse Acvr1 mRNA did not alter the pSmad1/5 gradient in WT embryos and rescued pSmad1/5 in Acvr1l-KD embryos (Figure 2b,b’). There was no significant difference in mean nuclear pSmad1/5 intensity between uninjected wild-type, Acvr1-injected wild-type, and Acvr1l-KD embryos injected and rescued with Acvr1 (Figure 2h). ΔAcvr1 also did not perturb normal gradient formation in WT embryos, but could not rescue loss of pSmad1/5 in Acvr1l-KD embryos (Figure 2c,c’). There was no significant difference in mean pSmad1/5 fluorescence between Acvr1l-KD embryos and Acvr1l-KD embryos injected with ΔAcvr1, showing that WT-Acvr1 cannot signal through pSmad1/5 without a ligand-binding domain (Figure 2h). In contrast, both Acvr1-R206H and ΔAcvr1-R206H restored pSmad1/5 signaling in Acvr1l-KD embryos and greatly expanded the signaling gradient dorsally (Figure 2d,d’,e,e’). Likewise, Acvr1-G328R and ΔAcvr1-G328R rescued and expanded the pSmad1/5 gradient even when endogenous Acvr1l was absent (Figure 2f,f’,g,g’). Both ACVR1-R206H and ACVR1-G328R significantly increased the mean pSmad1/5 signaling intensity in Acvr1l-KD embryos regardless of the presence of a ligand-binding domain (Figure 2h). These results confirm that ACVR1-R206H and ACVR1-G328R have acquired the capacity to over-activate Smad1/5 phosphorylation even in the absence of an intact ligand-binding domain.

ACVR1-R206H and -G328R, but not ΔAcvr1-R206H, are responsive to Bmp7 ligand

We next tested if FOP-ACVR1 with an intact ligand-binding domain retained the ability to respond to ligand. We used Bmp7 in this experiment since previous studies showed that ACVR1 binds and signals in response to Bmp7 (Yadin et al., 2016; Little and Mullins, 2009; Heinecke et al., 2009; Allendorph et al., 2007). We injected human WT- or FOP-ACVR1 mRNAs into one-cell stage bmp7sb1aub null mutant zebrafish embryos that also had Acvr1l KD. We then determined whether Bmp7 ligand expression enhanced signaling by these ACVR1 receptors.

Homozygous bmp7-/- embryos exhibit a severely dorsalized C5 phenotype (Figure 3a,b column 1; Figure 3—figure supplement 1Nguyen et al., 1998; Dick et al., 2000; Schmid et al., 2000). This dorsalization can be rescued by injected bmp7 mRNA (Figure 3a,b column 2; Figure 3—figure supplement 1). However, bmp7 mRNA expression does not rescue bmp7-/- embryos that are also deficient for Acvr1l, as expected (Figure 3a,b column 3; Figure 3—figure supplement 1). Conversely, in the absence of endogenous bmp7, WT ACVR1 expression cannot rescue bmp7-/- embryos (Figure 3b column 4, b’; Figure 3—figure supplement 1), confirming that both of these components are required for BMP signaling to pattern the developing embryo. Co-injection of human ACVR1 with bmp7 mRNA rescued embryos to less dorsalized or wild-type phenotypes (Figure 3b column 5, b’; Fig Figure 3—figure supplement 1). Similarly, mouse Acvr1 rescued DV patterning with bmp7 mRNA, but could not pattern embryos in the absence of bmp7 (Figure 3—figure supplement 1, columns 5 and 6).

Figure 3 with 2 supplements see all
ACVR1-R206H and -G328R but not ΔAcvr1-R206H are responsive to Bmp7 ligand.

(a) Representative dorsal-ventral (DV) phenotypes of bmp7-/- embryos not injected (12 hpf), injected with bmp7 mRNA (12 and 30 hpf), or bmp7 mRNA and acvr1l KD (12–14 hpf). (b–d) 12–30 hpf DV phenotypes of bmp7-/- embryos with acvr1l KD that were injected with human ACVR1 mRNA alone or combined with bmp7 mRNA. (b) WT ACVR1 injected embryos. Three pooled experiments. Columns: 1, N = 240; 2, N = 150; 3, N = 143; 4, N = 101; 5, N = 120. (b’) Representative 12 and 30 hpf phenotypes. (c) ACVR1-R206H injected embryos. Two pooled experiments. Columns: 1, N = 177; 2, N = 78; 3 N = 132; 4, N = 100; 5, N = 86. (c’) Representative 12 and 30 hpf phenotypes. (d) ACVR1-G328R injected embryos. Two pooled experiments. Columns: 1, N = 52; 2, N = 46; 3, N = 55; 4, N = 56; 5, N = 82. (d’) Representative 12 and 30 hpf phenotypes. (e–f) 12–30 hpf DV phenotypes of bmp7-/- embryos with acvr1l KD that were injected with a mouse Acvr1 or ΔAcvr1 mRNA alone or in combination with bmp7 mRNA. Four pooled experiments. (e) WT Acvr1 or ΔAcvr1 mRNA Columns: 1, N = 540; 2, N = 172; 3, N = 143; 4, N = 152; 5, N = 231; 6, N = 163; 7, N = 104; 8, N = 97; (f) Acvr1-R206H or ΔAcvr1-R206H mRNA Columns: 1, N = 540; 2, N = 172; 3, N = 143; 4, N = 152; 5, N = 176; 6, N = 217; 7, N = 119; 8, N = 145.

We next tested if ACVR1-R206H or ACVR1-G328R signaling can be enhanced by Bmp7 ligand. ACVR1-R206H rescued bmp7-/-, acvr1l-KD fish primarily to mildly ventralized phenotypes (Figure 3c column 4, c’; Figure 3—figure supplement 1). This rescue was enhanced to severe ventralization phenotypes by the addition of bmp7 ligand mRNA (Figure 3c column 5, c’, Figure 3—figure supplement 1). Similarly, ACVR1-G328R rescued bmp7-/- embryos to less severe dorsalized phenotypes (Figure 3d column 4, d’, Figure 3—figure supplement 1) and induced further ventralization in response to bmp7 ligand (Figure 3d column 5, d’; Figure 3—figure supplement 1).

We then tested if our intact and ligand-binding mutant mouse Acvr1 could respond to Bmp7. Like human ACVR1, mouse Acvr1 only rescued bmp7-/- mutant fish in the presence of injected bmp7 mRNA (Figure 3e, columns 5 and 6; Figure 3—figure supplement 2). ΔAcvr1, however, could not rescue bmp7-/- embryos regardless of the presence of Bmp7 (Figure 3e, columns 7 and 8; Figure 3—figure supplement 2), demonstrating that WT Acvr1 requires a ligand-binding domain to signal. Acvr1-R206H rescued bmp7-/-, acvr1l-KD embryos primarily to mildly ventralized phenotypes (Figure 3f, column 5; Figure 3—figure supplement 2) and additional bmp7 ligand mRNA enhanced the rescue to severely ventralized phenotypes (Figure 3f, column 6; Figure 3—figure supplement 2). Importantly, while ΔAcvr1-R206H rescued bmp7-/- embryos to ventralized phenotypes (Figure 3e, column 7; Figure 3—figure supplement 2), the addition of bmp7 mRNA did not further enhance ventralization (Figure 3e, column 8; Figure 3—figure supplement 2), supporting that loss of the ligand-binding domain prevents ligand response. These data show that ACVR1-R206H and ACVR1-G328R are responsive to BMP ligand, and together with the data in Figures 1 and 2, demonstrate that these FOP-ACVR1 mutant receptors have both ligand-independent and ligand-responsive activity.

ACVR1-R206H signaling in response to activin A ligand depends on its ligand binding domain

Studies have shown that ACVR1-R206H has acquired the ability to respond to Activin A ligand, in addition to its normal BMP ligands (Hatsell et al., 2015; Lees-Shepard et al., 2018; Hino et al., 2015). Previous studies reported that ΔAcvr1-R206H does not respond to Activin A or BMP ligand in cell culture (Hildebrand et al., 2017). To test if ACVR1-R206H requires a ligand-binding domain to activate pSmad1/5 in response to Activin A or BMP7 ligand in vivo in the zebrafish vertebrate model, we injected Acvr1l-KD, bmp7-/- embryos with mouse Acvr1 or ΔAcvr1 mRNA with or without Activin A or bmp7 mRNA and assayed pSmad1/5 activation in six hpf embryos and DV phenotypes in 30 hpf embryos.

Expression of Activin A ligand in the early embryo enhances Nodal signaling through pSmad2 (Figure 4p) and dorsal organizer mesoderm formation (Gritsman et al., 1999; Thisse et al., 2000; Green et al., 1992; Green et al., 1994), precluding our ability to assay DV patterning defects. In wildtype and bmp7-/- embryos, the dorsal organizer or shield forms on the presumptive dorsal side of the early gastrula-stage embryo (Figure 4a,b). Overexpression of Activin A mRNA in the embryo results in duplication or expansion of the dorsal organizer regardless of the presence of bmp7 (Figure 4a,b). This expansion of dorsal structures causes development to halt, leading to subsequent death or severe perturbation of patterning.

ACVR1-R206H requires a ligand-binding domain to respond to BMP7 and Activin A ligand through pSmad1/5.

(a, b) Representative 6 hpf (shield stage) WT (a) and bmp7-/- (b) embryos uninjected or injected with Activin A mRNA. WT and bmp7-/- develop normal dorsal organizers (arrows). Activin A injection causes embryos to have expanded (filled arrowheads) or duplicated (empty arrowheads) dorsal organizers. (c–m) Animal pole view of pSmad1/5 intensities (using arbitrary units (AU)) within each nucleus of the embryo in representative bmp7-/- early gastrula (shield stage) embryos with endogenous Acvr1l present (c–e) or knocked down (f–m). Injected receptor mRNA is noted to the left and ligand mRNA is noted above. Embryos are oriented with the dorsal shield to the right. Scale bars = 100 μm. (c–e) bmp7-/- uninjected embryos (N = 8), or injected with bmp7 (N = 10), or Activin A (N = 8) mRNA. (f and g) bmp7-/-, acvr1l KD embryos injected with bmp7 (N = 6) or Activin A (N = 8) mRNA. (h–j) Acvr1-R206H injected bmp7-/-, acvr1l KD embryos with no injected ligand (N = 8), bmp7 (N = 8), or Activin A (N = 9) mRNA. (k–m) ΔAcvr1-R206H injected bmp7-/-, acvr1l KD embryos (N = 11), with injected bmp7 (N = 11), or Activin A (N = 11) mRNA. (n) Mean nuclear pSmad1/5 fluorescence of injected embryos. Each dot represents the mean fluorescence of an individual embryo. Mean and standard deviation of each condition is shown. * indicates p<0.05, ns indicates no significance. (o–s) Lateral views showing relative pSmad2 intensities (using arbitrary units (AU)) within each nucleus of the embryo in representative bmp7-/- early gastrula embryos (shield stage) with endogenous acvr1l present (i and j) or knocked down (k–m). Injected mRNA is noted above each image. Embryos are oriented with the presumptive dorsal side facing forward. Scale bars = 100 μm. (o) bmp7-/- embryo (N = 5) (p) Activin A injected embryo (N = 8) (q) Activin A injected embryo with Acvr1l knockdown (N = 5) (r) mAcvr1-R206H injected embryo with Acvr1l knockdown (N = 5) (s) mAcvr1-R206H and Activin A injected embryo with Acvr1l knockdown (N = 5) (t) Mean nuclear pSmad2 fluorescence of injected embryos. Each dot represents the mean fluorescence of an individual embryo. Mean and standard deviation of each condition is shown by bars. * indicates p<0.05, ns indicates no significance.

Therefore, to assess the ability of Acvr1-R206H to respond to Activin A with or without a ligand-binding domain, we used immunostaining to quantify pSmad1/5 activity in Acvr1l-KD, bmp7-/- embryos injected with Acvr1 or ΔAcvr1 with or without bmp7 or Activin A. For these experiments, a lower amount of Acvr1-R206H and ΔAcvr1-R206H mRNA was injected than in the DV phenotyping experiments to decrease the initial pSmad1/5 intensity prior to the addition of ligand and permit detection of Activin A ligand-induced effects. Embryos were collected at shield stage before Activin A expressing embryos halt their development.

A Bmp2/7 heterodimer is the obligatory patterning ligand in the gastrula zebrafish embryo (Little and Mullins, 2009), and as a result, bmp7-/- early gastrula embryos lack detectable pSmad1/5 signaling (Figure 4c). Injection of bmp7 mRNA rescues pSmad1/5 signaling to wild-type levels that peak ventrally and decrease dorsally (Figure 4d). Addition of bmp7 mRNA did not rescue signaling in the absence of endogenous Acvr1l (Figure 4f). Addition of Activin A did not rescue pSmad1/5 signaling regardless of the presence of Acvr1l (Figure 4e,g). To quantitatively compare the pSmad1/5 signaling levels of the embryos in these conditions, we determined the mean pSmad1/5 intensities for each condition (Figure 4n). We found that Bmp7 significantly increased the mean pSmad1/5 signaling intensity compared to bmp7-/- embryos (Figure 4n). Expression of Bmp7 or Activin A in Acvr1l-KD embryos did not significantly alter the mean pSmad1/5 signaling level (Figure 4n), showing that Bmp7 requires Acvr1 to induce pSmad1/5 signaling and Activin A normally has no significant effect on pSmad1/5 signaling.

The low level of injected Acvr1-R206H mRNA activated low levels of pSmad1/5 signaling in bmp7-/- embryos (Figure 4h). Importantly, co-injection of Acvr1-R206H with Activin A or bmp7 mRNA significantly increased the mean pSmad1/5 signaling intensity (Figure 4i,j,n). Our data suggest that ACVR1-R206H had a more intense response to Bmp7 than Activin A; however, it is important to note that the amount of translated ligand in an embryo was not determined in these experiments. In addition, the dorsal organizer expansion in response to Activin A in our experiments may mask pSmad1/5 intensity enhancement by ACVR1-R206H in response to Activin A. These data demonstrate that Acvr1-R206H activates pSmad1/5 signaling in response to both Activin A and Bmp7.

Conversely, while ΔAcvr1-R206H induced pSmad1/5 in bmp7-/- embryos (Figure 4k,n), neither addition of Activin A nor Bmp7 significantly increased the mean pSmad1/5 fluorescence in ΔAcvr1-R206H injected embryos (Figure 4l,m,n). These data demonstrate that Acvr1 requires a ligand-binding domain to respond to both Activin A and Bmp7, and suggest that Acvr1-R206H can activate pSmad1/5 signaling independently of both of these ligands. These data further support that FOP-ACVR1 mutant receptors have both ligand-independent and ligand-responsive activity.

We next evaluated the ability of Acvr1-R206H to activate pSmad2 signaling. A nuclear pSmad2 gradient forms along the margin of the zebrafish embryo during early gastrula stages in response to Nodal-Vg1 signaling and specifies endodermal and mesodermal cell fates (Hill, 2018; Pelliccia et al., 2017; Montague and Schier, 2017; van Boxtel et al., 2015Figure 4o). Activin A can rescue loss of Nodal signaling by activating pSmad2 through Nodal receptors (Gritsman et al., 1999). Acvr1-R206H has been shown to signal in response to either BMP or Activin A ligand in cell culture and over-activate pSmad1/5, but not pSmad2, signaling (Hatsell et al., 2015; Hino et al., 2015; Hildebrand et al., 2017). Expression of Activin A alone in the developing zebrafish over-activates pSmad2 throughout the entire embryo (Figure 4p).

To test if Acvr1-R206H enhances signaling through the pSmad2 pathway, we injected Acvr1-R206H mRNA into bmp7-/-, Acvr1l-KD embryos with or without Activin A mRNA and measured pSmad2 immunofluorescence intensity. Embryos mutant for bmp7 were used to eliminate possible competition between Activin A and Bmp7 for Acvr1 and type II BMP receptors and enhance any potential results. Expression of Activin A significantly increased mean pSmad2 signaling regardless of the presence of endogenous Acvr1l (Figure 4p,q,t). Acvr1-R206H alone did not increase the mean pSmad2 intensity compared to uninjected embryos and had significantly lower mean pSmad2 intensity compared to embryos injected with Activin A (Figure 4r,t). Activin A significantly increased mean pSmad2 intensity in Acvr1-R206H injected embryos, but no more than in the absence of Acvr1-R206H (Figure 4s,t). These data show that Activin A enhances pSmad2 signaling in the embryo, but Acvr1-R206H does not, and confirm that Acvr1-R206H over-activates pSmad1/5, but not pSmad2 signaling.

ACVR1-R206H signals in the absence of the type I Bmpr1 receptor

The ability of FOP-ACVR1 to signal independently of ligand suggests the possibility that the mutant receptor could signal in the absence of receptor complex partners as well. In the developing zebrafish, both type I BMP receptors, Acvr1l and Bmpr1, are required for signaling and to pattern the embryo (Mintzer et al., 2001; Little and Mullins, 2009). BMP ligand is required for Acvr1l to associate with Bmpr1 in the zebrafish gastrula embryo (Little and Mullins, 2009). Previous studies showed that ACVR1-R206H retained the ability to over-activate BMP signaling when either BMPR1A or BMPR1B was knocked down in cell culture (Hino et al., 2015). However, given that these two genes have largely redundant activity (Yoon et al., 2005; Wine-Lee et al., 2004), one copy of BMPR1 (A or B) may be sufficient to allow ACVR1-R206H to signal.

Zebrafish have two bmpr1a genes (aa and ab) and two bmpr1b genes (ba and bb). To test if ACVR1-R206H can signal in the absence of all other type I BMP receptors, we first intercrossed bmpr1aa+/-; bmpr1ab-/- zebrafish (Figure 5a) to deplete bmpr1a gene function. We next injected the bmpr1a-deficient embryos with MOs against bmpr1ba, bmpr1bb, and acvr1l (designated as Type I KD fish henceforth). We then injected these Type I KD fish with human ACVR1-R206H mRNA, collected embryos at an early gastrula stage for pSmad1/5 immunostaining or at 12 to 30 hpf for phenotyping, analyzed them blindly, then genotyped for the bmpr1aa mutation. Using immunostaining, we confirmed that Flag-tagged ACVR1-R206H is expressed and localized to the cell membrane in bmpr1a+/-embryos (Figure 5b).

Figure 5 with 2 supplements see all
ACVR1-R206H signals in the absence of BMPR1.

(a) Experimental workflow. bmpr1aa+/-; ab-/- fish were crossed with each other to generate bmpr1a+/- (bmpr1aa+/+; ab-/-), bmpr1a+/- (bmpr1aa+/-; ab-/-), and bmpr1a-/- (bmpr1aa-/-;ab-/-) embryos. One-cell stage eggs were injected with bmpr1ba, bmpr1bb morpholinos, and separately injected with an acvr1l morpholino to additionally knockdown these endogenous BMP receptors, and then were injected with ACVR1-R206H mRNA. Early gastrula (shield-65% epiboly) stage embryos were collected and fixed for immunostaining. At 12 to 30 hpf the remaining embryos were scored for DV patterning phenotypes. Following blindly immunostaining and imaging, or phenotyping, embryos were individually genotyped. (b) Representative immunostained embryo for ACVR1-Flag (magenta), β-Catenin (marking the cell membrane cyan), and nuclei (yellow) (N=5). (c-e) Representative 24 hpf phenotypes of (b) bmpr1aa+/+; ab-/-, (c) bmpr1aa+/-; ab-/-, and (d) bmpr1aa-/-; ab-/- embryos. (f) Injected embryo phenotypes at 12 to 30 hpf. Three pooled experiments. Columns: 1, N=104; 2, N=41; 3, N=69; 4, N=69; 5, N=78; 6, N=70; 7, N=36; 8, N=19; 9, N=25; 10, N=29; 11, N=23; 12, N=22. (g-j) Animal pole view of relative pSmad1/5 intensities (AU) within each nucleus in representative early-gastrula embryos. (d and f) Embryos are oriented with the ventral (V) side to the left and the dorsal (D) side to the right. (e and g) Dorsal side of the embryo could not be identified due to loss of the shield structure with ventralization. (g) bmpr1a+/- embryo (N=5). (h) bmpr1a+/- embryo injected with ACVR1-R206H mRNA (N=5). (i) bmpr1a-/- embryo with acvr1l and bmpr1b KD (Type I KD embryo) (N=4). (j) Type I KD embryo injected with ACVR1-R206H mRNA (N=5). (k) Mean nuclear pSmad1/5 fluorescence of injected embryos. Each dot represents the mean fluorescence of an individual embryo. Mean and standard deviation of each condition (e-h) is shown. * indicates P<0.05, ns indicates no significance.

Both bmpr1aa+/+; ab-/- (bmpr1a+/+) and bmpr1aa+/-; ab-/- (bmpr1a+/-) embryos developed normally (Figure 5c,d,f column 1; Figure 5—figure supplement 1), but embryos null for both bmpr1aa and bmpr1ab (bmpr1a-/-) were severely dorsalized to a C4 phenotype (Figure 5e,f column 7; Figure 5—figure supplement 1). bmpr1b KD does not affect DV patterning of bmpr1a+/+ or +/- embryos (Figure 5f column 2; Figure 5—figure supplement 1), demonstrating that Bmpr1aa with Acvr1l is sufficient for signaling and patterning the zebrafish embryo. However, bmpr1b KD further dorsalized bmpr1a-/- embryos to a C5 phenotype (Figure 5f column 8; Figure 5—figure supplement 1). Embryos were severely dorsalized to a C5 phenotype by KD of bmpr1b and acvr1l (Figure 5f column 3; Figure 5—figure supplement 1) and Type I KD embryos were also dorsalized to a C5 phenotype (Figure 5f column 9; Figure 5—figure supplement 1). However, ACVR1-R206H was able to ventralize Type I KD embryos, indicating that it does not require its normal signaling partner, Bmpr1, to pattern the embryo (Figure 5f column 12; Figure 5—figure supplement 1). Similarly, ACVR1-G328R could ventralize Type I KD embryos, demonstrating it shares the ability to signal without Bmpr1 (Figure 5—figure supplement 2).

We examined how the pSmad1/5 gradient was affected in the injected embryos. ACVR1-R206H significantly increased the mean pSmad1/5 intensity compared to uninjected bmpr1a+/-sibling embryos (Figure 5g,h,k). Type I KD embryos lacked a pSmad1/5 gradient and had a significantly lower mean pSmad1/5 fluorescence than uninjected siblings (Figure 5i,k), demonstrating that loss of type I receptors results in loss of pSmad1/5 signaling. However, ACVR1-R206H significantly increased pSmad1/5 intensity in Type I KD embryos (Figure 5j,k), consistent with the observed ventralized phenotype. These data suggest that FOP-ACVR1 does not require BMPR1a or BMPR1b to phosphorylate Smad1/5 and that this mutant receptor does not require the presence of wild-type ACVR1-BMPR1 signaling complexes.

ΔACVR1-R206H signals in the absence of the type I Bmpr1 receptor

To test if ligand-independent FOP-ACVR1 signaling requires Bmpr1 or endogenous Acvr1l, we injected Type I KD embryos with mouse ΔAcvr1-R206H or Acvr1-R206H and evaluated DV patterning phenotypes at 30 hpf and dorsal marker expression in 5- to 9-somite stage embryos. Interestingly, like Acvr1-R206H (Figure 5; Figure 6a, Figure 6—figure supplement 1), ΔAcvr1-R206H also ventralized Type I KD embryos (Figure 6b column 8; Figure 6—figure supplement 1), indicating that ligand-independent ACVR1-R206H signaling also does not require other type I BMP receptors to signal in patterning the zebrafish embryo.

Figure 6 with 1 supplement see all
ΔACVR1-R206H signals in the absence of Bmpr1.

(a–b) Injected bmpr1a+/- or -/- 12 to 30 hpf embryo phenotypes with bmpr1b KD, acvr1 KD with or without Acvr1-R206H or ΔAcvr1-R206H mRNA. Two pooled experiments. (a) Acvr1-R206H injected embryos. Columns: 1, N = 150; 2, N = 80; 3, N = 98; 4, N = 89; 5, N = 76; 6, N = 36; 7, N = 31; 8, N = 30. (b) ΔAcvr1-R206H injected embryos. Columns: 1, N = 150; 2, N = 80; 3, N = 92; 4, N = 127; 5, N = 76; 6, N = 36; 7, N = 26; 8, N = 37. (c–i) Representative dorsal view of pax2.1 (white arrowheads: anteriorly in the midbrain-hindbrain boundary and posteriorly in the pronephric mesoderm), krox20 (black arrowheads; rhombomeres 3 and 5), and myod (black arrow; paraxial mesoderm) expression in 5–9 somite stage bmpr1a+/-or -/- embryos with bmpr1b KD, acvr1 KD with or without Acvr1-R206H or ΔAcvr1-R206H. Two independent experiments. Embryos are oriented with the anterior (A) side left and the posterior (P) side right. Number of embryos that showed expression patterns similar to the representative embryos out of the total number of embryos analyzed is shown. (c) bmpr1a+/- embryo (d) bmpr1a-/- embryo (e) bmpr1a-/-embryo with acvr1l and bmpr1b KD (Type I KD embryo) (f) Type I KD embryo injected with Acvr1-R206H mRNA. (g) Type I KD embryo injected with ΔAcvr1-R206H mRNA.

We additionally evaluated expression of two dorsal markers, pax2.1 and krox20, by whole-mount in situ hybridization. In wild-type 5- to 9-somite stage embryos, pax2.1 is expressed in the midbrain-hindbrain (MHB) boundary (Figure 6c, white arrowhead at anterior) and krox20 is expressed in rhombomeres 3 and 5 (Figure 6c, black arrowheads) (Thisse et al., 2001; Strähle et al., 1993; Krauss et al., 1991; Hashiguchi and Mullins, 2013). In bmpr1a-/- embryos, which develop to a C4 dorsalized phenotype, the MHB and rhombomere expression of pax2.1 and krox20, respectively, were expanded laterally (Figure 6d). In Type I KD embryos, which display a C5 dorsalized phenotype, pax2.1 and krox20 became radially expressed in the MHB and rhombomere 3 and 5 (Figure 6e). Acvr1-R206H mRNA injection rescued Type I KD embryos to a ventralized phenotype, characterized by dorsally restricted neural expression of pax2.1 and krox20 (Figure 6f) compared to Type I KD embryos. Injection of Type I KD embryos with ΔAcvr1-R206H mRNA, which lacks critical regions of the ligand-binding domain, similarly restricted expression of pax2.1 and krox20 to dorsal regions (Figure 6g). These data provide additional support that ligand-independent signaling by ACVR1-R206H also does not require Bmpr1a, Bmpr1b, or endogenous Acvr1l.

ACVR1-R206H responds to ligand in the absence of Bmpr1

Since ligand facilitates association of Acvr1 and Bmpr1 in the developing zebrafish (Little and Mullins, 2009), we next examined if FOP-ACVR1 requires other type I BMP receptors for its enhanced ventralizing activity in response to ligand. We expressed human ACVR1-R206H in Type I KD embryos that were either deficient in BMP (by overexpressing the BMP ligand-binding inhibitor Chordin) or overexpressing Bmp7. Embryos were evaluated for DV patterning and dorsal marker gene expression.

Overexpression of Chordin dorsalized embryos in both the presence and absence of Bmpr1 (Figure 7a columns 1 and 9; Figure 7—figure supplement 1). While Bmp7 overexpression ventralized embryos in the presence of Bmpr1a (Figure 7a column 3; Figure 7—figure supplement 1), Bmp7 had no effect on patterning in Bmpr1a-deficient or Type I KD embryos, as expected (Figure 7a column 11 and 13; Figure 7—figure supplement 1). The inability of Bmp7 to affect Bmpr1a-deficient embryos, while it ventralizes Bmpr1a+/-embryos (Figure 7a columns 3,10,11), attests to the strong Bmpr1 loss of function. As in Figure 5f, ACVR1-R206H ventralized embryos even in the absence of all other type I BMP receptors (Figure 7a, column 15; Figure 7—figure supplement 1). Comparatively, overexpression of Chordin inhibited ventralization by ACVR1-R206H with or without Bmpr1 (Figure 7a columns 6 and 14, compare to columns 7 and 15; Figure 7—figure supplement 1), consistent with reduced BMP pathway activity. Overexpression of Bmp7 enhanced ventralization by ACVR1-R206H with or without Bmpr1, consistent with increased signaling (Figure 7a, compare columns 8 and 16, to columns 7 and 15; Figure 7—figure supplement 1).

Figure 7 with 1 supplement see all
ACVR1-R206H responds to ligand in the absence of all other type I BMP receptors.

(a) 12–30 hpf phenotypes of bmpr1a+/-or -/- embryos with bmpr1b KD and acvr1l KD with or without ACVR1-R206H, with or without chordin (chd) mRNA or bmp7 mRNA. Four pooled experiments plus two experiments with controls only. Columns: 1, N = 172; 2, N = 160; 3, N = 106; 4, N = 135; 5, N = 104; 6, N = 121; 7, N = 169; 8, N = 117; 9, N = 32; 10, N = 91; 11, N = 17; 12, N = 57; 13, N = 29; 14, N = 28; 15, N = 49; 16, N = 49. (b–g) Representative dorsal view of pax2.1, krox20, and myod expression in 5–9 somite stage bmpr1a+/-or -/- embryos with bmpr1b KD, acvr1 KD, with or without ACVR1-R206H, and with or without chordin or bmp7 mRNA. Three experiments. Embryos are oriented with the anterior (A) side left and the posterior (P) side right. Number of embryos that showed expression patterns similar to the representative embryos out of the total number of embryos analyzed is shown. (b) bmpr1a +/- embryo (c) bmpr1a-/-embryo (d) bmpr1a-/-embryo with acvr1l and bmpr1b KD (Type I KD embryo) (e) Type I KD embryo injected with ACVR1-R206H and chd mRNA (f) Type I KD embryo injected with ACVR1-R206H mRNA (g) Type I KD embryo injected with ACVR1-R206H and bmp7 mRNA.

We next evaluated 5–9 somite stage embryos for pax2.1 and krox20 expression using in situ hybridization. Compared to bmpr1a+/+ and +/- embryos (Figure 7b, as in Figure 6c), bmpr1a-/-embryos displayed expanded neural expression of pax2.1 and krox20 (Figure 7c, as in Figure 6d) and Type I KD embryos had radialized expression of pax2.1 and krox 20 (Figure 7d, as in Figure 6e). Type I KD embryos co-injected with ACVR1-R206H and chordin mRNA had dorsally-restricted expression of pax2.1 and krox20 compared to Type I KD embryos (Figure 7d,e), although not as restricted as bmpr1a+/- embryos (Figure 7b), consistent with moderately dorsalized phenotypes. Type I KD embryos injected with ACVR1-R206H or co-injected with ACVR1-R206H and bmp7, expressed pax2.1 and krox20 in patterns similar to, or more dorsally-restricted than bmpr1a+/- embryos, consistent with rescue to wild-type or ventralized phenotypes (Figure 7f and g). These results suggest that ACVR1-R206H can respond to ligand in the absence of Bmpr1a, Bmpr1b, and endogenous Acvr1l.


Using an in vivo zebrafish model, a highly informative and sensitive vertebrate system for BMP signaling activity during DV patterning, we investigated the signaling mechanism of the ACVR1 type I BMP receptor and the effects of ACVR1 activating mutations that cause a rare genetic disorder of ectopic bone formation. We show that although wild-type ACVR1 requires its ligand-binding domain for signaling, the FOP-ACVR1 mutants, ACVR1-R206H and ACVR1-G328R, do not require a ligand-binding domain to over-activate pSmad1/5 signaling. However, these mutant receptors do retain the ability to respond to BMP and Activin A ligand when their ligand-binding domain is intact. We further show for the first time that Bmpr1, which is a required partner for signaling by WT Acvr1l, is dispensable for both ligand-independent and ligand-responsive signaling by mutant FOP-ACVR1. Our data support that the causative mutations of FOP allow the mutant receptor to bypass normal ligand-receptor complex assembly. This aberrant signaling highlights the importance of ligand-receptor complexes to facilitate and regulate signaling by ACVR1. Elucidation of FOP-ACVR1 signaling mechanisms not only provides insight into therapeutic targets for treating FOP, but also gives us unique insight into how BMP signaling is regulated.

Recent studies have shown that FOP-ACVR1 has acquired the ability to signal through pSmad1/5 in response to the TGFβ family ligand Activin A, which normally binds ACVR1b to signal through pSmad2/3 (Hatsell et al., 2015; Lees-Shepard et al., 2018; Hino et al., 2015). Our study confirms that ACVR1-R206H is able to respond to both its normal activating ligand, Bmp7, and to Activin A, in an in vivo model, demonstrating that FOP-mutant ACVR1 has an expanded repertoire of ligands to which it can respond. These data support a mechanism of over-active signaling induced by availability of multiple ligands for ACVR1-R206H. Interestingly, the magnitude of Bmp7 response by ACVR1-G328R appeared to be greater than that of ACVR1-R206H (Figure 3c,d). While multiple factors could be contributing to this observation, other studies have shown similar trends (Haupt et al., 2018), suggesting that the signaling mechanisms of the two mutants are not identical. An interesting next experiment would be to compare Activin A responses of ACVR1-R206H and -G328R in vivo.

In this study, we also demonstrate in an in vivo vertebrate system that neither Acvr1-R206H nor Acvr1-G328R require a ligand-binding domain to signal. Further supporting ligand-independent pathway activation, we showed that Acvr1-R206H and Acvr1-G328R are able to pattern the zebrafish embryo in the absence of their normal obligatory ligand, Bmp2/7 (Figure 3). This does not preclude the possibility that other components of an FOP-ACVR1 signaling complex play a role in binding ligands other than BMP. We show that Acvr1-R206H pSmad1/5 signaling also is inappropriately activated by Activin A in the zebrafish. By RNAseq and wholemount in situ hybridization, low levels of activin A expression are detectable in the prechordal plate during late gastrulation (75% epiboly) (Thisse et al., 2004; White et al., 2017), a stage later than our analysis of pSmad1/5 at early gastrulation (shield to 65% epiboly) (Figures 2 and 4d,e). However, another report detected low activin A expression during early gastrulation by RT-PCR (Hashiguchi et al., 2008), thus we cannot exclude Activin A as a factor in FOP-ACVR1 signaling in Figure 3. We show, however, that ligand-binding deficient ACVR1 does not respond to Bmp7 or Activin A ligand (Figure 4k–n), demonstrating that the ligand-binding domain of ACVR1-R206H is required for ligand response and FOP-ACVR1 does not require ligand to signal (Hildebrand et al., 2017).

Studies suggest that not only is ligand critical for normal type I receptor complex assembly, but ligand also mediates which receptors assemble together through differential ligand-receptor affinity (Yadin et al., 2016; Little and Mullins, 2009; Heinecke et al., 2009; Allendorph et al., 2007; Antebi et al., 2017). In zebrafish, Acvr1l and its type I BMP receptor partner Bmpr1 will not associate with each other and signal in the absence of appropriate ligands (Little and Mullins, 2009). Therefore, the ability of ACVR1-R206H and -G328R to signal in response to novel ligands suggests an acquired ability to signal in novel receptor complex combinations. Conversely, the ability of the mutant receptors to signal in the absence of an intact ligand-binding domain suggests an acquired ability to signal in the absence of normally-regulated complex formation. In the context of the developing zebrafish, these mutations decouple the activity of ACVR1 from its morphogen signal, Bmp2/7. Indeed, in this study, we also determined that ACVR1-R206H does not require its normal type I BMP receptor partner, Bmpr1, for its signaling activity.

We note that in our experimental system, residual maternal bmpr1aa mRNA remains in our bmpr1aa-/-, ab-/- mutants; however, the inability of Bmp7 overexpression to even partially rescue the C4 dorsalized phenotype of bmpr1aa-/-; ab-/- mutants or the C5 dorsalization of Type I KD mutants indicates that residual bmpr1aa+/- maternal transcript has little or no effect on DV patterning (Figure 5f). Further, the inability of Bmp7 overexpression to rescue Type I KD embryos suggests that any remaining receptor from our knockdown was not sufficient to contribute to DV patterning, indicating a severe loss of Type I receptor function.

The signaling activity that we observed in our ligand-binding mutant ACVR1 receptors may represent a baseline constitutive activity by ACVR1-R206H and -G328R in the absence of receptor complex assembly. All confirmed ACVR1 mutations in FOP are located within the GS or protein kinase domains and are theorized to alter receptor phosphorylation and, as a result, the activation energy required for ACVR1 to signal (Chaikuad et al., 2012; Shore and Kaplan, 2010). Previous studies have suggested that the FOP mutations weaken binding by the type I receptor inhibitor FKBP12, allowing for constitutive or ‘leaky’ signaling (Chen et al., 1997; Huse et al., 1999; Groppe et al., 2011). However, more recent evidence suggests that this loss of FKBP12 inhibition does not fully account for the level of increased activity displayed by the FOP mutant receptors (Machiya et al., 2018). In addition, ACVR1-R206H has been shown to require type II BMP receptors and GS domain activation to signal (Hino et al., 2015; Bagarova et al., 2013; Le and Wharton, 2012). In the absence of ligand-induced complex assembly with other receptors, GS domain activation of FOP-ACVR1 may occur by stochastic association with free type II BMP receptors. These data highlight that even more remains to be elucidated about the mechanism by which BMP receptor components assemble and coordinately regulate signaling.

Conversely, the Bmp7 and Activin A ligand-responsive activity that we observed by ACVR1-R206H and -G328R may reflect mutation-induced stabilization of signaling activity by ligand-facilitated receptor complex assembly. Under normal circumstances, WT Acvr1l is an obligate type I receptor partner with either Bmpr1a or Bmpr1b (Little and Mullins, 2009). Our results show that FOP-ACVR1 can respond to Bmp7 ligand without its normal type I BMP receptor partner, Bmpr1. These data suggest that ACVR1-R206H is either able to respond to ligand on its own or with novel receptor partners. An important future experiment would be to test if ACVR1-R206H requires Bmpr1 or other type I receptors to respond to Activin A.

In the absence of Bmpr1, ACVR1-R206H may homodimerize with itself to signal. BMPR1, although not ACVR1, has been shown to form inert pre-formed homodimer complexes that are poised to respond to ligand (Marom et al., 2011). ACVR1, however, normally binds ligand poorly on its own, indicating that this type I receptor may not easily associate or form stable complexes with ligand in the absence of other receptor partners (Heinecke et al., 2009). We also note that the type I BMP receptor, ACVRL1 (ALK1), was not targeted for knockdown in this study; however, expression studies show that ACVRL1 is not detectable by RNAseq until 75% epiboly, after the stage in which we see expanded pSmad1/5 signaling, and it is not detectable by in situ during the first 24 hr of development (Thisse et al., 2004; White et al., 2017). Our study, however, cannot exclude that low levels of ACVRL1 play a role in the ability of ACVR1-R206H to respond to Bmp7 in the absence of BMPR1. In our study, the type II BMP receptors are also present in the zebrafish embryo and may be sufficient to form a working signaling complex with FOP-ACVR1 as the only type I receptor and still respond to ligand. Previous reports have shown that both BMPR2, a type II receptor with high affinity for BMP ligand, and ACVR2a, a type II receptor with high affinity for Activin A, are required for signaling by ACVR1-R206H (Yadin et al., 2016; Hino et al., 2015; Walton et al., 2012), and an important next step would be to test this requirement in our in vivo system.

Recent studies have shown that TGFβR1 can associate with ACVR1 and initiate pSmad1/5 signaling (Ramachandran et al., 2018). TGFβR1 normally signals with TGFβR2 in response to TGFβ ligand, components with which ACVR1 is not known to associate. ACVR1b, the Nodal/Activin receptor, is also present in the zebrafish embryo. Notably, ACVR1b uses the same type II receptors, ACVR2a and ACVR2b, as ACVR1 to signal, although these complexes normally signal through pSmad2/3 rather than pSmad1/5. The ability of FOP-ACVR1 to signal in response to Activin A, may occur by signaling through components of the normal Activin signaling complex: ACVR1b and ACVR2. Our data show that if ACVR1 signals by complexing with Acvr1b, this was not sufficient to sequester Acvr1b and reduce pSmad2 signaling in our system (Figure 4t). We show that there is no significant difference in pSmad2 intensity in embryos injected with Activin A alone or with Acvr1-R206H. Much remains to be investigated to elucidate the mechanism of an ActivinA/ACVR1-R206H response.

The pathological significance of the ACVR1-R206H signaling modalities elucidated in this study remain to be further investigated. One possibility is that they represent two proposed modes of HO initiation in FOP patients: spontaneous and injury-induced. Ligand-independent basal activity of FOP-ACVR1 may lead to increasing levels of signaling within tissues and the initiation of spontaneous HO when a threshold is reached with no obvious acute inciting factor (Shore and Kaplan, 2010). Ligand-responsive hyperactivity may account for injury-induced HO, in which cascades of signaling in response to injury-induced ligands, including Activin A (Hatsell et al., 2015; Lees-Shepard et al., 2018; Hino et al., 2015), contribute to increased activity by FOP-ACVR1. It is important to note, however, that these two modes of HO initiation may not represent separate mechanisms, and ligand independent and responsive activation may play more nuanced roles in the pathogenesis of disease. Research to identify FOP treatment strategies has examined multiple drug targets in ACVR1 signaling including ligand binding and ACVR1 kinase activity (Cappato et al., 2018). Our data suggest that directly targeting the kinase activity of FOP-ACVR1 to inhibit both ligand independent and responsive signaling by the receptor would be a highly promising strategy for treatment.

Materials and methods

Key resources table
Reagent type
(species) or resource
DesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Danio rerio)bmpr1aap3/+This paperp3
Genetic reagent (Danio rerio)bmpr1absa0028ZIRCsa0028
Genetic reagent (Danio rerio)bmp7asb1aubSchmid et al., 2000sb1aub, RRID:ZFIN_ZDB-GENO-100415-21
Sequence-based reagentAlk 8 (Acvr1l) Morpholino 4Gene Tools LLCMO4-acvr1l (previously MO2-acvr1l)TGCCTTTCAGTATTCGCACAGCCAG
Sequence-based reagentAlk8 (Acvr1l) Morpholino 2Gene Tools LLCMO2-acvr1l (previously MO3-acvr1l)GATTCATGTTTGTGTTCAATTTCCG
Sequence-based reagentAlk6a (Bmpr1ba) Morpholino 1Gene Tools LLCMO1-bmpr1baAGAACTCCAGTGAGCCAGAGAATCC
Sequence-based reagentAlk6b (Bmpr1bb) Morpholino 1Gene Tools LLCMO1-bmpr1bbACTGCTCCACAGCTACTCCACACTG
Recombinant DNA reagentHuman ActivinA (plasmid)OrigeneCat #RC203226
INHBA, inhibinβa, ActivinA
Cloned into pCS2 backbone
Recombinant DNA reagentZebrafish bmp7a (plasmid)Schmid et al., 2000bmp7aCloned into pCS2 backbone
Recombinant DNA reagentZebrafish chordin (plasmid)Miller-Bertoglio et al., 1997chdCloned into pCS2 backbone
Recombinant DNA reagentHuman ACVR1 (plasmid)The Shore Lab. This Paper.Shen et al., 2009ACVR1Cloned into pCS2 backbone
Recombinant DNA reagentHuman ACVR1-R206H (plasmid)The Shore Lab. Shen et al., 2009ACVR1-R206HCloned into pCS2 backbone
Recombinant DNA reagentHuman ACVR1-G328R (plasmid)The Shore Lab. This Paper.(Shore et al., 2006).ACVR1-G328RCloned into pCS2 backbone
Recombinant DNA reagentMouse Acvr1 (plasmid)Haupt et al., 2014Cloned into pCS2 backbone
Recombinant DNA reagentMouse Acvr1-R206H (plasmid)Haupt et al., 2014p.R206HCloned into pCS2 backbone
Recombinant DNA reagentMouse Acvr1-G328R (plasmid)Haupt et al., 2014p.G328RCloned into pCS2 backbone
Recombinant DNA reagentMouse ΔAcvr1 (plasmid)Haupt et al., 2014ΔLBD-Acvr1Cloned into pCS2 backbone
Recombinant DNA reagentMouse ΔAcvr1-R206H (plasmid)Haupt et al., 2014ΔLBD-Acvr1Cloned into pCS2 backbone
Recombinant DNA reagentMouse ΔAcvr1-G328R (plasmid)Haupt et al., 2014ΔLBD-Acvr1Cloned into pCS2 backbone
AntibodyAnti-pSmad1/5/8 (rabbit monoclonal)Cell SignalingCat #13820
IF (1:200)
AntibodyAnti-pSmad2/3 (rabbit monoclonal)Cell SignalingCat #8828, RRID:AB_2631089IF (1:800)
AntibodyAnti-Beta catenin (mouse monoclonal)SigmaCat #C7207, RRID:AB_476865IF (1:1000)
AntibodyAnti-HA (rabbit polyclonal)InvitrogenCat #71–5500, RRID:AB_87935IF (1:500)
AntibodyAnti-Flag (rabbit polyclonal)SigmaCat #F7425, RRID:AB_439687IF (1:500)
AntibodyAnti-rabbit Alexa 647 (goat polyclonal)InvitrogenCat #A-21245, RRID:AB_2535813IF (1:500)
AntibodyAnti-mouse Alexa 594 (goat polyclonal)Molecular ProbesCat #A21123, RRID:AB_141592IF (1:500)
OtherSytox greenFisherCat #S7020IF (1:2000)
Sequence-based reagentpax2.1 zebrafishin situ probeKrauss et al., 1992
Sequence-based reagentkrox20 zebrafishin situ probeOxtoby and Jowett, 1993
Sequence-based reagentmyod zebrafishin situ probeWeinberg et al., 1996
Commercial assay, KitmMESSAGE mMACHINE
SP6 Transcription Kit
ThermoFisherCat #AM1340
Software, algorithmFiji (ImageJ)Fijihttps://fiji.sc/#download
Software, algorithmImarisOxford InstrumentsImaris 9.6https://imaris.oxinst.com/


Procedures involving animals were approved by the University of Pennsylvania IACUC. Adult zebrafish were kept at 28°C in a 13 hr light/11 hr dark cycle. All zebrafish husbandry was performed in accordance with institutional and national ethical and animal welfare guidelines. The characterized mutant bmp7asb1aub (bmp7-/-) (Schmid et al., 2000) and bmpr1aap3/+; bmpr1ab sa0028 (bmpr1aa+/-;bmpr1ab-/-) were used in this study. bmp7sb1aub fish were maintained as homozygous mutant stocks by rescuing the C5 dorsalized embryonic phenotype with bmp7 mRNA injection. bmpr1aa+/-; bmpr1ab-/-fish were generated by intercrossing and genotyping for the bmpr1aa allele (described below). Embryos used in these experiments were 0–48 hpf. Embryos were maintained at 28–32°C in E3 solution. Sex/gender was not accounted for as zebrafish sex determination takes place later, during juvenile stages of development (Santos et al., 2017).

CRISPR generation and identification of bmpr1aa mutant allele

Request a detailed protocol

A mutant allele of bmpr1aa (bmpr1aap3) in the zebrafish was generated using CRISPR-Cas9 mutagenesis. The target site GGTATAAGTGGCAGACAGAG in exon 8 (out of 13) in the kinase domain, was selected with the assistance of the web tool CHOPCHOP (https://chopchop.cbu.uib.no). Single guide RNAs (sgRNAs) were designed to utilize the T7 Promoter. sgRNAs were synthesized in-vitro from PCR amplified templates using the cloning-free method of Gagnon et al., 2014 with the following changes: sgRNA templates were amplified using Phusion Polymerase 40 uL reaction (ThermoFischer F553S). sgRNA templates were purified after amplification using the MinElute purification kit (QIAGEN 28004). sgRNAs were synthesized from the templates in vitro using the MEGAshortscript T7 kit (ThermoFischer AM1354). Megashortscript reactions were run overnight rather than the recommended 2–4 hr, as this was found to increase yield. sgRNA was purified post synthesis using the ethanol precipitation protocol from Gagnon et al., 2014. Purified sgRNAs were assessed and quantified visually by running a dilution series on a glyoxal/sodium phosphate buffer RNA gel and comparing to RiboRuler (ThermoFischer SM1821), as the Nanodrop was found to be an unreliable to quantify these guide RNAs.

Immediately prior to injection, 2.5 µL of undiluted sgRNA were mixed with 1 µl of 5 mg/mL Cas9-NLS protein (PNA Bio CP01-50), 1 µl of Phenol Red, and 0.5 µl 1M KCl (total volume 5 µl), this solution was kept at room temperature for the duration of the injection. This mixture was injected in volumes of 2 nl into wild type and bmpr1absa0028 embryos.

CRISPR efficiency was assessed using High-Resolution Melt Analysis (HRMA) (Dahlem et al., 2012). At 48 hpf, a subset of the injected embryos was sacrificed for HRMA. HRMA was performed using the MeltDoctor HRM master mix (ThermoFischer 4415440). Embryos from injections with greater than 50% efficiency were raised to adulthood, and outcrossed to WT or bmpr1ab-/- fish. 12 embryos from each outcross were sacrificed for Sanger Sequencing. DNA was isolated from lysed embryos and the target sequence was amplified with PCR. Products from these PCR reactions were purified using the Qiaquick PCR purification kit (Qiagen 28106). Purified PCR products were quantified via Nanodrop and sequenced by the University of Pennsylvania Sequencing core by Sanger sequencing. Mutant alleles were identified by directly reading trace data using Lasergene SeqMan Pro.

A mutant allele with a 53 base pair deletion and a 29 base pair insertion, which includes the exon eight splice acceptor site was identified. Siblings of allele-carrying embryos were raised to adulthood, genotyped, and in-crossed. In the bmpr1ab-/- background, homozygous mutants display a C4 phenotype. Mutant embryos were re-sequenced to confirm the allele sequence. RNA was later isolated from homozygous mutant embryos at 12 hpf, a stage at which they could be identified phenotypically, using Trizol (ThermoFischer 15596026), and reverse transcribed to create cDNA using the SuperScript II kit (ThermoFischer 18064014). The bmpr1aa transcript was amplified by PCR, sequenced and compared to WT transcript. Sequence analysis revealed that the mutation lead to the inclusion of the intron between exons 7 and 8, which contains a premature stop codon.

CRISPR template synthesis oligos:



  • HRMA primers



Target site Sequencing Primers:

  • Amplification Forward Primer: CCTGTTTTTCCACATCACTGAA

  • Amplification Reverse Primer: TAGAGGCTCCTGTGCCATTTAT


Mutant Allele Sequence:


  • Mutant sequence (inserted bases in bold):



Request a detailed protocol

Adult and embryonic genomic DNA was obtained using HotShot DNA isolation. Genotyping of adults and embryos for bmpr1aa was performed using KASPar genotyping (Smith and Maughan, 2015). Primers were designed and synthesized by LGC Bioscience Technologies. The following sequence was submitted for primer design: ATAAGAGGAGTCAGGAGTGATCTCTTTAACATCAAGGATA[CNAAAAAAACAGCTTTGACTGTGTTTTGTCATCAGGTATAAGTGGCAGACAGA/GTCCGTTATCAACTTGAAAAAGTGGCACC]GAGGCAGCGCTACCACAGAGACCTGGAGCAAGACGAGGCCTTTATCCCAGCAGGAGAATCCCTGAAAGA (Primer sequences are proprietary, LGC Biosearch technologies). Immunostained embryos were recovered after photographing and placed in methanol prior to Hotshot and KASPar genotyping. Alternatively, bmpr1aa mutant fish were genotyped by conventional PCR using Choice Taq Blue Mastermix (Denville CB4065-7), and the aforementioned HRM primers.

mRNA synthesis

Request a detailed protocol

Human, mouse, or zebrafish ACVR1 cDNAs were cloned into the pCS2+ expression vector. Mouse Acvr1 constructs contained an HA tag inserted after amino acid M34. ΔAcvr1 constructs contained a 64 amino acid deletion (C35-C99) within the extracellular domain (Haupt et al., 2014). Human ACVR1 constructs all contained a C-terminal Flag tag. mRNA was synthesized using SP6 mMessage machine kit (Sigma Aldrich) and purified using phenol:chloroform extraction. The mRNA was stored in nuclease-free water at −80°C.

Microinjection of one-cell stage zebrafish embryos

Request a detailed protocol

Eggs at 0–15 min post fertilization were collected in E3 media and injected at 22°C. For each experiment, each mRNA was injected into eggs with the same calibrated needle. For serial injections, eggs were loaded onto the same plate and injected with the first mRNA or morpholino, a subset were then set aside for controls and the remainder were injected with the next mRNA or morpholino. This process was repeated multiple times in different orders to ensure consistency between experimental and control conditions. Injection concentrations of each mRNA were determined based on phenotypic evaluation. In cases in which multiple mRNA syntheses were used, different mRNA concentrations were used to achieve the same phenotype due to presumed inconsistent mRNA 5’ capping. Working concentrations of mRNA based on Nanodrop spectrometer measurements: 2.5–200 pg mAcvr1 and ΔmAcvr1 mRNAs, 65–250 pg hACVR1 mRNAs, 1 ng chordin mRNA, 200 pg bmp7 for rescue of bmp7-/- to a wildtype phenotype, 500 pg-1 ng of bmp7 was used for overexpression experiments, 5–10 pg of Activin A mRNA. Morpholinos were synthesized by Gene Tools LLC and reconstituted in Daneaue solution at 25 mg/ml. A morpholino mixture of 2.3 ng Alk8MO4 (5’TGCCTTTCAGTATTCGCACAGCCAG3’) and 9.2 ng Alk8MO2 (5’GATTCATGTTTGTGTTCAATTTCCG3’) was used to knockdown endogenous acvr1l. To knock down all the type I BMP receptors, 17 ng Alk8MO2 was co-injected with a mixture of 5 ng Alk6aMO1 (5’AGAACTCCAGTGAGCCAGAGAATCC3’) and 2 ng Alk6bMO1 (5’ACTGCTCCACAGCTACTCCACACTG3’). All morpholinos bind independent sequences upstream of their target gene start sites to inhibit translation (Little and Mullins, 2009; Bauer et al., 2001).

Phenotypic evaluation

Request a detailed protocol

Embryos between 12 to 48 hpf were categorized into dorsoventral patterning phenotypes (Figure 1g). All images of embryos were photographed in E3 media with a Leica IC80HD. Injection results and controls from multiple experiments were then pooled. Phenotype pictures were corrected with background subtraction using ImageJ, and white balanced using Adobe Photoshop. Embryo bubble graphs were generated by pooling total numbers of embryos within each phenotypic category (C5-V5, Figure 1g) in each condition. These numbers were converted into percent of total embryos to generate the bubble graphs using excel bubble graph. (Figure 1—source data 1, Figure 1—figure supplement 2—source data 1, Figure 3—source data 1, Figure 5—source data 1, Figure 5—figure supplement 2—source data 1, Figure 6—source data 1, Figure 7—source data 1).


Request a detailed protocol

P-Smad1/5 immunostaining and imaging were performed as previously described (Zinski et al., 2017; Zinski et al., 2019). For all immunostaining, embryos were fixed in 4% formaldehyde in PBST between shield stage and 60% epiboly (approximately 6–7 hpf), blocked with 10% FBS in PBST, and probed overnight at 4°C with a 1:200 dilution of anti-PSmad1/5/9 (Cell Signaling 13820). Embryos were then treated overnight at 4°C with a 1:500 dilution of antibody Alexa 647 (Invitrogen A-21245) and 1:2000 of Sytox green (Fisher S7020) diluted in blocking solution. Stained embryos were stored in the dark at 4°C in PBST for up to 2 months.

P-Smad2 immunostaining was performed as described for P-Smad1/5 immunostaining with the following changes: Primary antibody used was anti-PSmad2/3 (1:800; Cell Signaling 8828), embryos were dehydrated in MeOH after fixing, rehydrated embryos were incubated in Acetone at −20C prior to blocking.

Receptor tag immunostaining was performed as described for P-Smad1/5. Primary antibodies used were: 1:200 of anti-HA (Invitrogen 71–5500) or 1:200 of anti-Flag (Sigma F7425), and 1:1000 of anti-beta-Catenin (Sigma C7207) diluted in blocking solution. Secondary antibodies used were: 1:500 of Alexa 546 (Molecular Probes A21123), and/or 1:2000 of Sytox green (Fisher S7020).

Immunofluorescence imaging and analysis

Request a detailed protocol

Prior to imaging, immunostained embryos were gradually dehydrated in MeOH and then cleared using BABB: a 1:2 ratio of benzyl alcohol (Sigma B-104) and benzyl benzoate (Sigma B-6630). Whole embryos were mounted with the DV axis parallel to the cover slip (either animal pole up or down). Imaging was performed using a Ziess LSM880 confocal microscope with an LD LCI Plan-Achromat 25X/0.8 lmm Corr DIC M27 multi-immersion lens in the oil-immersion setting. A single bead from a calibration slide (ThermoFisher Scientific Cat#F369009, Well A1) was imaged between each slide of embryos to account for fluctuations in power of the 633 nm laser over time (This laser was used for detecting pSmad1/5, pSmad2, or HA/Flag). Immunoflourescence was performed as described in Zinski et al., 2017 for pSmad2 immunostained embryos in Figure 2 and pSmad1/5 Immunostained embryos in Figure 4. pSmad1/5 immunostained embryos in Figures 2 and 5 were imaged with the following changes: embryos were imaged in a single ~567×567 μm frame and pixel dwell time was reduced to 0.77μsec. Receptor HA and Flag tagged embryos were imaged at 63x. Images of receptor stains were taken approximately 18 μm from the outer yolk syncytial layer of the embryo in a ~ 225×225 μm frame (Figure 1a). Quantitative receptor tag images were taken by imaging 16 2.2 μm stacks starting at the apical end of the embryo in a ~ 225×225 μm frame (Figure 1—figure supplement 2).

Embryo immunofluorescent intensity for pSmad1/5, pSmad2 or HA/Flag was normalized to a calibration bead imaged at the same time. Mean fluorescence of each fluorescent bead stacked image was measured using Imaris statistical analysis. Fold change in mean fluorescence was then calculated for each bead compared to a reference bead that was imaged immediately after an uninjected embryo was imaged. The fold change in mean fluorescence was then applied to the total fluorescence of each experimental-imaged embryo using the ImageJ multiply function.

For pSmad1/5 and pSmad2 immunostained embryos, calibrated Images were analyzed using the Imaris software spots function which identifies each nucleus within the immunostained embryo using the Sytox green nuclear stain and refined based on quality. Spot quality threshold is set using a control image to allow the program to detect all nuclei without detecting fluorescent points that are not nuclei, and then refined by eye (Figure 2—source data 2, Figure 4n—source data 2, Figure 4t—source data 2, Figure 5—source data 3). The Imaris program was then used to color each spot based on mean relative pSmad1/5 or pSmad2 (Alexa 647) intensity (AU) within the spot.

For HA immunostained embryos, calibrated embryos were analyzed using the Imaris software surfaces function to detect the area stained by β-catenin. The total HA flourescence was then measured within the area of β-catenin and the fluorescence per μm2 was calculated (Figure 1—figure supplement 2—source data 2).

Statistical analysis

Request a detailed protocol

For pSmad1/5 and pSmad2 immunostained embryos, mean fluorescence was calculated for all individual nuclei within each embryo using the Imaris spots function, as described above. For each embryo, nuclei that fell outside 1.8 times the interquartile range were removed. The mean of the remaining nuclei was calculated to generate a mean nuclear pSmad1/5 or pSmad2 fluorescence for each embryo. Mean nuclear fluorescence was then compared using a two-tailed T-test assuming unequal variance (Figure 2—source data 1, Figure 4n—source data 2, Figure 4t—source data 2, Figure 5—source data 2).

For receptor tag immunostained embryos, HA fluorescence per μm2 calculated values that fell outside 1.8 times the interquartile range were excluded. HA fluorescence per μm2 was also compared by a two-tailed T-test assuming unequal variance (Figure 1—figure supplement 2—source data 2).

Representative embryos in all figures were selected from the three embryos closest to the mean fluorescence of the group, using embryos without any significant tears or defects.

In situ hybridization

Request a detailed protocol

Whole mount in situ hybridizations were performed on fixed 5–9 somite stage embryos using DIG-labeled anti-sense RNA probes (made with labeling kit: Roche 11277073910) to pax2.1, krox20, and myod. Probes were visualized with anti-DIG-Alkaline Phosphatase (Roche11093274910) and developed in BM Purple (Roche 11442074001). Embryos were mounted on agarose in methanol and photographed with a Leica IC80HD. Images were processed using image J. After imaging, embryos were collected in MeOH for genotyping. pax2.1 and krox20 expression patterns were categorized as completely radialized (as in a C5 embryo), expanded compared to wild-type, similar to wild-type, or restricted compared to wild-type. A representative embryo was chosen from the category most represented in each condition.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided for Figures 1, 3, 4, 5, 6, Figure 1-figure supplement 2, and Figure 5-figure supplement 2.


    1. Bauer H
    2. Lele Z
    3. Rauch GJ
    4. Geisler R
    5. Hammerschmidt M
    The type I serine/threonine kinase receptor Alk8/Lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo
    Development 128:849–858.
    1. Dick A
    2. Hild M
    3. Bauer H
    4. Imai Y
    5. Maifeld H
    6. Schier AF
    7. Talbot WS
    8. Bouwmeester T
    9. Hammerschmidt M
    Essential role of Bmp7 (snailhouse) and its prodomain in dorsoventral patterning of the zebrafish embryo
    Development 127:343–354.
    1. Green JB
    2. Smith JC
    3. Gerhart JC
    Slow emergence of a multithreshold response to activin requires cell-contact-dependent sharpening but not prepattern
    Development 120:2271–2278.
    1. Krauss S
    2. Johansen T
    3. Korzh V
    4. Fjose A
    Expression of the zebrafish paired box gene Pax[zf-b] during early neurogenesis
    Development 113:1193–1206.
    1. Mintzer KA
    2. Lee MA
    3. Runke G
    4. Trout J
    5. Whitman M
    6. Mullins MC
    Lost-a-fin encodes a type I BMP receptor, Alk8, acting maternally and zygotically in dorsoventral pattern formation
    Development 128:859–869.
    1. Schmid B
    2. Fürthauer M
    3. Connors SA
    4. Trout J
    5. Thisse B
    6. Thisse C
    7. Mullins MC
    Equivalent genetic roles for bmp7/snailhouse and bmp2b/swirl in dorsoventral pattern formation
    Development 127:957–967.
  1. Book
    1. Thisse B
    2. Pflumio S
    3. Fürthauer M
    4. Loppin B
    5. Heyer V
    Expression of the Zebrafish Genome During Embryogenesis ZFIN Direct Data Submission
    Science Open.
    1. Weinberg ES
    2. Allende ML
    3. Kelly CS
    4. Abdelhamid A
    5. Murakami T
    6. Andermann P
    7. Doerre OG
    8. Grunwald DJ
    9. Riggleman B
    Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos
    Development 122:271–280.

Decision letter

  1. Cheryl Ackert-Bicknell
    Reviewing Editor; University of Colorado, United States
  2. Kathryn Song Eng Cheah
    Senior Editor; The University of Hong Kong, Hong Kong
  3. Petra Knaus

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Fibrodysplasia Ossificans Progressiva (FOP) is a rare, but devastating genetic disease wherein connective tissue is turned to bone, progressively restricting movement by the patient. Mutations in the ACVR1 gene are causative for FOP, but many questions are unanswered about how connective tissue is turned to bone in this disease. In this study, a zebrafish embryonic patterning assay was used demonstrate that the FOP causing mutations in ACVR1 result in a receptor that can both respond to the normal ACVR1 ligand, non-normal ligands and can also act independent of ligand to mediate signaling. The authors also show that normal obligatory ACVR1 binding partners are not needed for signaling by this ACVR1 mutant receptor. This work represents a significant step forward in our understanding of the initiating steps that proceed the formation of bone outside of the skeleton in FOP.

Decision letter after peer review:

Thank you for submitting your article "FOP-ACVR1 Signals by Multiple Modalities in the Developing Zebrafish" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editors and Kathryn Cheah as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Petra Knaus (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.


Fibrodysplasia ossificans progressiva (FOP) is a very rare disease caused by mutations in the ACVR1 gene. This gene codes for a type I BMP/TGFβ receptor which signals via pSMAD1/5. There are two separate mutations that lead to FOP, R206H and G328R, both of which are activating mutations. This study, a zebrafish DV patterning assay is used to interrogate the mechanism by which ACVR1 mutants R206H and G328R promote canonical SMAD1/5-mediated signaling responses. Both FOP mutants with deletions in ligand binding domain were found to overactivate BMP/SMAD1/5-induced DV patterning. Moreover, whereas WT ACVR1 critically depends on BMPR1 for DV patterning, the data presented suggest that BMPR1 is dispensable for both BMP7-dependent and independent signaling by the ACVR R206H mutant. This latter finding is highly novel and considered the largest strength of this study.

Overall, this is well presented and coherently written paper. The introduction does a fantastic job of setting up the study. The experiment follows a logical order and the prior literature is considered both in the experimental design and interpretation of the results. The conclusions of this study are interesting and provocative, but in several instances, it was felt that these were overstated. Some additional experiments were requested by the reviewers and it was unanimously considered that these were essential for this manuscript to be accepted.

Essential revisions:

1) The concept of decreased/dispensability of ligand binding domain ACVR1 with FOP or constitutively active mutation were reported before by Haubt et al., 2014 using in vitro cultured cells. Allen et al., now validate and extend these previous results using in vivo zebrafish assays (as measured by DV patterning, pSMAD1/5 IF imaging and dorsal marker ISH staining). To extend the previous findings in vivo is an important step forward, but becomes even more stronger when complemented with in vitro culture/transfection experiments that are more easier to control and quantitate. The most novel finding by Allen et al., that the ΔACVR1-R206H can signal in the absence of all other type I receptors needs to be shown in in vitro cultured cells using BRE-luc and pSMAD1/5 assays and include (cell surface) expression controls (or lack thereof) for receptors. This experiment was considered essential by all reviewers.

2) The authors use mouse ALK2 for their studies in zebrafish. Mouse ALK2 differs quite a lot from Zebrafish ALK2 (the latter was first described in the literature as a novel type I receptor, ALK8). Would the authors have gotten the same results if Zebrafish ALK2 constructs would have been used; do mouse and zebrafish ALK2 form equally efficient complexes with endogenous zebrafish BMP type I and type II receptors? Or is it actually an advantage to use mouse ALK2 as it allows for better insights into role of mutated ALK2 in FOP, and uncouple it from effects from endogenous zebrafish activin ligands? It is unclear if mouse BMP7 or zebrafish BMP7 expression construct was used in their study.

3) FOP ALK2 mutants can mediate Activin-induced SMAD1/5 response. From that perspective it would have been interesting to examine the effect of Actin ectopic (instead of BMP7) expression. Is the response of ΔAcvr1-R206H also not responsive to activin?

4) All data was performed in zebrafish embryos in which WT and mutant receptors are likely overexpressed. Authors do not provide information whether the expression levels of ectopic receptor are comparable to that of endogenous receptors. Can the authors exclude the possibility that the observed results are not an artifact of overexpression?

5) The authors state that ACVR1-R206H is able to signal in the absence of all other BMP type I receptors. This is an overstatement, and needs to be corrected. Morpholinos are used, which will never completely deplete BMP receptor expression. In the experiments residual maternal BMP receptor expression is still present. ALK1 is also a BMP type I receptor that was not targeted for depletion by the authors.

6) Figure S3. Primary (imaging) data that ACVR-R206H is responsive to BMP7 ligand needs to be included. Include statistical analysis of the IF imaging data shown in Figure 2 and Figure 4.

7) The bubble graphs are an efficient manner of presenting the data. That said, can a legend or scaling system be devised such that we know what percent each sized bubble represents? This would aid with data transparency.

8) Figure 1I, column 5… this is only an incomplete rescue, not a full rescue as is stated in the text. This should be clarified.

9) It is difficult to see that there is indeed a gradient in Figure 2D,D’,E,E’. Can this be quantified in any way, both to see how reproducible this was and to make the read-out less subjective. A second concern is that the images for the FOP mutants are over saturated obscuring the pattern.

10) Using DV patterning assays in zebrafish embryos the group has convincingly shown that both Acvr1-R206H and Acvr1-G328R, two FOP mutants, are able to rescue an acvr1l deletion mutant, even when the ligand binding site is deleted. This is not seen in the corresponding wt-deletion mutant. In animal pole view experiment, in which pSMAD1/5 was measured, the ligand independent effects were confirmed. Here it would be of interest to also show data on pSMAD2/3 as it was suggested before that FOP-mutant receptors induce both branches of SMAD signaling. The authors should address this with the same assay shown in Figure 2. This experiment was considered essential by all reviewers.

11) Please explain the differences for R206H as compared to G328R in Figure 2: Δ-R206H acts stronger in the KD (e, e'), while Δ-G328R works stronger in the wt setting (g, g'). Is this statistically significant? What is the explanation for these differences?

12) The authors write in subsection “ACVR1-R206H signals in the absence of all other Type I BMP receptors”: "Therefore, the ability of FOP-ACVR1 to signal independently of ligand suggests the possibility of signaling in the absence of receptor complex partners as well." This statement is interesting; however, the absence of receptor complex partners is not the only explanation for this observation. In particular, the authors should refer to and/or address the role of the low affinity receptor for BMP (BMPR2) or the high affinity receptor for Activin (ActR2) in this context. The data on the contribution of BMPR1a and BMPR1b however are convincingly shown and important as they give evidence that for the ligand-independent signaling by the FOP-mutant receptor, none of these type 1 receptors are required. It would be however important to mention the expression of other type 1 receptors such as ALK4 and ALK5 as potentially compensating receptors. This is of particular importance also for point 1 (SMAD2/3 signaling), mentioned above.

13) The authors continued to show, that Acvr1-R206H responds to BMP7 in the absence of BMPR1A and BMPR1B. It would be of particular interest to extend this also to other ligands. While testing all ligands is beyond the scope of this paper, this topic should be addressed in the discussion as potential needed future work and or in context with that which is already know.

14) In the Discussion section the authors write: "….further suggests it does not have the ability to bind ligand, and therefore does not need ligand to signal." This is a strong statement, in particular, as others have shown that Activin binding to the mutant receptors leads to increased SMAD signaling. How do the authors explain these controversial findings?


Author response


Fibrodysplasia ossificans progressiva (FOP) is a very rare disease caused by mutations in the ACVR1 gene. This gene codes for a type I BMP/TGFβ receptor which signals via pSMAD1/5. There are two separate mutations that lead to FOP, R206H and G328R, both of which are activating mutations. This study, a zebrafish DV patterning assay is used to interrogate the mechanism by which ACVR1 mutants R206H and G328R promote canonical SMAD1/5-mediated signaling responses. Both FOP mutants with deletions in ligand binding domain were found to overactivate BMP/SMAD1/5-induced DV patterning. Moreover, whereas WT ACVR1 critically depends on BMPR1 for DV patterning, the data presented suggest that BMPR1 is dispensable for both BMP7-dependent and independent signaling by the ACVR R206H mutant. This latter finding is highly novel and considered the largest strength of this study.

Overall, this is well presented and coherently written paper. The introduction does a fantastic job of setting up the study. The experiment follows a logical order and the prior literature is considered both in the experimental design and interpretation of the results. The conclusions of this study are interesting and provocative, but in several instances, it was felt that these were overstated. Some additional experiments were requested by the reviewers and it was unanimously considered that these were essential for this manuscript to be accepted.

Essential revisions:

1) The concept of decreased/dispensability of ligand binding domain ACVR1 with FOP or constitutively active mutation were reported before by Haubt et al., 2014 using in vitro cultured cells. Allen et al., now validate and extend these previous results using in vivo zebrafish assays (as measured by DV patterning, pSMAD1/5 IF imaging and dorsal marker ISH staining). To extend the previous findings in vivo is an important step forward, but becomes even more stronger when complemented with in vitro culture/transfection experiments that are more easier to control and quantitate. The most novel finding by Allen et al. that the ΔACVR1-R206H can signal in the absence of all other type I receptors needs to be shown in in vitro cultured cells using BRE-luc and pSMAD1/5 assays and include (cell surface) expression controls (or lack thereof) for receptors. This experiment was considered essential by all reviewers.

As noted by the reviewers, ligand-independent signaling through FOP ACVR1 has been reported previously, however some in the field have not found the reported in vitro data to be fully convincing that this is an established mechanism of action for the mutant ACVR1 receptor. Therefore, our in vivo studies are an important advance in understanding FOP and the mechanisms of BMP receptor regulation and moving the field forward.

We agree with the reviewers that the suggested additional in vitro experiments would provide additional in vitro evidence to support our in vivo data, and in response to the reviewers we designed experiments to conduct these studies. We had planned to initiate these experiments in April, however, our labs were closed in mid-March in response to the COVID-19 pandemic. We gained limited access to our labs in mid-June, just this week transitioning from 20% occupancy. At this time, our cell culture facilities are not fully operational and we still do not have the ability to conduct these experiments. Once we are able to access the facility, we expect these experiments would take a minimum of three months to complete. In addition, the first author of this paper has re-entered her clinical year of veterinary school as part of her dual VMD-PhD program, and has limited access to the lab at this time. And while we agree that performing these experiments in in vitro cell culture would extend these studies, we believe the added controls and quantitation of our in vivo data in this revision are very strong and compelling independently of repeating the work in cell culture.

In particular, we would like to address the concern that our in vivo data are not as well controlled or quantifiable as cell culture. With the reviewer’s suggestions, we have added quantification of pSmad1/5 signaling in our immunostained embryos and performed statistical analysis on these data (Figure 2H, Figure 4N,T and Figure 5K). We hope they demonstrate the power of our system in detecting changes in signaling intensity by BMP receptors. In addition, we have further clarified in the body of the text our use of reproducible pSmad1/5 signaling-dose dependent phenotypes to verify knockdown of different receptors in our system (Results section and Discussion section). bmp7 mRNA overexpression in an embryo normally over-activates pSmad1/5 signaling resulting in a ventralized phenotype (V1-5). Acvr1l KD produces the most dorsalized phenotype, C5, and cannot be rescued by bmp7 mRNA overexpression, demonstrating that this receptor is necessary for signaling, and knockdown was sufficient to prevent response to Bmp7 ligand. In one of our experiments, the knockdown was not complete in all embryos; we have repeated this experiment to obtain complete knockdown (Figure 1E,F,G). These data are further supported by our pSmad1/5 immunostaining results showing Acvr1l KD results in loss of pSmad1/5 signaling that cannot be rescued by bmp7 overexpression. Bmpr1b KD has no effect on wildtype fish, but consistently dorsalizes bmpr1a-/- fish to a C5 phenotype even in the presence of endogenous Bmp7, indicating that knockdown eliminated pSmad1/5 signaling. We recognize that we previously did not thoroughly explain these and other controls in the manuscript, and this is now added.

2) The authors use mouse ALK2 for their studies in zebrafish. Mouse ALK2 differs quite a lot from Zebrafish ALK2 (the latter was first described in the literature as a novel type I receptor, ALK8). Would the authors have gotten the same results if Zebrafish ALK2 constructs would have been used; do mouse and zebrafish ALK2 form equally efficient complexes with endogenous zebrafish BMP type I and type II receptors? Or is it actually an advantage to use mouse ALK2 as it allows for better insights into role of mutated ALK2 in FOP, and uncouple it from effects from endogenous zebrafish activin ligands? It is unclear if mouse BMP7 or zebrafish BMP7 expression construct was used in their study.

This study uses both mouse and human ACVR1 (ALK2). Zebrafish Acvr1l (ALK8) has 69% identity with the amino acid sequence of human ACVR1 overall and 85% identity in the intracellular domain. We chose to use mouse and human ACVR1 because of their greater relevance to the human disease, Fibrodysplasia ossificans progressiva. Both mouse and human WT-ACVR1 are able to rescue loss of endogenous zebrafish Acvr1l, showing that they can replace its function, including its role in the BMP receptor complex. This is further supported in our studies by the ability of both mouse and human WT-ACVR1 to respond to zebrafish Bmp7 (Figure 3).

3) FOP ALK2 mutants can mediate Activin-induced SMAD1/5 response. From that perspective it would have been interesting to examine the effect of Actin ectopic (instead of BMP7) expression. Is the response of ΔAcvr1-R206H also not responsive to activin?

In response to the reviewers’ question we have now tested the ability of both ACVR1-R206H and ΔACVR1-R206H to respond to Activin A using our pSmad1/5 quantitative immunofluorescence protocol and included these data in our manuscript (new Figure 4). We show that ACVR1-R206H, but not ΔACVR1-R206H, is able to respond to both Bmp7 and to Activin A.

Note that because Activin A also activates the Nodal pathway in developing zebrafish embryos, phenotypic evaluation of Activin A response in later stage embryos is not possible. Embryos arrest at epiboly and die before DV patterning or, in rare cases, are phenotypically uninterpretable and cannot be assessed (Figure 4A,B).

4) All data was performed in zebrafish embryos in which WT and mutant receptors are likely overexpressed. Authors do not provide information whether the expression levels of ectopic receptor are comparable to that of endogenous receptors. Can the authors exclude the possibility that the observed results are not an artifact of overexpression?

We agree that this is an important point that we had not addressed in our experiments. We now compared the level of mouse WT-ACVR1 that was sufficient to just rescue Acvr1ldepleted embryos to the amount of ACVR1-R206H, ΔACVR1-R206H, ACVR1-G328R, and ΔACVR1-G328R that ventralized Acvr1l-depleted embryos (Figure 1—figure supplement 2). We used quantitative immunofluorescence of antibody binding to the HA-epitope tag on these receptors, quantitating immunostaining at the cell membrane via co-localization with betaCatenin immunofluorescence. Our results show that similar or less amounts of ACVR1-R206H, ΔACVR1-R206H, ACVR1-G328R, and ΔACVR1-G328R protein are required to ventralize the embryo compared to the amount of WT-ACVR1 protein that is required to rescue loss of endogenous Acvr1l. Thus, our results cannot be explained by an overexpression artifact. These new results have been added to the manuscript (Results section).

We also note that the amount of ACVR1-R206H mRNA injected to achieve a ventralized phenotype in this study was 1/20th the dose of WT-ACVR1 mRNA required to rescue the loss of endogenous WT-Acvr1l. While the amount of mRNA does not necessarily correlate with the amount of protein produced, the large degree to which these concentrations differ suggests that significantly less ACVR1-R206H is required to ventralize the zebrafish embryo than the amount of WT-ACVR1 required to rescue the embryo, and as a result is expected to be less than the endogenous amount of Acvr1l protein.

5) The authors state that ACVR1-R206H is able to signal in the absence of all other BMP type I receptors. This is an overstatement, and needs to be corrected. Morpholinos are used, which will never completely deplete BMP receptor expression. In the experiments residual maternal BMP receptor expression is still present. ALK1 is also a BMP type I receptor that was not targeted for depletion by the authors.

We agree that this was an overstatement and have now revised our manuscript to state that ACVR1-R206H is able to signal independently of Bmpr1 specifically.

We believe our results strongly indicate that Bmpr1, a required partner for WT-ACVR1, is not required for ACVR1-FOP-mediated patterning. Our Bmpr1, Acvr1l triple

knockdown/mutant embryo is unable to respond to Bmp7 overexpression, showing that there is not enough receptor present following morpholino knockdown to be relevant to signal in patterning. We note that females are bmpr1aa+/-, so are depleted of maternal bmpr1aa as well. Further, bmpr1a-/- mutant embryos are unable to respond to Bmp7 overexpression (Figure 7A columns 3,10,11), indicating that the half-dose of maternal bmpr1aa is insufficient to signal in DV patterning. It is possible that this residual transcript is degraded shortly after the initiation of zygotic transcription at 3 hpf, when a large fraction of maternal transcripts are degraded, a timepoint 2.5 hours before BMP signaling patterns the zebrafish embryo.

It is also important to note that AcvrlI (ALK1) is not present in the embryo at the time of our pSmad1/5 immunostains. Studies have shown by RNA seq that acvrlI transcript is not detectable until 75% epiboly1 and is not detectable by in situ during the first 24 hours of development2. We cannot exclude, however, that low levels of AcvrlI expression play a role in the ability of ACVR1-R206H to respond to ligand in the absence of Bmpr1 and Acvr1, as shown in Figure 7. We thank the reviewers for raising these questions and these points have now been added to the Discussion section.

6) Figure S3. Primary (imaging) data that ACVR-R206H is responsive to BMP7 ligand needs to be included. Include statistical analysis of the IF imaging data shown in Figure 2 and Figure 4.

Figure S3 has been converted to the second part of Figure 3 within the main text and images of embryo phenotypes have been added as supplemental figures (Figure 3—figure supplement 2).

For all pSmad1/5 immunofluorescence imaging (Figure 2, Figure 4, and Figure 5), we have now added plots comparing the means of the mean nuclear fluorescence of each embryo in an experimental condition. Two tailed T-tests assuming unequal variance have been performed on these data and the results have been added. Note that the number of embryos analyzed in Figure 2 and Figure 5 has changed since our last submission. More embryos were immunostained and a few had to be removed from analysis due to a non-specific stain in the outer cell layer.

7) The bubble graphs are an efficient manner of presenting the data. That said, can a legend or scaling system be devised such that we know what percent each sized bubble represents? This would aid with data transparency.

Thank you for this suggestion. We have added a legend in Figure 1 for the bubble plots showing the size of example bubbles that correspond to 100, 90, 80, 70, 60, 50, 40, 30, 20 and 10% of the total population.

8) Figure 1I, column 5… this is only an incomplete rescue, not a full rescue as is stated in the text. This should be clarified.

We have restated our results to state that Acvr1 primarily rescues acvr1l KD embryos to mildly dorsalized or wildtype phenotypes (Results section).

9) It is difficult to see that there is indeed a gradient in Figure 2D,D’,E,E’. Can this be quantified in any way, both to see how reproducible this was and to make the read-out less subjective. A second concern is that the images for the FOP mutants are over saturated obscuring the pattern.

We agree with the reviewers’ point. The results from our immunofluorescent studies have now been composited in graphs showing the means of the mean nuclear fluorescence of each embryo in an experimental condition (Figure 2, Figure 4 and Figure 5), which greatly strengthens this analysis. In many of these embryos, the visible gradient is lost because signaling is high in all nuclei, as is the case for d, d’, e, and e’. All embryos being compared to each other have been normalized and processed in the same way, allowing us to compare the loss of gradient and bright signal to the normal gradient in wildtype un-injected embryos.

10) Using DV patterning assays in zebrafish embryos the group has convincingly shown that both Acvr1-R206H and Acvr1-G328R, two FOP mutants, are able to rescue an acvr1l deletion mutant, even when the ligand binding site is deleted. This is not seen in the corresponding wt-deletion mutant. In animal pole view experiment, in which pSMAD1/5 was measured, the ligand independent effects were confirmed. Here it would be of interest to also show data on pSMAD2/3 as it was suggested before that FOP-mutant receptors induce both branches of SMAD signaling. The authors should address this with the same assay shown in Figure 2. This experiment was considered essential by all reviewers.

We have now performed pSmad2 immunostaining on bmp7-/- embryos not injected

(which have normal Nodal signaling and as a result normal pSmad2 expression) or injected with Activin A, Acvr1-R206H or Acvr1-R206H plus Activin A mRNA. While Activin A increases pSmad2 expression, presumably by activating the Nodal signaling pathway, Acvr1-R206H does not increase pSmad2 expression. Acvr1-R206H plus Activin A does increase pSmad2 signaling, but not any more than Activin A alone. These data are now included in Figure 4O-T.

11) Please explain the differences for R206H as compared to G328R in Figure 2: Δ-R206H acts stronger in the KD (e, e'), while Δ-G328R works stronger in the wt setting (g, g'). Is this statistically significant? What is the explanation for these differences?

Both ACVR1-R206H and ACVR1-G328R produce a range of DV phenotypes (as indicated in bubble plots), and this is reflected in a range of pSmad1/5 intensities. Quantification of pSmad1/5 intensity has now been added to provide more information (Figure 2H). The embryos shown in Figure 2A-G, Figure 4C-M, 4O-S, and Figure 5G-J were selected from the 3 embryos closest to the mean fluorescence of the condition and did not have any significant defects or tears. These selection criteria have been added to the Materials and methods section.

In Figure 2, with the exception of ΔAcvr1, none of the receptors induce a significant difference in pSmad1/5 intensity with verses without Acvr1l KD (Figure 2H). In general, the mean intensity of pSmad1/5 appears to decrease with acvr1l KD. This is most likely due to the lower baseline signaling activity in the acvr1l KD embryos before the activity of FOP-ACVR1.

12) The authors write in subsection “ACVR1-R206H signals in the absence of all other Type I BMP receptors”: "Therefore, the ability of FOP-ACVR1 to signal independently of ligand suggests the possibility of signaling in the absence of receptor complex partners as well." This statement is interesting; however, the absence of receptor complex partners is not the only explanation for this observation. In particular, the authors should refer to and/or address the role of the low affinity receptor for BMP (BMPR2) or the high affinity receptor for Activin (ActR2) in this context. The data on the contribution of BMPR1a and BMPR1b however are convincingly shown and important as they give evidence that for the ligand-independent signaling by the FOP-mutant receptor, none of these type 1 receptors are required. It would be however important to mention the expression of other type 1 receptors such as ALK4 and ALK5 as potentially compensating receptors. This is of particular importance also for point 1 (SMAD2/3 signaling), mentioned above.

We thank the reviewers for noting that our “data on the contribution of BMPR1a and BMPR1b however are convincingly shown and important as they give evidence that for the ligand-independent signaling by the FOP-mutant receptor, none of these type 1 receptors are required.” We agree with the reviewers that we have not excluded relevant roles of type II receptors or Alk4 and 5 receptors. We have modified the Discussion section to more thoroughly address the role that the type II receptors may play. Previously, we discussed the possibility that ACVR1-R206H may be able to signal with only type II BMP receptors. We have now also addressed that the type II receptors that signal in this case may depend on the ligand available.

Previously, we also discussed the possibility that ACVR1 may be signaling in combination with TGFB1 (Alk5) and ACVR1b (Alk4). We have further added to the Discussion section that the preference for these receptors may be influenced by the associated ligand and type II receptor, in particular in the case of ACVR1b.

13) The authors continued to show, that Acvr1-R206H responds to BMP7 in the absence of BMPR1A and BMPR1B. It would be of particular interest to extend this also to other ligands. While testing all ligands is beyond the scope of this paper, this topic should be addressed in the discussion as potential needed future work and or in context with that which is already know.

As suggested, this has been added to the Discussion section as a future direction for this work.

14) In the Discussion section the authors write: "….further suggests it does not have the ability to bind ligand, and therefore does not need ligand to signal." This is a strong statement, in particular, as others have shown that Activin binding to the mutant receptors leads to increased SMAD signaling. How do the authors explain these controversial findings?

This statement previously referred specifically to ΔAcvr1-R206H, which lacks a large part of the ligand binding domain. Unlike Acvr1-R206H, ΔAcvr1-R206H does not signal in response to either Bmp7 or Activin A. This has been expanded and further clarified in the new Figure 4 and Results section . The results suggest that Acvr1-R206H can signal without binding and responding to ligand.


Article and author information

Author details

  1. Robyn S Allen

    1. Department of Cell and Developmental Biology University of Pennsylvania Perelman School of Medicine, Philadelphia, United States
    2. Departments of Orthopaedic Surgery and Genetics University of Pennsylvania Perelman School of Medicine, Philadelphia, United States
    Conceptualization, Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-8306-0620
  2. Benjamin Tajer

    Department of Cell and Developmental Biology University of Pennsylvania Perelman School of Medicine, Philadelphia, United States
    Conceptualization, Validation, Investigation, Methodology, Writing - original draft, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7791-1249
  3. Eileen M Shore

    Departments of Orthopaedic Surgery and Genetics University of Pennsylvania Perelman School of Medicine, Philadelphia, United States
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-2609-6971
  4. Mary C Mullins

    Department of Cell and Developmental Biology University of Pennsylvania Perelman School of Medicine, Philadelphia, United States
    Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9979-1564


National Institute of General Medical Sciences (R35-GM131908)

  • Mary C Mullins

National Institute of General Medical Sciences (R01-GM056326)

  • Mary C Mullins

National Institute of Arthritis and Musculoskeletal and Skin Diseases (R01-AR071399)

  • Eileen M Shore

Developmental Grant from the Cali family

  • Mary C Mullins

Center for Research in FOP and Related Disorders

  • Eileen M Shore

Cali/Weldon Professorship

  • Eileen M Shore

International Fibrodysplasia Ossificans Progressiva Association

  • Eileen M Shore

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.


We thank: the UPenn CDB Microscopy Core, especially Andrea Stout; Petra Seemann and Julia Haupt at Berlin-Brandenburg Center for Regenerative Therapies for providing the ligand-binding mutant receptor constructs; the UPenn fish facility; high school student Claire Tse; the Shore lab especially Meiqi Xu for ACVR1 constructs; Thomas Wardrop; Amy Kugath and members of the Mullins lab for helpful consultation. This work was supported by NIH R01-GM056326 and R35-GM131908 (to MCM) and R01-AR071399 (to EMS), a Developmental Grant from the Cali family and the Center for Research in FOP and Related Disorders, the Cali/Weldon Professorship (to EMS), and the International Fibrodysplasia Ossificans Progressiva Association (IFOPA).


Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocols (#803105) of the University of Pennsylvania.

Senior Editor

  1. Kathryn Song Eng Cheah, The University of Hong Kong, Hong Kong

Reviewing Editor

  1. Cheryl Ackert-Bicknell, University of Colorado, United States


  1. Petra Knaus

Publication history

  1. Received: November 21, 2019
  2. Accepted: August 12, 2020
  3. Version of Record published: September 8, 2020 (version 1)


© 2020, Allen et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.


  • 1,106
    Page views
  • 96
  • 9

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Download citations (links to download the citations from this article in formats compatible with various reference manager tools)

Open citations (links to open the citations from this article in various online reference manager services)

Further reading

    1. Chromosomes and Gene Expression
    2. Developmental Biology
    Benoit Roch et al.
    Research Article Updated

    We developed an Xrcc4M61R separation of function mouse line to overcome the embryonic lethality of Xrcc4-deficient mice. XRCC4M61R protein does not interact with Xlf, thus obliterating XRCC4-Xlf filament formation while preserving the ability to stabilize DNA ligase IV. X4M61R mice, which are DNA repair deficient, phenocopy the Nhej1-/- (known as Xlf -/-) setting with a minor impact on the development of the adaptive immune system. The core non-homologous end-joining (NHEJ) DNA repair factor XRCC4 is therefore not mandatory for V(D)J recombination aside from its role in stabilizing DNA ligase IV. In contrast, Xrcc4M61R mice crossed on Paxx-/-, Nhej1-/-, or Atm-/- backgrounds are severely immunocompromised, owing to aborted V(D)J recombination as in Xlf-Paxx and Xlf-Atm double Knock Out (DKO) settings. Furthermore, massive apoptosis of post-mitotic neurons causes embryonic lethality of Xrcc4M61R -Nhej1-/- double mutants. These in vivo results reveal new functional interplays between XRCC4 and PAXX, ATM and Xlf in mouse development and provide new insights into the understanding of the clinical manifestations of human XRCC4-deficient condition, in particular its absence of immune deficiency.

    1. Cell Biology
    2. Developmental Biology
    Deepika Sharma et al.
    Research Article

    Osteoblast differentiation is sequentially characterized by high rates of proliferation followed by increased protein and matrix synthesis, processes that require substantial amino acid acquisition and production. How osteoblasts obtain or maintain intracellular amino acid production is poorly understood. Here we identify SLC1A5 as a critical amino acid transporter during bone development. Using a genetic and metabolomic approach, we show SLC1A5 acts cell autonomously to regulate protein synthesis and osteoblast differentiation. SLC1A5 provides both glutamine and asparagine which are essential for osteoblast differentiation. Mechanistically, glutamine and to a lesser extent asparagine support amino acid biosynthesis. Thus, osteoblasts depend on Slc1a5 to provide glutamine and asparagine, which are subsequently used to produce non-essential amino acids and support osteoblast differentiation and bone development.