Research Article

Dissecting the phenotypic and functional heterogeneity of mouse inflammatory osteoclasts by the expression of Cx3cr1

Laboratoire de PhysioMédecine Moléculaire, CNRS, France
Université Côte d’Azur, France
Department of Pharmacy, Cardenal Herrera-CEU University, Spain
Laboratory of Immune Cell Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, United States
Université Paris-Saclay, UVSQ, INSERM, Infection et inflammation, France
IRMB, Univ Montpellier, INSERM, CHU Montpellier, France
Genetics division, Ambroise Paré Hospital, AP-HP, France

May 13, 2020

https://doi.org/10.7554/eLife.54493

Open access
Copyright information

Figures
Tables
Additional files

8 figures, 1 table and 5 additional files

Figures

Figure 1 with 2 supplements

Download asset Open asset

*Cx3cr1*-deficient mice display reduced bone loss after ovariectomy.

(A) FACS analysis of Cx3cr1⁺ OCLs generated from BM cells from SHAM-operated and OVX WT mice. Histograms indicate the mean ± SD percentage of Cx3cr1⁺ i-OCLs (n = 4–5). (B) Representative images of femur µCT analysis from SHAM-operated and OVX WT *Cx3cr1*^GFP/+ and Cx3cr1-deficient *Cx3cr1*^GFP/GFP mice 6 weeks post-surgery. (C) Histograms show the mean ± SD percentage of bone volume fraction (BV/TV), trabecular number and trabecular separation (n = 8 mice per group). (D) Representative TRAcP staining on femora from OVX Cx3cr1^GFP/+ and Cx3cr1^GFP/GFP mice. Scale bar = 100 µm. (E) Ex vivo FACS analysis of CD11c⁺ DCs and (F) CD11b⁺Ly6C^hi MNs present in the BM of SHAM and OVX mice. Cells were gated as in Figure 1—figure supplement 2 and histograms are showing the absolute cell number of these populations in the bone marrow. **p<0.01; ***p<0.001; n.s., no significant difference.

Figure 1—figure supplement 1

Download asset Open asset

Analysis of i-OCLs progenitors in OVX mice.

(A) Schematic representation of the differentiation of OCLs from blood CD11b⁺Ly6C^hi monocytes from WT *Cx3cr1*^GFP/+ mice (B) FACS analysis on these CD11b⁺ Ly6C^hi MNs-derived OCLs using Hoechst 33342-A staining revealed that GFP⁺ (Cx3cr1⁺) OCLs differentiate efficiently from CD11b⁺ Ly6C^hi MNs. OCLs were gated as cells having three nuclei and more (≥3N) as described previously (Madel et al., 2018).

Figure 1—figure supplement 2

Download asset Open asset

Gating strategy for ex vivo FACS analysis.

Gating strategy for ex vivo FACS analysis of bone marrow DCs and inflammatory monocytes in SHAM and OVX mice.

Figure 2 with 2 supplements

Download asset Open asset

Cx3cr1 deficiency does not affect resorption and immune function in Cx3cr1⁺ i-OCLs.

(A) Schematic representation of the differentiation of i-OCLs from BM-derived DCs of WT *Cx3cr1*^GFP/+ and Cx3cr-deficient *Cx3cr1*^GFP/GFP mice. (B) RNA-seq analysis on sorted GFP⁺ i-OCLs (representing Cx3cr1⁺ i-OCLs) differentiated from BM-derived DCs of WT *Cx3cr1*^GFP/+ and Cx3cr-1deficient *Cx3cr1*^GFP/GFP mice (gated as in Figure 2—figure supplement 1). Volcano-plot indicates –Log₁₀ adjusted p value versus log₂fold-change comparing gene expression in i-OCL subsets. (C) Matrix dissolution activity of sorted GFP⁺ i-OCLs from WT *Cx3cr1*^GFP/+ and Cx3cr1-deficient *Cx3cr1*^GFP/GFP mice seeded at the same cell density on a calcified matrix was evidence by red alizarin staining of the mineralized matrix. Unstained areas correspond to the resorbed areas. Left panel: representative images of resorbed area. Scale bar = 100 µm. Right panel: quantification of resorbed areas presented as mean ± SD percentage of three independent biological replicates each in triplicates. (D) FACS analysis of fluorescent-OVA uptake among GFP⁺ i-OCLs from *Cx3cr1*^GFP/+ and *Cx3cr1*^GFP/GFP mice. Left panel: representative density plots and right panel: percentage of OVA⁺ cells from five independent experiments. (E) FACS analysis of GFP⁺ i-OCLs from *Cx3cr1*^GFP/+ and *Cx3cr1*^GFP/GFP mice in at least four independent experiments. (F) T cell proliferation assay on CD4⁺ T cells labelled with CFSE and cultured in the presence of OVA-challenged GFP⁺ i-OCLs differentiated from *Cx3cr1*^GFP/+ and *Cx3cr1*^GFP/GFP mice and analyzed by FACS after 4 days of coculture. (G) CD4⁺ T cells activated by OVA-challenged GFP⁺ i-OCLs from *Cx3cr1*^GFP/+ and *Cx3cr1*^GFP/GFP mice were analyzed for their expression of TNFα and IFNγ by FACS after intracytoplasmic staining of these cytokines. n.s., no significant difference.

Figure 2—figure supplement 1

Download asset Open asset

Gating strategy for mature Cx3cr1⁺ and Cx3cr1^neg i-OCLs.

(A) Gating strategy for the analysis and sorting of mature GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs using flow cytometry. After gating on total cells, doublets were excluded and cells with ≥3 nuclei (≥3N) cells were considered as OCLs and distinguished from 1 to 2 nucleated (1–2N) cells based on their Hoechst 33342 staining level. OCLs were analyzed based on their GFP expression and GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs were sorted.

Figure 2—figure supplement 2

Download asset Open asset

Comparative transcriptomic analysis of Cx3cr1⁺ i-OCLs from *Cx3cr1*^GFP/GFP and *Cx3cr1*^GFP/+ mice.

(A) Comparative RNA-seq analysis between GFP⁺ (Cx3cr1⁺) i-OCLs from KO *Cx3cr1*^GFP/GFP and WT *Cx3cr1*^GFP/+ mice. Heatmap visualization of the z-scored expression for selected genes involved in OCL differentiation, T cell stimulation and antigen presentation. (B) Relative mRNA expression of GFP⁺ (Cx3cr1⁺) i-OCLs from KO *Cx3cr1*^GFP/GFP and WT *Cx3cr1*^GFP/+ mice. Results are represented as the mean with 95% confidence interval of three independent biological replicates conducted in triplicates. n.s., no significant difference.

Figure 3 with 1 supplement

Download asset Open asset

Transcriptomic profiling of Cx3cr1⁺ and Cx3cr1^neg i-OCLs reveals two distinct populations of i-OCLs.

(A) Schematic representation of the differentiation of GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs from BM-derived DCs of WT *Cx3cr1*^GFP/+ mice and their sorting (gated as in Figure 2—figure supplement 1). (B) Principal component analysis of Cx3cr1⁺ and Cx3cr1^neg i-OCLs clusters samples in two groups (red: GFP⁺ (Cx3cr1⁺) OCLs and blue GFP^neg (Cx3cr1^neg) OCLs, both from *Cx3cr1*^GFP/+ mice). Data shows the two first components on the top 500 most differentially expressed genes after batch correction. Each dot represents the expression profile of one sample. (C) Volcano-plot showing representative differentially expressed genes for Cx3cr1⁺ and Cx3cr1^neg i-OCLs. Cut-off values were defined by a fold change (FC) >2 and an adjusted p-value<0.05. (D) Heatmap visualization of the top 107 genes significantly differentially expressed between GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs from *Cx3cr1*^GFP/+ mice (adjusted p-value<0.05, FC ≥2). (E) Graphical representation of gene ontology analysis associated with differentially expressed genes between Cx3cr1⁺ and Cx3cr1^neg i-OCLs.

Figure 3—figure supplement 1

Download asset Open asset

Cx3cr1⁺ and Cx3cr1^neg i-OCLs differ in their expression of Cx3cr1-interacting genes.

(A) Heatmap visualization of selected genes involved in the Cx3cr1 pathway that are significantly differentially expressed (p<0.05, FC ≥2) between GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs differentiated from WT *Cx3cr1*^GFP/+ mice. (B) Relative expression levels of *Nr1d1* and (C) *Tlr4* in Cx3cr1⁺ and Cx3cr1^neg i-OCLs. (D) BM-derived DCs from *Cx3cr1*^GFP/+ mice were sorted based on their expression of GFP and were differentiated into i-OCLs. Both GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) DCs gave rise to approx. 20% of Cx3cr1⁺ i-OCLs. *p<0.05; ****p<0.0001.

Figure 4 with 1 supplement

Download asset Open asset

Cx3cr1^neg and Cx3cr1⁺ i-OCLs differ in their resorbing activity.

(A) Heatmap visualization of the z-scored expression for selected genes involved in bone resorption, osteoclast fusion and differentiation that are differentially expressed between GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs both differentiated from WT *Cx3cr1*^GFP/+ mice (adjusted p-value<0.05, FC ≥2). (B) RT-qPCR analysis on GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs. Results are represented as the mean with 95% confidence interval of 3 independent biological replicates in triplicates. (C) Flow cytometry analysis of TRAcP expression using ELF95 substrate in the 2 i-OCLs subsets. Percentage of positive cells (dark curve) compared to the negative control (light curve) is indicated. (D) Quantification of the mean fluorescence intensity (MFI) of TRAcP in GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs (n = 3). (E) Representative images of matrix dissolution activity of sorted GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs seeded at the same cell density. Red alizarin staining of the mineralized matrix revealed the resorbed areas as unstained. Scale bar = 100 µm. (F) Quantification of resorbed areas from three independent experiments in triplicates are indicated as percentage. ****p<0.0001; n.s., no significant difference.

Figure 4—figure supplement 1

Download asset Open asset

Cx3cr1⁺ i-OCLs differ from Cx3cr1⁺ BM-derived macrophages.

(A) Schematic representation of the differentiation of macrophages from the BM of *Cx3cr1*^GFP/+ mice. (B) FACS analysis of macrophage markers on BM-derived macrophages and (C) on GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs (n = 3). (D) Quantification of CD68⁺CD169⁺ cells in Cx3cr1⁺ BM-derived macrophages and in Cx3cr1^neg and Cx3cr1⁺ i-OCL subsets. (E) Representative images of TRAcP staining on i-OCLs and BM-derived macrophages showing that contrasting to i-OCLs that all express TRAcP, BM-derived macrophages are negative for TRAcP expression. Scale bar = 50 µm.

Figure 5 with 1 supplement

Download asset Open asset

Cx3cr1^neg and Cx3cr1⁺ subsets differ in their antigen uptake and presentation.

(A) Heatmap visualization of the z-scored expression for selected genes involved in antigen uptake, processing and presentation that are differentially expressed between GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs from WT *Cx3cr1*^GFP/+ mice (adjusted pVal <0.05, FC ≥2). (B) Representative FACS plots of OVA uptake in Cx3cr1⁺ and Cx3cr1^neg i-OCLs. (C) Quantification of FACS analysis for OVA uptake in GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs (n = 5). (**D–F**) FACS analysis of GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs for (D) MHC-II, (E) CD80 and (F) CD86 (n = 6). (G). Representative FACS histograms for T cell proliferation assay of CFSE-labelled CD4⁺ T cells from OT-II mice cultured with OVA-loaded GFP⁺ (Cx3cr1⁺) or GFP ^neg (Cx3cr1^neg) i-OCLs after 5 days of coculture. **p<0.01; n.s., no significant difference.

Figure 5—figure supplement 1

Download asset Open asset

CD4⁺ T cell polarization analysis CD4⁺ T cells from OT-II mice were cocultured with OVA-challenged GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs from WT *Cx3cr1*^GFP/+ mice, respectively, and analyzed by intracytoplasmic staining for their (A) TNFα, (B) IFNγ and (C) FoxP3 expression using flow cytometry. n.s., no significant difference.

Figure 6

Download asset Open asset

Cx3cr1^neg and Cx3cr1⁺ subsets differ in their T cell activation capacity.

(A) Heatmap visualization of the z-scored expression for selected genes involved in T cell stimulation and inhibition that are differentially expressed between GFP⁺ (Cx3cr1⁺) and GFP^neg (Cx3cr1^neg) i-OCLs from WT *Cx3cr1*^GFP/+ mice (adjusted p<0.05, FC ≥2). (B) RT-qPCR analysis of immunosuppressive molecules. Graphs show three independent experiments conducted in triplicates. (C) Representative FACS histograms and quantification of the proliferation of CSFE-labelled CD4⁺ T cell from OT-II mice cocultured with OVA-loaded Cx3cr1⁺ i-OCLs from WT *Cx3cr1*^GFP/+ mice and an isotype antibody (left panel) or an anti-PD-1 antibody (right panel). (D) Schematic representation of the experimental setup. Sorted GFP^neg (Cx3cr1^neg) i-OCLs from WT *Cx3cr1*^GFP/+ mice were loaded with OVA for 3 hr and incubated with CFSE⁺ CD4⁺ T cells in the presence of different rations of non-OVA loaded GFP⁺(Cx3cr1⁺) i-OCLs from WT *Cx3cr1*^GFP/+ mice. (E) FACS analysis and quantification of CFSE⁺ CD4⁺ T cells of OT-II mice cocultured in the presence of different ratios (1:0; 1:1; 1:2) between OVA-loaded Cx3cr1^neg i-OCLs and Cx3cr1⁺ i-OCLs (non-loaded with OVA) for 5 days. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; n.s., no significant difference.

Figure 7

Download asset Open asset

Heterogeneity of osteoclasts and underlying molecular mechanisms.

In steady state, BM progenitors differentiate into tolerogenic OCLs (t-OCLs) that are able to present antigens and induce CD4⁺ Treg cells. During inflammation, inflammatory MNs and DCs are recruited to the BM and differentiate into i-OCLs. Approx. 25% of these i-OCLs can be characterized by their expression of Cx3cr1 while the majority of i-OCLs does not express this marker. Cx3cr1^neg i-OCLs show significantly higher bone resorption activity in vitro compared to Cx3cr1⁺ i-OCLs. Both i-OCL subsets act as antigen-presenting cells but differ in their T cell activation capacity that is higher for the Cx3cr1^neg i-OCL subset. Both i-OCL subsets are able to induce TNFα-producing CD4⁺ T cells, however the Cx3cr1⁺ OCL subset express high levels of co-inhibitory molecules such as PD-L1 that reduce their capacity to activate T cells. Moreover, Cx3cr1⁺ i-OCLs have an immune suppressive effect on Cx3cr1 ^neg i-OCLs by reducing their T cell proliferation capacity in vitro.

Author response image 1

Download asset Open asset

Cx3cr1^neg i-OCLs from Cx3cr1^GFP/+ mice are distinct from Cx3cr1⁺ i-OCLs from deficient Cx3cr1^GFP/GFP mice.

A) Principal component analysis of Cx3cr1⁺ from deficient Cx3cr1^GFP/GFP mice (green) and Wt Cx3cr1^GFP/+ mice (red) and Cx3cr1^neg i-OCLs from Cx3cr1^GFP/+ mice (blue). Data shows the two first components after batch correction. Each dot represents the expression profile of one sample. B) Similarity matrix analysis on the same samples.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Mus musculus)	Cx3cr1^GFP/+	Jung et al., 2000		CDTA, CNRS, Orléans, France
Sequenced-based reagent	Calcr		PCR primers	CTTCCATGCTGATCTTCTGG andCAGATCTCCATTGGGCACAA
Sequenced-based reagent	Acp5		PCR primers	TGCCTACCTGTGTGGACATGA andCACATAGCCCACACCGTTCTC
Sequenced-based reagent	Mmp9		PCR primers	TGAGTCCGGCAGACAATCCT and CGCCCTGGATCTCAGCAATA
Sequenced-based reagent	Ctsk		PCR primers	CAGCAGAGGTGTGTACTATG and GCGTTGTTCTTATTCCGAGC
Sequenced-based reagent	Atp6V0a3/Tcirg1		PCR primers	CGCTGCGAGGAACTGGAG and AGCGTCAGACCTGCCCG
Sequenced-based reagent	Tnfrsf11a		PCR primers	CTTGGACACCTGGAATGAAGAAG and AGGGCCTTGCCTGCATC
Sequenced-based reagent	Nfatc1		PCR primers	TGAGGCTGGTCTTCCGAGTT and CGCTGGGAACACTCGATAGG
Sequenced-based reagent	Dcstamp		PCR primers	GGGCACCAGTATTTTCCTGA and CAGAACGGCCAGAAGAATGA
Sequenced-based reagent	Oscar		PCR primers	GTAACGGATCAGCTCCCCAG and CGCGGTACAGTGCAAAACTC
Sequenced-based reagent	CD274		PCR primers	CAAGCGAATCACGCTGAAAG and GGGTTGGTGGTCACTGTTTGT
Sequenced-based reagent	Lgals9		PCR primers	TCAAGGTGATGGTGAACAAGAAA and GATGGTGTCCACGAGGTGGTA
Sequenced-based reagent	Lightr/Tnfrsf14		PCR primers	TGTCCATTCTTTTGCCACTTG and CCTGATGGTGTTCTCCTGTTGTT
Sequenced-based reagent	36B4		PCR primers	TCCAGGCTTTGGGCATCA and CTTTATCAGCTGCACATCACTCAGA
Antibody	Monoclonal anti-mouse CD80	BD Biosciences	clone 16-10A1	APC-conjugated (1:100)
Antibody	Monoclonal anti-mouse CD86	BD Biosciences	clone GL1	PE-conjugated (1:100)
Antibody	Monoclonal anti-mouse I-A[b]	BD Biosciences	clone AF6-120.1	Biotin-conjugated (1:200)
Antibody	Monoclonal anti-mouse/human CD11b	BD Biosciences	clone M1/70	PE-conjugated (1:500)
Antibody	Monoclonal anti-mouse CD4	BD Biosciences	clone RM4-5	PECy7-conjugated (1:1000)
Antibody	Monoclonal anti-mouse CD68	ThermoFisher Scientific	clone FA-11	PECy7-conjugated (1:200)
Antibody	Monoclonal anti-mouse CD11c	ThermoFisher Scientific	clone N418	PECy7-conjugated (1:200)
Antibody	Monoclonal anti-mouse Ly6C	ThermoFisher Scientific	clone HK1.4	PerCP-conjugated (1:1000)
Antibody	Monoclonal anti-mouse CD169	ThermoFisher Scientific	clone SER-4	APC-conjugated (1:100)
Antibody	Monoclonal anti-mouse IFNγ	ThermoFisher Scientific	clone XMG1.2	APC-conjugated (1:400)
Antibody	Monoclonal anti-mouse TNFα	ThermoFisher Scientific	clone MP6-XT22	BV421-conjugated (1:400)
Chemical compound, drug	streptavidin	ThermoFisher Scientific		PercP-conjugated (1:200)
Chemical compound, drug	ovalbumin	ThermoFisher Scientific		Alexa Fluor 647-conjugated
Commercial assay or kit	Acid Phosphatase Leucocyte (TRAcP) kit	Sigma-Aldrich	387A
Commercial assay or kit	ELF 97 Endogenous Phosphatase Detection Kit	Molecular probes	E-6601

Additional files

Source data 1 Raw counts-HTSeq. Raw counts (HTseq) per gene and per sample from the RNAseq analysis of Cx3cr1⁺ and Cx3cr1^neg i-OCLs from WT Cx3cr1^GFP/+ mice and Cx3cr1⁺ i-OCLs from deficient Cx3cr1^GFP/GFP mice. In each group, the 4 i-OCL samples have been obtained from 4 different mice.: https://cdn.elifesciences.org/articles/54493/elife-54493-data1-v1.xlsx
Download elife-54493-data1-v1.xlsx
Source data 2 Counts_Deseq NormaBatch Corrected. Counts per gene and per sample after normalization and batch correction from the RNAseq analysis of Cx3cr1⁺ and Cx3cr1^neg i-OCLs from WT Cx3cr1^GFP/+ mice and Cx3cr1⁺ i-OCLs from deficient Cx3cr1^GFP/GFP mice. In each group, the 4 i-OCL samples have been obtained from 4 different mice.: https://cdn.elifesciences.org/articles/54493/elife-54493-data2-v1.xlsx
Download elife-54493-data2-v1.xlsx
Source data 3 Cx3cr1⁺ i-OCLs from WT Cx3cr1^GFP/+ mice versus Cx3cr1⁺ i-OCLs from deficient Cx3cr1^GFP/GFP mice _Deseq. Statistics (Deseq) for the comparison of expressed genes in Cx3cr1⁺ i-OCLs from WT Cx3cr1^GFP/+ mice versus Cx3cr1⁺ i-OCLs from deficient Cx3cr1^GFP/GFP mice. In each group, the 4 i-OCL samples have been obtained from 4 different mice.: https://cdn.elifesciences.org/articles/54493/elife-54493-data3-v1.xlsx
Download elife-54493-data3-v1.xlsx
Source data 4 Cx3cr1⁺ i-OCLs from WT Cx3cr1^GFP/+ mice versus Cx3cr1^neg i-OCLs from WT Cx3cr1^GFP/+ mice mice _Deseq. Statistics (Deseq) for the comparison of expressed genes in Cx3cr1⁺ versus Cx3cr1^neg i-OCLs from WT Cx3cr1^GFP/+ mice. In each group, the 4 i-OCL samples have been obtained from 4 different mice.: https://cdn.elifesciences.org/articles/54493/elife-54493-data4-v1.xlsx
Download elife-54493-data4-v1.xlsx
Transparent reporting form: https://cdn.elifesciences.org/articles/54493/elife-54493-transrepform-v1.pdf
Download elife-54493-transrepform-v1.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Maria-Bernadette Madel
Lidia Ibáñez
Thomas Ciucci
Julia Halper
Matthieu Rouleau
Antoine Boutin
Christophe Hue
Isabelle Duroux-Richard
Florence Apparailly
Henri-Jean Garchon
Abdelilah Wakkach
Claudine Blin-Wakkach

(2020)

Dissecting the phenotypic and functional heterogeneity of mouse inflammatory osteoclasts by the expression of Cx3cr1

eLife 9:e54493.

https://doi.org/10.7554/eLife.54493

Figures

Cx3cr1-deficient mice display reduced bone loss after ovariectomy.

Analysis of i-OCLs progenitors in OVX mice.

Gating strategy for ex vivo FACS analysis.

Cx3cr1 deficiency does not affect resorption and immune function in Cx3cr1⁺ i-OCLs.

Gating strategy for mature Cx3cr1⁺ and Cx3cr1^neg i-OCLs.

Comparative transcriptomic analysis of Cx3cr1⁺ i-OCLs from Cx3cr1^GFP/GFP and Cx3cr1^GFP/+ mice.

Transcriptomic profiling of Cx3cr1⁺ and Cx3cr1^neg i-OCLs reveals two distinct populations of i-OCLs.

Cx3cr1⁺ and Cx3cr1^neg i-OCLs differ in their expression of Cx3cr1-interacting genes.

Cx3cr1^neg and Cx3cr1⁺ i-OCLs differ in their resorbing activity.

Cx3cr1⁺ i-OCLs differ from Cx3cr1⁺ BM-derived macrophages.

Cx3cr1^neg and Cx3cr1⁺ subsets differ in their antigen uptake and presentation.

Cx3cr1^neg and Cx3cr1⁺ subsets differ in their T cell activation capacity.

Heterogeneity of osteoclasts and underlying molecular mechanisms.

Cx3cr1^neg i-OCLs from Cx3cr1^GFP/+ mice are distinct from Cx3cr1⁺ i-OCLs from deficient Cx3cr1^GFP/GFP mice.

Tables

Additional files

Source data 1

Source data 2

Source data 3

Source data 4

Transparent reporting form

Download links

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Be the first to read new articles from eLife

Share this article

Cite this article

Cx3cr1-deficient mice display reduced bone loss after ovariectomy.

Analysis of i-OCLs progenitors in OVX mice.

Gating strategy for ex vivo FACS analysis.

Cx3cr1 deficiency does not affect resorption and immune function in Cx3cr1+ i-OCLs.

Gating strategy for mature Cx3cr1+ and Cx3cr1neg i-OCLs.

Comparative transcriptomic analysis of Cx3cr1+ i-OCLs from Cx3cr1GFP/GFP and Cx3cr1GFP/+ mice.

Transcriptomic profiling of Cx3cr1+ and Cx3cr1neg i-OCLs reveals two distinct populations of i-OCLs.

Cx3cr1+ and Cx3cr1neg i-OCLs differ in their expression of Cx3cr1-interacting genes.

Cx3cr1neg and Cx3cr1+ i-OCLs differ in their resorbing activity.

Cx3cr1+ i-OCLs differ from Cx3cr1+ BM-derived macrophages.

Cx3cr1neg and Cx3cr1+ subsets differ in their antigen uptake and presentation.

Cx3cr1neg and Cx3cr1+ subsets differ in their T cell activation capacity.

Heterogeneity of osteoclasts and underlying molecular mechanisms.

Cx3cr1neg i-OCLs from Cx3cr1GFP/+ mice are distinct from Cx3cr1+ i-OCLs from deficient Cx3cr1GFP/GFP mice.

Source data 1

Source data 2

Source data 3

Source data 4

Transparent reporting form

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Cx3cr1 deficiency does not affect resorption and immune function in Cx3cr1⁺ i-OCLs.

Gating strategy for mature Cx3cr1⁺ and Cx3cr1^neg i-OCLs.

Comparative transcriptomic analysis of Cx3cr1⁺ i-OCLs from Cx3cr1^GFP/GFP and Cx3cr1^GFP/+ mice.

Transcriptomic profiling of Cx3cr1⁺ and Cx3cr1^neg i-OCLs reveals two distinct populations of i-OCLs.

Cx3cr1⁺ and Cx3cr1^neg i-OCLs differ in their expression of Cx3cr1-interacting genes.

Cx3cr1^neg and Cx3cr1⁺ i-OCLs differ in their resorbing activity.

Cx3cr1⁺ i-OCLs differ from Cx3cr1⁺ BM-derived macrophages.

Cx3cr1^neg and Cx3cr1⁺ subsets differ in their antigen uptake and presentation.

Cx3cr1^neg and Cx3cr1⁺ subsets differ in their T cell activation capacity.

Cx3cr1^neg i-OCLs from Cx3cr1^GFP/+ mice are distinct from Cx3cr1⁺ i-OCLs from deficient Cx3cr1^GFP/GFP mice.