Endogenous itaconate is not required for particulate matter-induced NRF2 expression or inflammatory response
Figures

Aconitate Decarboxylase 1 (Acod1) is highly upregulated by particulate matter in macrophages.
(A) We performed RNA-seq in BMDMs treated with either PM (20 μg/cm2) or vehicle control for 24 hours. Gene ontology analysis highlight the pathways involved with PM treatment. (B) Volcano plot of RNA-seq data representing differentially expressed genes in BMDMs treated with PM or PBS (vehicle control) for 24 hours. Acod1 (red point) is one of the most highly differentially expressed gene. In addition, we found induction of NRF2 target genes (i.e. Nqo1, Gclm; turquoise points) and inflammatory genes (i.e. Tnf, Il1b; orange points) following PM treatment. Black data points represent other significant genes, at FC > 2, and FDR adjusted p<0.05. (C) qPCR analysis of Acod1 in BMDMs treated with PM for 4, 8 or 24 hours. Data are represented as fold change. Significance was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, *p<0.05, **p<0.01, ***p<0.001. (D) Western blot of ACOD1 protein at 0, 4, 8, 24 and 48 hours of PM treatment. (E) Intracellular itaconate concentration in BMDMs treated with PM for 24 hours, as measured by mass spectrometry. (F) Extracellular itaconate in media in BMDMs treated with PM for 24 hours, as measured using mass spectrometry. Significance was determined using two-tailed unpaired student’s t-test, *p<0.05, **p<0.01, ***p<0.001.
-
Figure 1—source data 1
Differential expression analysis results of PM treated BMDMs compared with Control BMDMs.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig1-data1-v2.txt

Itaconate decreases oxygen consumption rate via inhibition of complex II, succinate dehydrogenase (SDH).
(A) We measured oxygen consumption rate (OCR) in permeabilized BMDMs (using XF plasma membrane permeabilizer) in the presence of ETC complex II substrate (succinate, 10 mM) and complex I inhibitor (rotenone, 2 mM), followed by injections of 1) media (control, n = 6), itaconate (10 mM, n = 6) or malonate (10 mM, n = 6), a known complex II inhibitor, 2) oligomycin (2 mM), an ATP synthase inhibitor, and 3) Antimycin A (2 mM), a complex III inhibitor. Both itaconate and malonate significantly decreased OCR. (B) We measured OCR in permeabilized BMDMs in the presence of ETC complex I substrates (pyruvate, 10 mM and malate, 0.5 mM) followed by injections of 1) itaconate or malonate, 2) oligomycin, or 3) rotenone and antimycin A (R/A) (n = 6). (C) We performed a mitochondrial stress test to measure OCR and ECAR in BMDMs treated with 4-octyl itaconate (OI) (0.25 mM) or vehicle control (n = 8). OI acutely decreased both (D) basal OCR and (E) maximal OCR measured at third time point after FCCP. Significance was determined using two-tailed unpaired student’s t-test, *p<0.05, **p<0.01, ***p<0.001.

The effect of PM on mitochondrial oxygen consumption is time dependent.
(A) We performed a mitochondrial stress test to measure OCR and ECAR in BMDMs at (A) 1 hour or (B) 24 hours following treatment with PM (20 μg/cm2) or control vehicle control. Oligomycin (ATP synthase inhibitor), FCCP (uncoupler), and rotenone/antimycin A (R/A) (complex I/III inhibitors) were injected sequentially. Basal OCR was acutely increased at 1 hour, which is before the induction of ACOD1 protein and production of itaconate. In contrast, both basal and maximal OCR decreased at 24 hours after PM treatment, when ACOD1 protein and itaconate levels are high (n = 8). ECAR was increased with PM at both timepoints. Significance was determined using two-tailed unpaired student’s t-test, *p<0.05, **p<0.01, ***p<0.001.

Acod1 and endogenous itaconate production is required for PM-reduced mitochondrial OCR via inhibition of SDH.
(A) Heatmap of intracellular levels of TCA cycle metabolites and itaconate at 24 hours following treatment with PM. (B–C) Intracellular concentrations of (B) itaconate and (C) succinate in WT and Acod1-/- cells with (n = 6) and without (n = 4) PM; itaconate is not detectable in Acod1-/- cells, while succinate does not accumulate in Acod1-/- cells. (D) Mitochondrial stress test of WT and Acod1-/- BMDMs after 24 hours of PM treatment. OCR was normalized to baseline OCR in WT control BMDMs (untreated). Maximal OCR levels are only decreased in WT cells, and not Acod1-/- cells following PM. Significance was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, *p<0.05, **p<0.01, ***p<0.001.

Inducible Nitric Oxide Synthase (iNOS) is induced by LPS but no by PM.
(A) Western blot of BMDMs treated with PM (20 µg/cm2) or LPS (100 ng/ml) for 0, 4, 8 or 24 hours. iNOS protein is not evident with PM treatment at any time point, but it is detectable with 24 hours of LPS treatment. (B) qPCR of BMDMs treated with PM or LPS for 24 hours. LPS significantly induces expression of Nos2 mRNA, the gene encoding iNOS protein. Significance between control and treatment groups was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, n = 4; *p<0.05, **p<0.01, ***p<0.001.

Exogenous but not endogenous itaconate decreases PM-induced inflammation.
(A) We treated WT BMDMs with PM for 4, 8 or 24 hours and measured mRNA expression of Tnfa, Il6 and Il1b by qPCR (n = 3). (B) We pretreated WT BMDMs with OI or vehicle control (DMSO) for 2 hours before we treated them with PM or vehicle control for 4 hours. We then measured mRNA expression of Tnfa, Il6 and Il1b (qPCR). (C, D) We treated WT and Acod1-/- BMDMs with PM or ve and measured (C) mRNA expression of Tnfa, Il6 and Il1b (qPCR). and (D) protein levels of IL-6 and TNFα in media (ELISA). IL-1β protein was not detectable. (E, F) We treated WT and Acod1-/- BMDMs with LPS (100 ng/ml) or PBS (control) and measured (E) mRNA expression of Tnfa, Il6 and Il1b (qPCR). and (F) protein levels of IL-6, TNFα, and IL-1β in media (ELISA, n = 4). Significance was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons *p<0.05, **p<0.01, ***p<0.001.

Endogenous and exogenous Itaconate have different effects on transcriptomic changes in response to PM.
(A) PCA plot showing top 500 of 10,250 low expression removed gene features in WT or Acod1-/-BMDMs treated with PM and/or OI for 24 hours. (B–C) Volcano plots showing differentially expressed genes (DEGs) in (B) PM-treated Acod1-/- BMDMs compared with PM-treated WT BMDMs (51 DEGs), and (C) OI and PM-treated WT BMDMs compared with only PM-treated WT BMDMs (1,030 DEGs). DEGs were identified using DESeq2 at FC > 2 and FDR adjusted p-value of p<0.05. Dark gray points represent significantly different genes; light gray points represent not significantly different genes. Inflammatory genes (orange) and NRF2 target genes (turquoise) were not significantly different between WT and Acod1-/- BMDMs, while OI-pretreated BMDMs significantly expressed fewer inflammatory genes and more NRF2 target genes compared to BMDMs without OI pretreatment.
-
Figure 6—source data 1
Table of gene feature counts for all samples as generated using featureCounts.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig6-data1-v2.txt
-
Figure 6—source data 2
Differential expression analysis results of PM treated Acod1-/- BMDMs compared with PM treated WT BMDMs.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig6-data2-v2.txt
-
Figure 6—source data 3
Differential expression analysis results of OI and PM treated BMDMs compared with only PM treated BMDMs.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig6-data3-v2.txt

Acod1 and endogenous Itaconate production is not required for PM and LPS-induced activation of NRF2 pathway.
(A, B) We treated WT and Acod1-/- BMDMs with PM for 24 hours and measured (A) protein expression of NRF2 (Western blot) and (B) mRNA expression of NRF2 target genes Nqo1, Hmox1 and Gclm (qPCR). NRF2 protein and target genes are unchanged between WT and Acod1-/- (C, D) We treated WT and Acod1-/- BMDMs with LPS (100 ng/ml) for 24 hours and measured (C) protein expression of NRF2 (Western blot) and (D) mRNA expression of NRF2 target genes Nqo1, Hmox1 and Gclm (qPCR). NRF2 protein is not different between WT and Acod1-/- cells. (E) We treated WT BMDMs with LPS for 4, 8, and 24 hours and measured protein expression of NRF2 and ACOD1 (Western blot) over time. Dimethyl fumarate (DMF, 0.1 mM) was used as a positive control for NRF2 expression. The expression of NRF2 precedes ACOD1 and the peak expression of NRF2 occurs before the peak expression of ACOD1. Significance of qPCR data was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, *p<0.05, **p<0.01, ***p<0.001.

NRF2 is not required for the anti-inflammatory effects of exogenous itaconate (OI) on PM-induced inflammatory response.
(A) Western blot showing upregulation of NRF2 protein following 2 hours of OI pretreatment (0.25 mM) followed by 4 hours of PM (20 µg/cm2) treatment. The combination of OI and PM further increased NRF2 activation. (B) qPCR of NRF2 target genes (Nqo1, Gclm, and Hmox1) in WT BMDMs treated with PM for 4 hours, with or without OI pretreatment (0.25 mM, for 2 hours). (C) BMDMs transfected with scramble control siRNA or Nfe2l2 siRNA (#1), Western blot analysis of control siRNA and Nfe2l2 siRNA (#1)-transfected BMDMs following 4 hours of PM treatment to induce NRF2 protein. (D) qPCR of pro-inflammatory cytokine genes (Tnfa, Il6 and Il1b) in Nfe2l2 siRNA-transfected BMDMs treated with OI (2 hours of pretreatment) and PM (4 hours). Significance of qPCR was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, *p<0.05, **p<0.01, ***p<0.001.

NRF2 is not required for the anti-inflammatory effects of exogenous itaconate (OI) on PM-induced inflammatory response.
(A) Western blot of NRF2 protein in BMDMs transfected with scramble control or Nfe2l2 siRNA (#2), then treated with PM (20 µg/cm2) for 4 hours. NRF2 protein is induced by PM in cells with control siRNA, but not with Nfe2l2 siRNA. (B) qPCR of pro-inflammatory cytokine genes (Tnfa, Il6 and Il1b) in control or Nrf2 siRNA (#2) transfected BMDMs treated with PM (20 µg/cm2) for 4 hours, with or without OI pretreatment (0.25 mM, for 2 hours). Significance of qPCR was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, n = 3; *p<0.05, **p<0.01, ***p<0.001.

NRF2 is not required for the anti-inflammatory response of exogenous itaconate (OI) on LPS-induced inflammatory response.
(A–B) qPCR of (A) proinflammatory cytokine (Tnfa, Il6 and Il1b) genes and (B) NRF2 target genes (Nqo1, Gclm, and Hmox1) in WT BMDMs treated with LPS (100 ng/ml, 4 hours), with or without OI pretreatment (0.25 mM, 2 hours). (C) qPCR of pro-inflammatory cytokine genes (Tnfa, Il6 and Il1b) in control or Nfe2l2 siRNA (#1)-transfected BMDMs treated with LPS for 4 hours, with or without OI pretreatment (0.25 mM, 2 hours). Significance of qPCR was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, n = 3; *p<0.05, **p<0.01, ***p<0.001.

NRF2 is not required for the anti-inflammatory effects of exogenous itaconate (OI) on LPS-induced inflammatory response.
qPCR of pro-inflammatory cytokine genes (Tnfa, Il6 and Il1b) in control or Nfe2l2 siRNA (#2) transfected BMDMs treated with LPS for 4 hours, with or without OI pretreatment (0.25 mM, for 2 hours). Significance of qPCR was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, n = 3; *p<0.05, **p<0.01, ***p<0.001.

Acod1 and Itaconate are not required for PM-induced inflammation in an in vivo model of PM exposure.
WT and Acod1-/-mice were treated intratracheally with PM (100 μg) or PBS and 24 hours later, bronchoalveolar lavage (BAL) fluid was collected to obtain alveolar macrophages and cytokine levels in fluid. (A) Acod1 gene expression is induced in alveolar macrophages by in vivo PM treatment in WT mice as measured by qPCR. (B) Inflammatory genes (Il6, Tnfa, Il1b) as measured by qPCR were equally upregulated by PM treatment in vivo in both WT and Acod1-/- mice. (C) Cytokine levels of IL-6 and TNFα in BAL fluid as measured by ELISA; IL-6 and TNFα levels increase equally with PM treatment in both WT and Acod1-/- mice. (D) NRF2 target genes (Nqo1, Gclm, Hmox1) were upregulated with PM treatment as measured by qPCR, with no difference between WT and Acod1-/- mice. Significance was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, n = 6; *p<0.05, **p<0.01, ***p<0.001.

Acod1 and Itaconate are not required for PM-induced inflammatory response in tissue resident alveolar macrophages.
Primary tissue resident alveolar macrophages were isolated from WT and Acod1-/- mice and cultured in vitro for 2 hours before treatment with PM (20 µg/cm2) for 24 hours. Gene expression was measured by qPCR. (A) Acod1 gene expression is significantly induced by PM treatment only in WT alveolar macrophages. (B) Inflammatory genes (Il6, Tnfa, Il1b) were equally upregulated by PM treatment in both WT and Acod1-/-alveolar macrophages. (C) Cytokine levels of IL-6 and TNFα in media as measured by ELISA; IL-6 and TNFα levels increase with PM treatment in both WT and Acod1-/-alveolar macrophages equally. (D) NRF2 target genes (Nqo1, Gclm, Hmox1) were upregulated with PM treatment as measured by qPCR, with no difference between WT and Acod1-/- cells. Significance was analyzed with one-way ANOVA corrected with Bonferroni’s post hoc test for multiple comparisons, *p<0.05, **p<0.01, ***p<0.001.
Tables
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (M. musculus) | Acod1 | Aconitate decarboxylase 1; Irg1 | ||
Strain, strain background (M. musculus) | C57BL/6NJ (WT) | Jackson Laboratory | Stock No. 005304 | Male (7–11 weeks) |
Strain, strain background (M. musculus) | C57BL/6NJ-Acod1em1(IMPC)J/J (Acod1 KO) | Jackson Laboratory | Stock No. 029340, RRID:IMSR_JAX:029340 | Male (7–11 weeks) |
Transfected construct (M. musculus) | Non-targeting siRNA | Dharmacon | D-001810-01-05 | |
Transfected construct (M. musculus) | Nfe2l2 siRNA #1 | Dharmacon | J-040766-08-0002 | |
Transfected construct (M. musculus) | Nfe2l2 siRNA #2 | Dharmacon | J-040766-06-0002 | |
Antibody | Anti-β-actin (mouse, monoclonal) | Sigma Aldrich | Catalog #: A5441, RRID:AB_476744 | WB (1:10,000) |
Antibody | Anti-ACOD1 (rabbit, polyclonal) | Thermo Fisher Scientific | Catalog #: PA5-49094, RRID:AB_2634550 | WB (1:500) |
Antibody | Anti-NRF2 (rabbit, monoclonal) | Abcam | Catalog #: Ab62352, RRID:AB_944418 | WB (1:1000) |
Antibody | Anti-iNOS (rabbit, polyclonal) | Cell Signaling Technology | Catalog #: 2982, RRID:AB_1078202 | WB (1:1000) |
Antibody | Anti-rabbit IgG, HRP-linked Antibody | Cell Signaling Technology | Catalog #: 7074, RRID:AB_2099233 | WB (1:2000) |
Antibody | Anti-mouse IgG, HRP-linked Antibody | Cell Signaling Technology | Catalog #: 7076, RRID:AB_330924 | WB (1:2000) |
Sequence-based reagent | RPL13a_F | This paper | PCR Primers | GAGGTCGGGTGGAAGTACCA |
Sequence-based reagent | RPL13a_R | This paper | PCR Primers | TGCATCTTGGCCTTTTCCTT |
Sequence-based reagent | Acod1_F | This paper | PCR Primers | TTTGGGGTCGACCAGACTTC |
Sequence-based reagent | Acod1_R | This paper | PCR Primers | CCATGGAGTGAACAGCAACAC |
Sequence-based reagent | Il6_F | This paper | PCR Primers | TCCTCTCTGCAAGAGACTTCC |
Sequence-based reagent | Il6_R | This paper | PCR Primers | AGTCTCCTCTCCGGACTTGT |
Sequence-based reagent | Tnfa_F | This paper | PCR Primers | ATGGCCTCCCTCTCATCAGT |
Sequence-based reagent | Tnfa_R | This paper | PCR Primers | TGGTTTGCTACGACGTGGG |
Sequence-based reagent | Il1b_F | This paper | PCR Primers | GCCACCTTTTGACAGTGATGA |
Sequence-based reagent | Il1b_R | This paper | PCR Primers | GACAGCCCAGGTCAAAGGTT |
Sequence-based reagent | Nqo1_F | This paper | PCR Primers | GGTAGCGGCTCCATGTACTC |
Sequence-based reagent | Nqo1_R | This paper | PCR Primers | CGCAGGATGCCACTCTGAAT |
Sequence-based reagent | Gclm_F | This paper | PCR Primers | AGTTGACATGGCATGCTCCG |
Sequence-based reagent | Gclm_R | This paper | PCR Primers | CCATCTTCAATCGGAGGCGA |
Sequence-based reagent | Hmox1_F | This paper | PCR Primers | GAGCAGAACCAGCCTGAACT |
Sequence-based reagent | Hmox1_R | This paper | PCR Primers | AAATCCTGGGGCATGCTGTC |
Sequence-based reagent | Nos2_F | This paper | PCR Primers | TTCACAGCTCATCCGGTACG |
Sequence-based reagent | Nos2_R | This paper | PCR Primers | TCGATGCACAACTGGGTGAA |
Commercial assay or kit | Direct-zol RNA Miniprep Kits | Zymo Research | R2053 | |
Commercial assay or kit | Mouse IL-6 DuoSet ELISA | R and D Systems | DY406 | |
Commercial assay or kit | Mouse TNF-alpha DuoSet ELISA | R and D Systems | DY410 | |
Commercial assay or kit | Seahorse XFe24 FluxPak | Agilent | 102340–100 | |
Commercial assay or kit | Seahorse XF Plasma Membrane Permeabilizer | Agilent | 102504–100 | |
Commercial assay or kit | Mouse Macrophage Nucleofector Kit | Lonza | VPA-1009 | |
Chemical compound, drug | 4-Octyl Itaconate | Sigma Aldrich | SML2338 | |
Chemical compound, drug | Itaconic Acid | Sigma Aldrich | I29204 | |
Chemical compound, drug | Malonic Acid | Sigma Aldrich | M1296 | |
Chemical compound, drug | Pyruvic Acid | Sigma Aldrich | 107360 | |
Chemical compound, drug | Malic Acid | Sigma Aldrich | 02288 | |
Chemical compound, drug | Succinic Acid | Sigma Aldrich | S3674 | |
Chemical compound, drug | Particulate Matter (PM) | NIST | Urban Dust - SRM 1649a | |
Chemical compound, drug | Lipopolysaccharide | Santa Cruz | sc-3535 | |
Chemical compound, drug | Oligomycin | Fisher Scientific | 49-545-510MG | |
Chemical compound, drug | FCCP | Sigma Aldrich | C2920 | |
Chemical compound, drug | Antimycin A | Sigma Aldrich | A8674 | |
Chemical compound, drug | Rotenone | Sigma Aldrich | R8875 | |
Chemical compound, drug | Recombinant Mouse M-CSF | BioLegend | 576408 | |
Software, algorithm | Prism 8 | GraphPad | RRID:SCR_002798 | |
Software, algorithm | FastQC | Babraham Institute | RRID:SCR_014583 | |
Software, algorithm | STAR | PMID:23104886 | RRID:SCR_015899 | |
Software, algorithm | Picard | Broad Institute | RRID:SCR_006525 | |
Software, algorithm | RSeQC | PMID:22743226 | RRID:SCR_005275 | |
Software, algorithm | FeatureCounts | WEHI | RRID:SCR_012919 | |
Software, algorithm | DESeq2 | Bioconductor | RRID:SCR_015687 |
Additional files
-
Source code 1
R code for differential expression analysis (DESeq2).
- https://cdn.elifesciences.org/articles/54877/elife-54877-code1-v2.r
-
Source code 2
R code for differential expression analysis.
- https://cdn.elifesciences.org/articles/54877/elife-54877-code2-v2.r
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/54877/elife-54877-transrepform-v2.docx