Endogenous itaconate is not required for particulate matter-induced NRF2 expression or inflammatory response
- Department of Medicine, Section of Pulmonary and Critical Care Medicine, The University of Chicago, United States
- Center for Research Bioinformatics, The University of Chicago, United States
Figures
Figure 1
Aconitate Decarboxylase 1 (Acod1) is highly upregulated by particulate matter in macrophages.
(A) We performed RNA-seq in BMDMs treated with either PM (20 μg/cm2) or vehicle control for 24 hours. Gene ontology analysis highlight the pathways involved with PM treatment. (B) Volcano plot of …
-
Figure 1—source data 1
Differential expression analysis results of PM treated BMDMs compared with Control BMDMs.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig1-data1-v2.txt
Figure 2
Itaconate decreases oxygen consumption rate via inhibition of complex II, succinate dehydrogenase (SDH).
(A) We measured oxygen consumption rate (OCR) in permeabilized BMDMs (using XF plasma membrane permeabilizer) in the presence of ETC complex II substrate (succinate, 10 mM) and complex I inhibitor …
Figure 3
The effect of PM on mitochondrial oxygen consumption is time dependent.
(A) We performed a mitochondrial stress test to measure OCR and ECAR in BMDMs at (A) 1 hour or (B) 24 hours following treatment with PM (20 μg/cm2) or control vehicle control. Oligomycin (ATP …
Figure 4 with 1 supplement
Acod1 and endogenous itaconate production is required for PM-reduced mitochondrial OCR via inhibition of SDH.
(A) Heatmap of intracellular levels of TCA cycle metabolites and itaconate at 24 hours following treatment with PM. (B–C) Intracellular concentrations of (B) itaconate and (C) succinate in WT and Aco…
Figure 4—figure supplement 1
Inducible Nitric Oxide Synthase (iNOS) is induced by LPS but no by PM.
(A) Western blot of BMDMs treated with PM (20 µg/cm2) or LPS (100 ng/ml) for 0, 4, 8 or 24 hours. iNOS protein is not evident with PM treatment at any time point, but it is detectable with 24 hours …
Figure 5
Exogenous but not endogenous itaconate decreases PM-induced inflammation.
(A) We treated WT BMDMs with PM for 4, 8 or 24 hours and measured mRNA expression of Tnfa, Il6 and Il1b by qPCR (n = 3). (B) We pretreated WT BMDMs with OI or vehicle control (DMSO) for 2 hours …
Figure 6
Endogenous and exogenous Itaconate have different effects on transcriptomic changes in response to PM.
(A) PCA plot showing top 500 of 10,250 low expression removed gene features in WT or Acod1-/-BMDMs treated with PM and/or OI for 24 hours. (B–C) Volcano plots showing differentially expressed genes …
-
Figure 6—source data 1
Table of gene feature counts for all samples as generated using featureCounts.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig6-data1-v2.txt
-
Figure 6—source data 2
Differential expression analysis results of PM treated Acod1-/- BMDMs compared with PM treated WT BMDMs.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig6-data2-v2.txt
-
Figure 6—source data 3
Differential expression analysis results of OI and PM treated BMDMs compared with only PM treated BMDMs.
- https://cdn.elifesciences.org/articles/54877/elife-54877-fig6-data3-v2.txt
Figure 7
Acod1 and endogenous Itaconate production is not required for PM and LPS-induced activation of NRF2 pathway.
(A, B) We treated WT and Acod1-/- BMDMs with PM for 24 hours and measured (A) protein expression of NRF2 (Western blot) and (B) mRNA expression of NRF2 target genes Nqo1, Hmox1 and Gclm (qPCR). NRF2 …
Figure 8 with 1 supplement
NRF2 is not required for the anti-inflammatory effects of exogenous itaconate (OI) on PM-induced inflammatory response.
(A) Western blot showing upregulation of NRF2 protein following 2 hours of OI pretreatment (0.25 mM) followed by 4 hours of PM (20 µg/cm2) treatment. The combination of OI and PM further increased …
Figure 8—figure supplement 1
NRF2 is not required for the anti-inflammatory effects of exogenous itaconate (OI) on PM-induced inflammatory response.
(A) Western blot of NRF2 protein in BMDMs transfected with scramble control or Nfe2l2 siRNA (#2), then treated with PM (20 µg/cm2) for 4 hours. NRF2 protein is induced by PM in cells with control …
Figure 9 with 1 supplement
NRF2 is not required for the anti-inflammatory response of exogenous itaconate (OI) on LPS-induced inflammatory response.
(A–B) qPCR of (A) proinflammatory cytokine (Tnfa, Il6 and Il1b) genes and (B) NRF2 target genes (Nqo1, Gclm, and Hmox1) in WT BMDMs treated with LPS (100 ng/ml, 4 hours), with or without OI …
Figure 9—figure supplement 1
NRF2 is not required for the anti-inflammatory effects of exogenous itaconate (OI) on LPS-induced inflammatory response.
qPCR of pro-inflammatory cytokine genes (Tnfa, Il6 and Il1b) in control or Nfe2l2 siRNA (#2) transfected BMDMs treated with LPS for 4 hours, with or without OI pretreatment (0.25 mM, for 2 hours). …
Figure 10 with 1 supplement
Acod1 and Itaconate are not required for PM-induced inflammation in an in vivo model of PM exposure.
WT and Acod1-/-mice were treated intratracheally with PM (100 μg) or PBS and 24 hours later, bronchoalveolar lavage (BAL) fluid was collected to obtain alveolar macrophages and cytokine levels in …
Figure 10—figure supplement 1
Acod1 and Itaconate are not required for PM-induced inflammatory response in tissue resident alveolar macrophages.
Primary tissue resident alveolar macrophages were isolated from WT and Acod1-/- mice and cultured in vitro for 2 hours before treatment with PM (20 µg/cm2) for 24 hours. Gene expression was measured …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (M. musculus) | Acod1 | Aconitate decarboxylase 1; Irg1 | ||
| Strain, strain background (M. musculus) | C57BL/6NJ (WT) | Jackson Laboratory | Stock No. 005304 | Male (7–11 weeks) |
| Strain, strain background (M. musculus) | C57BL/6NJ-Acod1em1(IMPC)J/J (Acod1 KO) | Jackson Laboratory | Stock No. 029340, RRID:IMSR_JAX:029340 | Male (7–11 weeks) |
| Transfected construct (M. musculus) | Non-targeting siRNA | Dharmacon | D-001810-01-05 | |
| Transfected construct (M. musculus) | Nfe2l2 siRNA #1 | Dharmacon | J-040766-08-0002 | |
| Transfected construct (M. musculus) | Nfe2l2 siRNA #2 | Dharmacon | J-040766-06-0002 | |
| Antibody | Anti-β-actin (mouse, monoclonal) | Sigma Aldrich | Catalog #: A5441, RRID:AB_476744 | WB (1:10,000) |
| Antibody | Anti-ACOD1 (rabbit, polyclonal) | Thermo Fisher Scientific | Catalog #: PA5-49094, RRID:AB_2634550 | WB (1:500) |
| Antibody | Anti-NRF2 (rabbit, monoclonal) | Abcam | Catalog #: Ab62352, RRID:AB_944418 | WB (1:1000) |
| Antibody | Anti-iNOS (rabbit, polyclonal) | Cell Signaling Technology | Catalog #: 2982, RRID:AB_1078202 | WB (1:1000) |
| Antibody | Anti-rabbit IgG, HRP-linked Antibody | Cell Signaling Technology | Catalog #: 7074, RRID:AB_2099233 | WB (1:2000) |
| Antibody | Anti-mouse IgG, HRP-linked Antibody | Cell Signaling Technology | Catalog #: 7076, RRID:AB_330924 | WB (1:2000) |
| Sequence-based reagent | RPL13a_F | This paper | PCR Primers | GAGGTCGGGTGGAAGTACCA |
| Sequence-based reagent | RPL13a_R | This paper | PCR Primers | TGCATCTTGGCCTTTTCCTT |
| Sequence-based reagent | Acod1_F | This paper | PCR Primers | TTTGGGGTCGACCAGACTTC |
| Sequence-based reagent | Acod1_R | This paper | PCR Primers | CCATGGAGTGAACAGCAACAC |
| Sequence-based reagent | Il6_F | This paper | PCR Primers | TCCTCTCTGCAAGAGACTTCC |
| Sequence-based reagent | Il6_R | This paper | PCR Primers | AGTCTCCTCTCCGGACTTGT |
| Sequence-based reagent | Tnfa_F | This paper | PCR Primers | ATGGCCTCCCTCTCATCAGT |
| Sequence-based reagent | Tnfa_R | This paper | PCR Primers | TGGTTTGCTACGACGTGGG |
| Sequence-based reagent | Il1b_F | This paper | PCR Primers | GCCACCTTTTGACAGTGATGA |
| Sequence-based reagent | Il1b_R | This paper | PCR Primers | GACAGCCCAGGTCAAAGGTT |
| Sequence-based reagent | Nqo1_F | This paper | PCR Primers | GGTAGCGGCTCCATGTACTC |
| Sequence-based reagent | Nqo1_R | This paper | PCR Primers | CGCAGGATGCCACTCTGAAT |
| Sequence-based reagent | Gclm_F | This paper | PCR Primers | AGTTGACATGGCATGCTCCG |
| Sequence-based reagent | Gclm_R | This paper | PCR Primers | CCATCTTCAATCGGAGGCGA |
| Sequence-based reagent | Hmox1_F | This paper | PCR Primers | GAGCAGAACCAGCCTGAACT |
| Sequence-based reagent | Hmox1_R | This paper | PCR Primers | AAATCCTGGGGCATGCTGTC |
| Sequence-based reagent | Nos2_F | This paper | PCR Primers | TTCACAGCTCATCCGGTACG |
| Sequence-based reagent | Nos2_R | This paper | PCR Primers | TCGATGCACAACTGGGTGAA |
| Commercial assay or kit | Direct-zol RNA Miniprep Kits | Zymo Research | R2053 | |
| Commercial assay or kit | Mouse IL-6 DuoSet ELISA | R and D Systems | DY406 | |
| Commercial assay or kit | Mouse TNF-alpha DuoSet ELISA | R and D Systems | DY410 | |
| Commercial assay or kit | Seahorse XFe24 FluxPak | Agilent | 102340–100 | |
| Commercial assay or kit | Seahorse XF Plasma Membrane Permeabilizer | Agilent | 102504–100 | |
| Commercial assay or kit | Mouse Macrophage Nucleofector Kit | Lonza | VPA-1009 | |
| Chemical compound, drug | 4-Octyl Itaconate | Sigma Aldrich | SML2338 | |
| Chemical compound, drug | Itaconic Acid | Sigma Aldrich | I29204 | |
| Chemical compound, drug | Malonic Acid | Sigma Aldrich | M1296 | |
| Chemical compound, drug | Pyruvic Acid | Sigma Aldrich | 107360 | |
| Chemical compound, drug | Malic Acid | Sigma Aldrich | 02288 | |
| Chemical compound, drug | Succinic Acid | Sigma Aldrich | S3674 | |
| Chemical compound, drug | Particulate Matter (PM) | NIST | Urban Dust - SRM 1649a | |
| Chemical compound, drug | Lipopolysaccharide | Santa Cruz | sc-3535 | |
| Chemical compound, drug | Oligomycin | Fisher Scientific | 49-545-510MG | |
| Chemical compound, drug | FCCP | Sigma Aldrich | C2920 | |
| Chemical compound, drug | Antimycin A | Sigma Aldrich | A8674 | |
| Chemical compound, drug | Rotenone | Sigma Aldrich | R8875 | |
| Chemical compound, drug | Recombinant Mouse M-CSF | BioLegend | 576408 | |
| Software, algorithm | Prism 8 | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | FastQC | Babraham Institute | RRID:SCR_014583 | |
| Software, algorithm | STAR | PMID:23104886 | RRID:SCR_015899 | |
| Software, algorithm | Picard | Broad Institute | RRID:SCR_006525 | |
| Software, algorithm | RSeQC | PMID:22743226 | RRID:SCR_005275 | |
| Software, algorithm | FeatureCounts | WEHI | RRID:SCR_012919 | |
| Software, algorithm | DESeq2 | Bioconductor | RRID:SCR_015687 |
Additional files
-
Source code 1
R code for differential expression analysis (DESeq2).
- https://cdn.elifesciences.org/articles/54877/elife-54877-code1-v2.r
-
Source code 2
R code for differential expression analysis.
- https://cdn.elifesciences.org/articles/54877/elife-54877-code2-v2.r
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/54877/elife-54877-transrepform-v2.docx
