Opposing p53 and mTOR/AKT promote an in vivo switch from apoptosis to senescence upon telomere shortening in zebrafish
- Institute for Research on Cancer and Aging of Nice (IRCAN), Université Côte d’Azur, France
- Instituto Gulbenkian de Ciência, Portugal
Figures
Figure 1 with 3 supplements
Proliferative tissues of tert-/- zebrafish undergo an in vivo switch from apoptosis to senescence with age.
(A-B) Representative haematoxylin and eosin-stained sections of gut (scale bar: 40 µm) and testis (scale bar: 25 µm) from 3-month-old (A) or 9-month-old (B) of WT and tert-/- siblings. While no macroscopic tissue defects are distinguishable at 3 months (N = 3), 9 month tert-/- (N = 3) exhibit altered gut and testis structures. (C-D) Representative immunofluorescence images of apoptosis (TUNEL) or senescence (p15/16 and SA-β-GAL) of gut and testis from 3 month (C) or 6–9 month-old (D) WT and tert-/- siblings (N = 3–6 each)(scale bar: 25 µm). Dashed outlines locate cysts of spermogonia cells or spermatocytes (testis) or villi (gut). At 3 months, both tissues show an increased number of apoptotic cells in tert-/- compared to WT. At that age, no signs of senescence are visible in these tissues. However, senescent cells appear in the gut and testis of 6–9 month-old tert-/- fish depicting a switch between apoptosis and senescence. (E-F) Quantification of the percentage of TUNEL and p15/16 positive cells in 3 month and 6–9 month-old tert-/- or WT. Data are represented as mean ± SEM. * p-value<0.05; using the Mann-Whitney test.
-
Figure 1—source data 1
Quantification of TUNEL and p16 positive cells in gut, as plotted in Figure 1E.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Quantification of TUNEL and p16 positive cells in testis, as plotted in Figure 1F.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig1-data2-v1.xlsx
Figure 1—figure supplement 1
Anti-p16 antibody validation in zebrafish through antisense morpholino knock-down of cdkn2a/b (p15/16).
Representative Western blot of p15/16 using 4dpf larvae injected (at 1 cell-stage) with control, 2.4 ng (p15/16 Mo1) or 3.6 ng (p15/16 Mo2) of p15/16 antisense morpholinos. Dose-dependent decrease of p15/16 protein levels with p15/16 morpholinos confirm the specificity of anti-p16 (F-12) (1:50, Santa Cruz Biotechnology, sc-1661) for zebrafish p15/16 protein.
Figure 1—figure supplement 2
Bcl-XL is overexpressed in 9 month but not 3-month-old tert-/-.
RT-qPCR analysis of Bcl-XL in gut and testis of 3- or 9-month-old tert-/- or WT siblings (N = 6 fish). While no differences are seen at 3 months (A), Bcl-XL is overexpressed in 9-month-old (B) tert-/- gut and testis compared to WT. Graphs are representing mean ± SEM mRNA fold increase after normalisation to rpl13a gene expression levels (** p-value<0.01, using t-test).
-
Figure 1—figure supplement 2—source data 1
Real-time qPCR data of Bcl-XL, as plotted in Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig1-figsupp2-data1-v1.xlsx
Figure 1—figure supplement 3
Apoptosis and senescence cell fate is present in the same cell types of gut and testis.
(A) Representative immunofluorescence images of apoptosis (TUNEL) or senescence (p15/16 IF) of testis from 3 month or 6-month-old tert-/- fish. Dashed lines delimitate cysts containing spermatogonia A (A) or B (B); scale bar: 20 µm. Right panel depicts examples of every cell type identified (A: spermatogonia A; B: spermatogonia B; C: spermatocytes; D: spermatids/spermatozoids); scale bar: 2 µm. Cell types were identified by their nuclear size and morphology, presence and number of nucleoli, and number of cells per cyst. B) Representative immunofluorescence images of apoptosis (TUNEL) or senescence (p15/16) of gut from 3 month or 9-month-old tert-/- fish. Arrows represent enterocyte cells; asterisks show blood cells). Cell types were identified by cell morphology and location. Scale bars: 20 µm.
Figure 2
Quantification of senescence markers in gut and testis of older tert-/- zebrafish.
(A-B) Western blot analysis of DNA damage and senescence-associated proteins in gut and testis of 3 month (A) or 9-month-old (B) of WT and tert-/- siblings (N >= 5 fish). Representative western blot (left panel) and corresponding quantification (right panel) showing induction of DNA Damage Response (H2A.X-P and p53) in 3-month-old and senescence (p15/16) in 9-month-old tert-/- zebrafish. (C) RT-qPCR analysis of senescence associated genes p15/16 and p21. RT-qPCR graphs are representing mean ± SEM mRNA fold increase after normalisation by rpl13a gene expression levels (* p-value<0.05; ** p-value<0.01, using the Mann-Whitney test).
-
Figure 2—source data 1
Western Blot quantifications, as plotted in Figure 2A-B.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Real-time qPCR data of p15/16 and p21, as plotted in Figure 2C.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig2-data2-v1.xlsx
Figure 3 with 1 supplement
Gut and testis of tert-/- zebrafish are characterised by a time-dependent mitochondrial defects, increase of ROS levels and reduction of ATP levels.
Gut and testis of tert-/- exhibit a time dependent increase in ROS levels (A and D) and decrease of ATP levels (C and F) (N >= 3 fish per time point per genotype), determined by 2′,7′-Dichlorofluorescin diacetate (DCFDA) measurement and the CellTiter-Glo Luminescent Cell Viability Assay, respectively. Representative EM images (B and E) of these tissues at 9 months revealed fragmented mitochondrial ultrastructure (arrows) and rounded and swollen mitochondria denoting perturbed cristae (arrows) in tert-/- zebrafish (N = 3 fish). Data are represented as mean ± SEM (* p-value<0.05; ** p-value<0.01, using the Mann-Whitney test).
-
Figure 3—source data 1
ROS and ATP measurements, as plotted in Figure 3.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
PGC1a expression is not altered in tert-/- mutants compared to WT.
No differences are detected in PGC1a expression between tert-/- and WT gut at 3 and 9 months. (A) RT-qPCR and (B) representative Western blot analysis of PGC1a in gut of 3- and 9-month-old tert-/- or WT siblings (N = 3 fish). The graphs are representing mean ± SEM mRNA fold increase after normalisation by rpl13a gene expression levels.
-
Figure 3—figure supplement 1—source data 1
Real-time qPCR data of PGC1a, as plotted in Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig3-figsupp1-data1-v1.xlsx
Figure 4 with 2 supplements
Activation of AKT in older tert-/- mutants results in FoxO1/4 translocation to the cytoplasm and reduction of mitochondria OxPhos defenses.
(A) Activation of Akt leads to the inhibitory phosphorylation of FoxO1 and FoxO4 and corresponding reduction of SOD2 expression in 9-month-old tert-/- mutants. Western blot analysis for AKT-P, total AKT, FoxO1-P, FoxO4-P and SOD2 from gut extracts of 9-month-old tert-/- mutant and WT siblings (N >= 9). Representative western blot (left panel) and corresponding normalised quantification (right panel). Data are represented as mean ± SEM. * p-value<0.05; ** p-value<0.01 using the Mann-Whitney test. (B-F) Activation of Akt in older tert-/- mutant gut enterocytes leads to the translocation of FoxO1 from the nucleus to the cytoplasm and complementary accumulation p15/16 senescence marker. Total FoxO1 and p15/16 co-immunofluorescence staining in the gut of 9-month-old tert-/- and WT siblings. (B) Representative image of 9-month-old tert-/- gut. Red arrows: low nuclear FoxO1 levels in p15/16 positive cells; White arrows: high nuclear FoxO1 levels in p15/16 negative cells; scale bar: 20 µm. Dashed lines a and b depict the regions of fluorescence intensity quantification of cells analysed in D and C, respectively. (C-D) Histograms representing fluorescence quantification of DAPI, FoxO1 and p15/16 across a p15/16 positive (dashed line b) or p15/16 negative cells (dashed line a). (E) Cell analysis: High p15/16 correlates with low FoxO1 nuclear/cytoplasmic fluorescence intensity in each gut cell of tert-/- mutants. Analysis performed per cell basis (WT N = 3; tert-/- N = 2; at least 69 cells per genotype were analysed). (F) Fish analysis: On average, 9-month-old tert-/- fish (N = 2) contain more ‘low FoxO1/high p15/16’ cells than WT siblings (N = 3). Data are represented as mean per sample. p-values were calculated using a 2-factor ANOVA test.
-
Figure 4—source data 1
Western Blot quantifications, as plotted in Figure 4A.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig4-data1-v1.xlsx
-
Figure 4—source data 2
Mean (nuclear/cytoplasmic) p15/16 or FoxO1 fluorescence intensity per cell, as plotted in Figure 4E.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig4-data2-v1.xlsx
-
Figure 4—source data 3
Mean (nuclear/cytoplasmic) p15/16 or FoxO1 fluorescence intensity per cell, as plotted in Figure 4F.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig4-data3-v1.xlsx
-
Figure 4—source data 4
Western Blot quantifications, as plotted in Figure 4—figure supplement 1–2.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig4-data4-v1.xlsx
Figure 4—figure supplement 1
Activation of AKT in older tert-/- mutants testis results in SOD2 reduction.
Activation of Akt leads to reduction of SOD2 expression in 9-month-old tert-/- mutants. Western blot analysis for p-Akt, total Akt, and SOD2 from testis extracts of 9-month-old tert-/- mutant and WT siblings (N >= 9). Representative western blot (left panel) and corresponding normalised quantification (right panel). Data are represented as mean ± SEM. (* p-value<0.05; ** p-value<0.01 using the Mann-Whitney test).
Figure 4—figure supplement 2
Akt pathway is not induced in young tert-/-compared to wild type.
Representative immunoblot of p-Akt and SOD2 and respective quantification from gut of 3-month-old tert mutant and WT siblings (N = 3). At 3 month, no differences are observed in p-Akt and SOD2 protein levels between tert-/- and WT siblings. Data are represented as mean ± SEM (ns - not significant, p>0.05, using the Mann-Whitney test).
Figure 5
Mutation of p53 prevents short telomeres-induced tissue degeneration, Akt activation, ROS accumulation and induction of senescence.
(A and E) Representative haematoxylin and eosin-stained sections of gut (A) (scale bar: 40 µm) and testis (E) (scale bar: 25 µm) from 6-month-old WT, tert-/-, tp53-/- and tert-/- tp53-/- siblings (N = 3 fish each);. Mutation of tp53 in tert-/- fish rescues short-telomere induced tissue defects. (B and F) Representative western blot analysis of AKT-p and SOD2 in gut (B) and testis (F) (N = 2 fish each). Mutation of tp53 in tert-/- fish prevents phosphorylation of AKT and downstream downregulation of SOD2 leading to a rescue of increased ROS levels (C and G; N = 3 fish per genotype). (D and H) Representative images of SA-β-GAL staining of gut (scale bar: 40 µm) (D) and testis (scale bar: 25 µm) (H) from 6 month-old WT, tert-/-, p53-/- and tert-/- p53-/- siblings (N = 3 fish). Data are represented as mean ± SEM (** p-value<0.01, using t-test).
-
Figure 5—source data 1
ROS levels measurements, as plotted in Figure 5.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig5-data1-v1.xlsx
Figure 6 with 2 supplements
Genetic and pharmacological inhibition of AKT prevents short telomere-induced senescence.
(A) Heterozygous mutation of zTOR counteracts telomere-shortening-induced Akt activation, leading to inhibition of p15/16 expression. Western blot analysis of AKT-P and (B) RT-qPCR analysis of p15/16 mRNA levels in 13-month-old gut of WT, tert-/-, ztor+/-and tert-/- ztor+/- fish (N = 3 fish). (C-F) Second generation (G2) tert-/- mutant larvae with extremely short telomeres show phenotypes associated with premature aging, as described in Figures 1, 2 and 3. (C) Representative images of SA-β-GAL staining of WT and second generation (G2) tert-/- mutant four dpf larvae. (D) RT-qPCR analysis of p15/16 mRNA levels (N = 6), E) Western blot analysis of AKT-P, SOD2, p15/16 (N = 4) and (F) ROS levels measurements determined by DCFDA assay (N = 3). G) Survival curve of G2 tert-/-upon NAC (40 µM from day 6 to 10) treatment (WT N = 31; WT+NAC N = 27; G2 tert-/- N = 61; G2 tert-/- +NAC N = 36 fish; ** p-value<0.01; ** p-value<0.01 using Log-Rank test). (H-J) Pharmacological inhibition of AKT rescues telomere-shortening induced p15/16 expression. (H) Experimental scheme of pharmacological inhibition of AKT in G2 tert-/-. (I) Western blot analysis of AKT-P and p15/16 and (J) RT-qPCR analysis of p15/16 mRNA levels of G2 tert-/- and WT treated with AKT inhibitor. All RT-qPCR graphs are representing mean ± SEM mRNA fold increase after normalisation to rpl13a gene expression levels (* p-value<0.05; ** p-value<0.01, using t-test).
-
Figure 6—source data 1
Real-time qPCR data of p15/16, as plotted in Figure 6B.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig6-data1-v1.xlsx
-
Figure 6—source data 2
Real-time qPCR data of p15/16, as plotted in Figure 6D and J.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig6-data2-v1.xlsx
-
Figure 6—source data 3
ROS levels measurements, as plotted in Figure 6F.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig6-data3-v1.xlsx
-
Figure 6—source data 4
Survival analysis upon NAC treatment, as plotted in Figure 6G.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig6-data4-v1.xlsx
Figure 6—figure supplement 1
ztor haploinsufficiency is not sufficient to suppress tissue defects in tert-/- zebrafish.
The absence of one copy of the ztor gene is not sufficient to rescue the morphological defects observed in the tert-/- at 13 months of age. (A and B) Representative haematoxylin and eosin-stained sections of gut (scale bar = 40 µm) (A) and testis (scale bar = 25 µm) (B) from 13-month-old WT, tert-/-, ztor+/- and tert-/- ztor +/- siblings (N = 3 fish each).
Figure 6—figure supplement 2
Pharmacological administration of ROS scavengers increases survival of G2 tert-/-.
Survival curve of G2 tert-/- upon MitoTempo (10 µM from day 3 to 5) treatment. (WT N = 26; WT+MitoTempo N = 35; G2 tert-/- N = 35: G2 tert-/- +MitoTempo N = 39 fish; * p-value<0.05 using Log-rank test).
-
Figure 6—figure supplement 2—source data 1
Survival analysis upon MitoTempo treatment, as plotted in Figure 6—figure supplement 2.
- https://cdn.elifesciences.org/articles/54935/elife-54935-fig6-figsupp2-data1-v1.xlsx
Figure 7
Opposing activities of p53 and mTOR/AKT upon telomere shortening promote a switch from apoptosis to senescence.
Early telomere shortening triggers p53-dependent apoptosis and inhibition of cell proliferation. At early age, apoptosis is the predominant cell fate and it mostly counterbalanced by compensatory proliferation of neighboring cells. However, inhibition of cell proliferation results in a progressive loss of tissue cellularity, eventually leading to tissue damage. As age progresses, loss of tissue homeostasis triggers the pro-proliferative mTOR/AKT pathway. Akt phosphorylates FoxO, inducing its translocation from the nucleus to the cytoplasm. Loss of FoxO transcriptional activity reduces mitochondrial SOD2 expression generating mitochondria oxidative stress through increased ROS levels. Mitochondrial dysfunction eventually triggers p15/16 expression and senescence becomes the predominant cell fate.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Danio rerio) | tert hu3430/+ | Hubrecht Institute, Utrecht, Netherland | RRID:ZFIN_ZDB-GENO-100412-50 | |
| Genetic reagent (Danio rerio) | tp53 M214K/+ | Berghmans et al., 2005 | RRID:ZDB-ALT-050428-2 | |
| Genetic reagent (Danio rerio) | ztor xu015Gt/+ | Ding et al., 2011 | RRID:ZDB-ALT-120412-1 | |
| Gene (Danio rerio) | tert | ZDB-GENE-080405–1 | ||
| Gene (Danio rerio) | tp53 | ZDB-GENE-990415–270 | ||
| Gene (Danio rerio) | ztor | ZDB-GENE-030131–2974 | ||
| Gene (Danio rerio) | cdkn2a/b (p15/16) | ZDB-GENE-081104–306 | ||
| Gene (Danio rerio) | cdkn1a (p21) | ZDB-GENE-070705–7 | ||
| Gene (Danio rerio) | bcl2l1 (Bcl-XL) | ZDB-GENE-010730–1 | ||
| Gene (Danio rerio) | ppargc1a (PGC1a) | ZDB-GENE-080505–1 | ||
| Gene (Danio rerio) | rpl13a | ZDB-GENE-030131–168 | ||
| Antibody | anti-p16 (mouse monoclonal; F-12) | Santa Cruz Biotechnology | #Sc-1661; RRID:AB_628067 | IF(1:50), WB (1:700) |
| Antibody | anti-FoxO1 (rabbit monoclonal; C29H4) | Cell Signaling Technology | #2880; RRID:AB_2106495 | IF(1:50) |
| Antibody | anti-zebrafish p53 (rabbit polyclonal) | Anaspec | #55342; RRID:AB_2287635 | WB (1:1000) |
| Antibody | anti-zebrafish γH2AX (rabbit polyclonal) | GeneTex | #GTX127342; RRID:AB_2833105 | WB (1:1000) |
| Antibody | anti-SOD2 (rabbit polyclonal) | Sigma-Aldrich | #SAB2701618; RRID:AB_2833106 | WB (1:1000) |
| Antibody | anti-phospho-Akt, Ser473 (rabbit monoclonal; D9E) | Cell Signaling Technology | #4060; RRID:AB_2315049 | WB (1:1000) |
| Antibody | anti-total-Akt (rabbit polyclonal) | Cell Signaling Technology | #9272, RRID:AB_329827 | WB (1:1000) |
| Antibody | anti-phospho-FoxO1, Ser256 (rabbit polyclonal) | Cell Signaling Technology | #9461; RRID:AB_329831 | WB (1:100) |
| Antibody | anti-tubulin (mouse monoclonal; B-5-1-2) | Sigma | #T6074; RRID:AB_477582 | WB (1:5000) |
| Antibody | Alexa Fluor 568 goat anti-mouse (goat polyclonal) | Invitrogen | #A11004; RRID:AB_2534072 | IF (1:500) |
| Antibody | Alexa Fluor 488 goat anti-rabbit (goat polyclonal) | Invitrogen | #A11008; RRID:AB_143165 | IF (1:500) |
| Antibody | HRP- anti-rabbit (goat polyclonal) | Santa Cruz | #Sc2054; RRID:AB_631748 | WB (1:5000) |
| Antibody | HRP- anti-mouse (goat polyclonal) | Santa Cruz | #Sc2005; RRID:AB_631736 | WB (1:5000) |
| Sequence-based reagent | cdkn2a/b (p15/16) Fw | This paper | PCR primers | GAGGATGAACTGACCACAGCA |
| Sequence-based reagent | cdkn2a/b (p15/16) Rv | This paper | PCR primers | CAAGAGCCAAAGGTGCGTTAC |
| Sequence-based reagent | bcl2l1 (Bcl-XL) Fw | This paper | PCR primers | GGGCTTGTTTGCTTGGTTGA |
| Sequence-based reagent | bcl2l1 (Bcl-XL) Rv | This paper | PCR primers | AGAACACAGTGCACACCCTT |
| Sequence-based reagent | cdkn1a (p21) Fw | This paper | PCR primers | CAGCGGGTTTACAGTTTCAGC |
| Sequence-based reagent | cdkn1a (p21) Rv | This paper | PCR primers | TGAACGTAGGATCCGCTTGT |
| Sequence-based reagent | ppargc1a (PGC1a) Fw | This paper | PCR primers | CTGTGGAACCCCAGGTCTGAC |
| Sequence-based reagent | ppargc1a (PGC1a) Rv | This paper | PCR primers | ACTCAGCCTGGGCCTTTTGCT |
| Sequence-based reagent | rpl13a Fw | Henriques et al., 2013 | PCR primers | TCTGGAGGACTGTAAGAGGTATG |
| Sequence-based reagent | rpl13a Rv | Henriques et al., 2013 | PCR primers | AGACGCACAATCTTGAGAGCAG |
| Sequence-based reagent | cdkn2a/b (p15/16) Morpholino | This paper | morpholino | TCAGTTCATCCTCGACGTTCATCAT |
| Sequence-based reagent | Control Morpholino | GeneTools | morpholino | CCTCTTACCTCAGTTACAATTTATA |
| Commercial assay or kit | In Situ Cell Death Detection Kit, Fluorescein | Roche | 11684795910 | |
| Commercial assay or kit | CellTiter-Glo Luminescent Cell Viability Assay | Promega | G7570 | |
| Chemical compound, drug | 2′,7′-Dichlorofluorescin diacetate (DCFDA) | Sigma Aldrich | D6883 | |
| Chemical compound, drug | AKT1/2 kinase inhibitor | Santa Cruz | sc-300173 | |
| Chemical compound, drug | N-Acetyl-L-Cysteine (NAC) | Sigma Aldrich | A7250 | |
| Chemical compound, drug | MitoTEMPO | Sigma Aldrich | SML0737 | |
| Other | DAPI stain | Sigma | D9542 | (0.5 µg/mL) |
Additional files
-
Supplementary file 1
List of primers used in RT-qPCR expression analysis.
Table listing the oligo-nucleotides used as primers for the RT-qPCR performed in this study.
- https://cdn.elifesciences.org/articles/54935/elife-54935-supp1-v1.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/54935/elife-54935-transrepform-v1.pdf
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Opposing p53 and mTOR/AKT promote an in vivo switch from apoptosis to senescence upon telomere shortening in zebrafish
eLife 9:e54935.
https://doi.org/10.7554/eLife.54935
