Figures and data in Condensin I subunit Cap-G is essential for proper gene expression during the maturation of post-mitotic neurons

Figures
Tables
Additional files

5 figures, 1 table and 1 additional file

Figures

Figure 1 with 1 supplement

Download asset Open asset

Cap-G expression in *Drosophila* neurons.

(A) Schematic representation of the *Drosophila* condensin I complex. (B) *w¹¹¹⁸* embryo (stage 15, anterior top). *Cap-G* mRNA is ubiquitously present in neuronal cytoplasm, neurons marked by Elav. (C) *Cap-G^EGFP* embryo (stage 14, anterior top). Cap-G^EGFP co-localises with Lola-N in neuronal nuclei of the VNC. (D) Optic lobe of 3^rd instar larvae *Cap-G^EGFP*. Cap-G is strongly present in NSCs marked by Dpn. Cap-G is present in neurons (Elav positive) in proximity of NSCs (yellow arrowheads). Scale bars 10 µm.

Figure 1—figure supplement 1

Download asset Open asset

Cap-G^EGFP expression in neurons.

(A) Optic lobe of 3^rd instar larvae. *Cap-G mRNA* is ubiquitously expressed in the lobes. mCD8-GFP marks neuronal membrane. Zoom in of central brain section shows expression of *Cap-G mRNA* in neurons marked by elav-driven GFP expression. (B) Optic lobe of 3^rd instar *Cap-G^EGFP* larvae. Cap-G is strongly present in the Optic Proliferation centre and the Central brain (CB). Zoom in on CB shows Cap-G is present in neuronal nuclei as it overlaps with marker Elav. (C) *Barren^EGFP* embryo (stage 15). Barren^EGFP is present in all cells of the VNC, including Elav positive neurons. All images show ventral view of embryonic VNC (anterior -top). Scale bars = 10 µm.

Figure 2 with 3 supplements

Download asset Open asset

Cap-G knockdown in neurons results in premature developmental arrest and severe mobility defects.

(A) Effective knockdown of Cap-G^EGFP in neurons. Embryonic VNC (stage 14, anterior top) showing reduced Cap-G^EGFP levels in neurons marked by Elav in *elav-KD* compared to *Cap-G^EGFP* control. Cap-G^EGFP is still detected in NSCs marked by Dpn in both *Cap-G^EGFP* control and *elav-KD*. (B) Survival of developing flies recorded at pupal and adult stages. *Cap-G^EGFP* flies were used as the control genotype. Survival expressed as a percentage of the initial total number of embryos. 300 biological replicates/genotype. Logrank test and weighted Gehan-Breslow-Wilcoxon model (****, p<0.0001). (C) Survival of adult *nSyb*-KD and *Cap-G^EGFP* control recorded daily until all flies deceased. Survival expressed as a percentage of starting flies, 60 biological replicates/genotype. Logrank test and weighted Gehan-Breslow-Wilcoxon model (****, p<0.0001). (D) Locomotion assay of L3 larvae from three independent experiments. Control 1 = *Cap G^EGFP; UAS-deGradFP*. Control 2 = *elav-GAL4; Cap-G^EGFP*. Control 3 = *Cap G^EGFP; nSyb-GAL4*. Mean crawling speed from 10 technical replicates for each of the 30 biological replicates/genotype. Kruskal-Wallis test one-way ANOVA (****, p<0.0001). (E) Negative geotaxis assay from three independent experiments. Control 1 = *Cap G^EGFP; nSyb-GAL4*. Control 2 = *Cap G^EGFP; UAS-deGradFP*. Control 3 = *nSyb-GAL4; UAS-deGradFP*. Mean distance climbed from 10 technical replicates for each of the 30 biological replicates/genotype. Kruskal-Wallis test one-way ANOVA (****, p<0.0001).

Figure 2—figure supplement 1

Download asset Open asset

Characterisation of Cap-G knockdown with *elav-GAL4*.

(A) Quantification of Cap-G^EGFP protein levels in dividing cells in *Cap-G^EGFP* control and *elav-KD* embryonic VNC (stage 15 – anterior top). Pixel intensity thresholding was performed to produce images in which dividing cells were defined as regions of interest (ROI) whilst neurons (lower pixel intensity) were excluded from the analysis. The average pixel intensity of dividing cells is calculated for >30 cells/ embryo, with 10 biological replicates per genotype. No significant difference in Cap-G^EGFP levels, t-test (p=0.522). Number of mitotic cells (ROIs) remains constant. (B) Representative images showing Cap-G^EGFP in NSCs. Note that NSCs show variable Cap-G expression depending on cell-cycle stage. (C) Quantification of Cap-G^EGFP protein levels in NSCs normalised against Dpn signal. Y-axis displays ratio of EGFP/DPN average signal intensity per cell. The average pixel intensity is calculated for >70 cells/ embryo, with three biological replicates per genotype (*Cap-G^EGFP* control and *elav-KD*). No significant difference as per Nested t-test (p>0.05).

Figure 2—figure supplement 2

Download asset Open asset

Characterisation of Cap-G knockdown with *elav-GAL4*.

(**A-C**) Quantification of NSCs numbers and cell division in *Cap-G^EGFP* control and *elav-KD* individuals. Z-stacks of embryonic VNC stage 15 for *Cap-G^EGFP* and *elav-KD* were used. (A) Quantification of total number of NSCs marked by Dpn. (B) Quantification of total number of mitotic cells marked by pH3. (C) Quantification of total number of dividing NSCs as number of pH3+/Dpn+ cells. 10 replicates per genotype. No significant difference as per t-test (p>0.05). (D) Maximum Z-projection of stage 15 embryonic VNC for both *Cap-G^EGFP* and *elav-KD* showing quantified NSCs (Dpn) and dividing cells (pH3). Anterior left, posterior right. Scale bar 10 µm.

Figure 2—figure supplement 3

Download asset Open asset

Apoptosis in *elav-KD*.

(A) Staining for apoptotic cells in embryonic VNC stage 16 for *Cap-G^EGFP* (control) and *elav-KD.* Neurons marked in green by Elav and apoptotic cells in magenta by TUNEL staining. Anterior left, posterior right. Maximum Z-projection. Scale bar 10 µm. (**B-C**) Quantification of apoptosis in embryonic VNC stage 16 for *Cap-G^EGFP* and *elav-KD.* 10 replicates per genotype. (B) No significant difference in number of apoptotic non-neuronal cells (TUNEL +, Elav -) between *Cap-G^EGFP* control and *elav-KD.* (C) Significant difference in number of apoptotic neurons (TUNEL+, Elav +), t-test p=0.006. Outliers have been identified and removed using the Grubbs’ test.

Figure 3

Download asset Open asset

Cap-G knockdown leads to increased DNA damage in larval neurons.

(A) Larval optic lobes for *Cap-G^EGFP* controls and *Cap-G KD* genotypes. γ-H2Av indicates DNA damage, Cap-G signal is strongest in dividing cells. Scale bars 10 µm. (B) Quantification of γ-H2Av+ neurons as percentage of total γ-H2Av+ cells. 10 biological replicates per genotype. Kruskal-Wallis test one-way ANOVA (***, p<0.001). (C) Section of embryonic VNC (ventral view) stage 15 for all genotypes. Elav to mark neuronal nuclei and DAPI as nuclei stain. Control (*Cap-G^EGFP*), *elav-KD* and *nSyb-KD* genotypes. (D) Quantification of neuronal nuclei area. Pixel area average of at least 1000 cells per replicate was analysed. seven biological replicates per genotype. No statistical difference determined by one-way ANOVA (p>0.5).

Figure 4 with 2 supplements

Download asset Open asset

Cap-G binds to DNA in NSCs and neurons.

(A) Cap-G binding at example loci in NSCs (*wor-GAL4*), all neurons including immature neurons (*elav-GAL4*) and mature (*nSyb-GAL4*) neurons. Light grey boxes on the gene annotation tracks represent other genes. Horizontal grey bars on the data tracks indicate statistically significant peaks. Y-axes display normalised ratio of log₂ Cap-G-Dam/Dam. N.b. since TaDa data is normalised to Dam-only signal it is normal to observe ‘negative peaks’ at sites of depleted binding that have higher background Dam-only methylation. (B) Venn diagram showing unique genes bound by Cap-G and the total overlap between all cell types. (C) Genomic annotation of Cap-G peaks shows enrichment in gene bodies (introns and exons) whilst binding at non-coding regions are depleted. (D) Cap-G binding is depleted at known *Drosophila* Regulatory Elements (REDfly, http://redfly.ccr.buffalo.edu/index.php). Profiles plotted against centre of enhancer region and 10 Kb up/downstream. (E) Average Cap-G binding is depleted at accessible chromatin for all cell types. Plot shows 2 Kb up/downstream centre of an open chromatin region. Note that a subset of sites appear enriched for Cap-G binding (blue lines on heatmap) (F) Average Cap-G binding in different chromatin states in NSCs. Cap-G binding is enriched in repressive states (Black, HP1, TrxG-repressive, and PcG repressive), and depleted in permissive chromatin states (non-TrxG, TrxG, and PcG). Heatmap is shown for the most highly enriched ‘black’ state (non-HP1, non-PcG repressive state).

Figure 4—figure supplement 1

Download asset Open asset

Analysis of Cap-G binding.

(A) Scatterplots indicating correlation between replicates for each cell-type. (B) Principal component analysis indicating close relationship between replicates. (C) Average binding of Cap-G across scaled gene-regions (all genes). Binding is relatively increased within the gene body. (D) Cap-G binding at example loci. Light grey boxes on the gene annotation tracks represent other genes. Horizontal grey bars on the data tracks indicate statistically significant peaks. Note increased binding of Cap-G to *stg* upstream regulatory region and *ase* up and downstream regions in mature neurons. *Unc-89* (not expressed in CNS) shows strong Cap-G binding in all cell stages.

Figure 4—figure supplement 2

Download asset Open asset

Comparisons between chromatin accessibility and Cap-G binding.

(A) Correlation heatmap between Cap-G binding and Accessible Chromatin (AC) per cell type. Cap-G binding negatively correlates with AC in each cell type. Numbers represent Spearman’s rank correlation coefficient. Cap-G binding and AC samples cluster separately by k-means. (B) PCA of Cap-G binding and AC per cell type. Cap-G binding (red) and AC (grey) cluster separately. Elav and NSC cluster in proximity of each other reflecting their greater similarity, whilst nSyb is more distant, observed in both AC and Cap-G binding samples.

Figure 5 with 1 supplement

Download asset Open asset

Cap-G knockdown in neurons display severe misregulation of gene expression.

(A) Volcano plots showing differentially expressed genes in *elav-KD* and *nSyb-KD* respectively. Significant differential expression marked in red by a Log2 fold change > 1 or <-1 and FDR < 0.05. Control genotypes are *elav-GAL4; UAS-deGradFP* and *nSyb-GAL4; UAS-deGradFP* for *elav-KD* and *nSyb-KD* respectively. (B) Pie charts showing tissue of origin expression data for upregulated genes in Cap-G KD datasets taken from FlyAtlas. The majority of genes are not normally expressed in the CNS but in alternative tissues. (C) Venn diagrams showing significant overlap between Up/Down regulated genes and Cap-G DamID peaks for elav and nSyb neurons respectively, Fisher’s exact test (p<1×10⁻²⁰). (D) Heatmap of overlapping differentially expressed genes between *elav-KD* and *nSyb-KD*. (E) Enriched Gene Ontology analysis of downregulated genes from *elav-KD* shows mostly neuron-specific terms. (F) Example of differentially expressed genes directly bound by Cap-G in *elav-KD* (all three replicates displayed).

Figure 5—figure supplement 1

Download asset Open asset

Analysis of RNA-seq data.

(**A-B**) MA plot of RNAseq datasets for *elav-KD* and *nSyb-KD* respectively showing mean of normalised counts and log₂ fold change values, significant genes marked in red. (**C-E**) Enriched GO terms analysis for differentially expressed genes, gene enrichment ratio shown, circle size correlates with number of genes detected and colour with p-adjust value. (C) Upregulated genes in *elav-KD* showing generic, non-CNS specific terms GO terms. (D) Upregulated genes in *nSyb-KD* showing generic, non-CNS specific terms. (E) Downregulated genes in *nSyb-KD* showing metabolic-related GO terms.

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (D. melanogaster)	Cap-G		FLYB: FBgn0259876
Strain, strain background (E. coli)	DH5α	NEB	# C2987I	Competent cells
Genetic reagent (D. melanogaster)	P{GawB}elav^C155 -GAL4 ‘elav-GAL4’	BloomingtonDrosophilaStock Center	BDSC: #458
Genetic reagent (D. melanogaster)	w¹¹¹⁸; P{y^+t7.7 w^+mC = GMR57 C10-GAL4}attP2 ‘nSyb-GAL4’	BloomingtonDrosophilastock Center	BDSC: #39171
Genetic reagent (D. melanogaster)	w;; P[w^+mC = UAS-Nslmb-vhhGFP4]* ‘UAS-deGradFP’	BloomingtonDrosophilastock Center	BDSC: #38421	Caussinus et al., 2012
Genetic reagent (D. melanogaster)	Cap-G^EGFP	Kleinschnitz, 2020		Stefan Heidmann Lab
Genetic reagent (D. melanogaster)	barren^EGFP	Kleinschnitz, 2020		Stefan Heidmann Lab
Genetic reagent (D. melanogaster)	wor-GAL4; tub-GAL80^ts	Southall Lab		Southall Lab stocks
Genetic reagent (D. melanogaster)	tub-GAL4	BloomingtonDrosophilastock Center
Genetic reagent (D. melanogaster)	UAS-LT3-Cap-G-Dam	This paper		See Materials and methods
Genetic reagent (D. melanogaster)	UAS-LT3-Dam	Southall Lab, Southall et al., 2013
Antibody	Anti-GFP (chicken-polyclonal)	Abcam	ab13970	IF(1:2000)
Antibody	Anti-Lola-N (rabbit-	Southall Lab, Southall et al., 2014		IF(1:10)
Antibody	Anti-elav (c) (rat- monoclonal)	DSHB		IF(1:500)
Antibody	Anti-deadpan (guinea pig)	Brand Lab		Donated by Andrea Brand Lab IF(1: 10000)
Antibody	Anti-pH3 (rabbit-polyclonal)	Millipore	#06–570	IF(1:500)
Antibody	Anti-γ-H2AV (mouse-monoclonal)	DSHB	Cat name: UNC93-5.2.1	IF(1:200)
Recombinant DNA reagent	Plasmid- pUAST-attB	Bischof et al., 2007
Sequence-based reagent	Cap-G_FW	This paper		TGGTACCGCATAATAACATGGCCAAACCAAAG
Sequence-based reagent	Cap-G_RV	This paper		GCGATTTTTCTTCATCAGATCCTCTTCAGAGATGAGTTTCTGTTCTTTCCTCCTGCTGCG
Sequence-based reagent	Dam_FW	This paper		GCGCAGCAGGAGGAAAGAACAGAAACTCATCTCTGAAGAGGATCTGATGAAGAAAAATCGC
Sequence-based reagent	Dam_RV	This paper		TTCACAAAGATCCTCTAGAGGTACCCTCGATTAACCGGCTTTTTTCGCGGGTGAAACGACTCC
Commercial assay or kit	Click-iT TUNEL Alexa Fluor 549	Thermo Fisher	Cat no: C10618
Software, algorithm	R, R Studio	R 3.4.3
Software, algorithm	Prism 8	Graphpad Prismeight for Windows
Other	DAPI (DNA stain)	Thermo Fisher	#D1306	Concentration: 1:20000