Figures and data in CNGA3 acts as a cold sensor in hypothalamic neurons

Figures
Tables
Additional files

9 figures, 1 table and 1 additional file

Figures

Figure 1

Download asset Open asset

Mice have a higher proportion of cold-sensitive POA neurons than ground squirrels.

(A) Representative bright-field and ratiometric calcium images of POA neurons from house mouse and thirteen-lined ground squirrel at baseline (~24°C), after cooling to 10°C, and after perfusion with 116 mM [K⁺] (“High K⁺”) demonstrate cold-sensitive (white arrows) and cold-insensitive (yellow arrowheads) POA neurons. Ratiometric images are pseudocolored according to the fluorescence ratio (FR) scale bar. Photos courtesy of the Gracheva laboratory. (B) Fluorescent ratio traces in response to a cooling ramp for individual POA neurons from a representative coverslip from mouse (*left panel*, N = 182 neurons) and ground squirrel (*right panel*, N = 129 neurons). POA neurons were harvested and plated on multiple coverslips per animal as shown in Figure 2A. Five neurons with the highest cold response amplitude are highlighted with thick lines. (C) Percentage of cold-sensitive (“Cold+”) POA neurons in mice and ground squirrels. *p<0.05, Mann-Whitney test. Each data point represents one coverslip. The horizontal line and error bars denote mean and SEM. N = 56 coverslips from 13 mice vs 33 coverslips from nine ground squirrels. (D) Fluorescent ratio traces in response to a warming ramp for individual POA neurons from a representative coverslip from mouse (*left panel*, N = 18 neurons) and ground squirrel (*right panel*, N = 28 neurons). Five neurons with the highest warm response amplitude are highlighted with thick lines. (E) Percentage of warm-sensitive (“Warm+”) POA neurons in mice and ground squirrels. p>0.05 (‘ns’), Mann-Whitney test. Each data point represents one coverslip. N = 33 coverslips from 6 mice vs 39 coverslips from 7 ground squirrels.

Figure 1—source data 1 Percentage of cold-sensitive and warm-sensitive POA neurons in mice and ground squirrels.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig1-data1-v2.xlsx
Download elife-55370-fig1-data1-v2.xlsx

Figure 2

Download asset Open asset

CNGA3 is enriched in cold-sensitive POA neurons in mice.

(A) A schematic diagram of the imaging-guided collection and separation of cold-sensitive and cold-insensitive mouse POA neurons for differential transcriptomics. (B) Quantification of *Cnga3* transcript in cold-sensitive (“cold+”) and cold-insensitive (“cold−“) mouse POA neurons determined by RNA sequencing. ***p<0.001, GLM quasi-likelihood F-test (EdgeR). N = 3 independent biological replicates containing ~ 100–200 POA neurons each collected over 2–5 mice/independent neuron isolations. (C) RNA in situ hybridization images (maximal intensity projections of confocal Z-stacks) of the POA probed for *Cnga3* (*middle and right panels*) and DapB (negative control; *left panel*) reveal neurons with abundant *Cnga3* expression (white arrows) and neurons with no *Cnga3* expression (yellow arrowheads) in the medial preoptic area (MPO) and lateral preoptic area (LPO). Brain sections correspond to AP coordinate of bregma −0.2 mm. Images are representative of 8 fields-of-view from 4 sections from two independent procedures.

Figure 2—source data 1 Cnga3 expression in cold-sensitive and cold-insensitive mouse POA neurons.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig2-data1-v2.xlsx
Download elife-55370-fig2-data1-v2.xlsx

Figure 3

Download asset Open asset

L-*cis*-diltiazem inhibits cold-activated neurons in mouse POA.

(**A and D**) Fluorescent ratio traces in response to a cooling (A) or warming (D) ramp for individual POA neurons from a representative coverslip in the absence (*left panels*, A: N = 49 neurons, D: N = 145 neurons) or in the presence (right panels, A: N = 39 neurons, D: N = 103 neurons) of 50 µM l-*cis*-diltiazem. Five neurons with the highest cold or warm response amplitude are highlighted with thicker lines. (**B and E**) Percentage of cold-sensitive (“Cold+”) or warm-sensitive (“Warm+”) POA neurons in the absence (‘ctrl’) or in the presence of 50 µM l-*cis*-diltiazem (‘dilt’). B: *p<0.05, E: p>0.05 (‘ns’), Welch’s t-test. Each data point represents one coverslip. The horizontal line and error bars denote mean and SEM. N = 4–5 coverslips from two mice in (B), 3 coverslips from one mouse in (E). (**C and F**) Per-coverslip average of the maximal response of all POA neurons recorded in the experiments in (B) and (E) to 116 mM [K⁺] solution. p>0.05 (‘ns’), Welch’s t-test.

Figure 3—source data 1 Percentage of cold-sensitive and warm-sensitive POA neurons and their "High K" response amplitudes with and without l-cis-diltiazem.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig3-data1-v2.xlsx
Download elife-55370-fig3-data1-v2.xlsx

Figure 4

Download asset Open asset

Cooling potentiates mouse but not squirrel CNGA3 in oocytes.

(**A–C**) Exemplar whole-cell currents (*left*) and quantification of current amplitude at 60 mV (*right*) recorded in *Xenopus* oocytes expressing mouse or squirrel CNGA3 in response to a voltage ramp in the presence or absence of 1 µM intracellular cGMP. (D) Quantification of the magnitude of cold activation of CNGA3 current in oocytes at 60 mV in the presence of 1 µM intracellular cGMP. (E) Exemplar whole-cell current traces (*left*) and quantification of current amplitude at 60 mV (*right*) recorded from mouse or squirrel CNGA3 in response to a voltage ramp in the presence of saturating 250 µM intracellular cGMP. Data are mean ± SEM. NS, not significant, p>0.05; ***p<0.001, paired t-test (**A–C**), Dunnett’s test (D), t-test (F). Each dot represents an individual cell.

Figure 4—source data 1 Cooling potentiates mouse but not squirrel CNGA3 in oocytes.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig4-data1-v2.xlsx
Download elife-55370-fig4-data1-v2.xlsx

Figure 5

Download asset Open asset

L-*cis*-diltiazem inhibits cold-activated current produced by CNGA3-CNGB1 heteromers.

(A) Quantification of *Cngb1* and *Cngb3* transcripts in cold-sensitive (“cold+”) and cold-insensitive (“cold−”) mouse POA neurons determined by RNA sequencing. ‘ns’, not significant, p>0.05, GLM quasi-likelihood F-test (EdgeR). N = 3 independent biological replicates containing ~ 100–200 POA neurons each collected over 2–5 mice/independent neuron isolations. (B) Exemplar whole-cell currents obtained from *Xenopus* oocytes expressing mouse CNGA3 alone or with mouse CNGB1, recorded at −80 mV at different temperatures in the presence of 1 µM intracellular cGMP and 100 µM extracellular l-*cis*-diltiazem (‘dilt’). (C) Quantification of maximum inhibition of cold-activated current by l-*cis*-diltiazem. Data are mean ± SEM. ***p<0.001, t-test. Each dot represents an individual cell.

Figure 5—source data 1 L-cis-diltiazem inhibits cold-activated current produced by CNGA3-CNGB1 heteromers.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig5-data1-v2.xlsx
Download elife-55370-fig5-data1-v2.xlsx

Figure 6

Download asset Open asset

Cooling does not affect CNGA2 current.

(A) Quantification of *Cnga2* transcript in cold-sensitive (“cold+”) and cold-insensitive (“cold−”) mouse POA neurons determined by RNA sequencing. ‘ns’, not significant, p>0.05, GLM quasi-likelihood F-test (EdgeR). N = 3 independent biological replicates containing ~ 100–200 POA neurons each collected over 2–5 mice/independent neuron isolations. (B) Exemplar whole-cell currents obtained from *Xenopus* oocytes expressing mouse CNGA3 and CNGA2, recorded at −80 mV at different temperatures in the presence of 1 µM intracellular cGMP. (C) Quantification of the effect of cooling on CNGA3 and CNGA2 current in the presence of 1 µM intracellular cGMP. (D) Quantification of mCNGA2 activity in the presence of 250 µM intracellular cGMP measured at −80 mV at 22°C. Data are mean ± SEM. ‘ns’, not significant, p>0.05; ***p<0.001, paired t-test. Each dot represents an individual cell.

Figure 6—source data 1 Cooling does not affect CNGA2 current.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig6-data1-v2.xlsx
Download elife-55370-fig6-data1-v2.xlsx

Figure 7 with 1 supplement

Download asset Open asset

Cooling activates mouse but not squirrel CNGA3 in HEK293T cells.

(**A–C**) Exemplar whole-cell currents (*left*) and quantification of current amplitude at 90 mV (*middle*) and −90 mV (*right*) recorded in HEK293T cells expressing empty vector (control) or CNGA3 in response to a voltage ramp in the presence of 2 µM intracellular cGMP, at indicated temperatures. Currents were elicited by voltage ramps from −100 mV to 100 mV from a holding potential of −60 mV. (D) Quantification of the magnitude of cold activation of CNGA3 current in HEK293T cells in the presence of 2 µM intracellular cGMP at 90 mV (*left*) and −90 mV (*right*). (E) Exemplar whole-cell current traces evoked in HEK293T cells expressing mCNGA3, sqCNGA3 or empty vector (control) by voltage ramps from −100 mV to 100 mV from a holding potential of −60 mV in the presence of saturating 100 µM intracellular cGMP at 22°C. (F) Quantification of current amplitude at 90 mV (*left*) and −90 mV (*right*) in the presence of saturating 100 µM intracellular cGMP at 22°C. Data are mean ± SEM. **p<0.01; ***p<0.001, paired t-test (**A–C**) or Dunnett’s test (**D, F**). Each dot represents individual cell.

Figure 7—source data 1 Reversible activation of mouse CNGA3 in HEK293T cells.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig7-data1-v2.xlsx
Download elife-55370-fig7-data1-v2.xlsx

Figure 7—figure supplement 1

Download asset Open asset

Reversible activation of mouse CNGA3 in HEK293T cells.

Exemplar whole-cell current traces obtained from mCNGA3 in the presence of 2 µM intracellular cGMP in response to temperature ramps. Currents were elicited by voltage ramps from −100 mV to 100 mV from a holding potential of −60 mV.

Figure 8

Download asset Open asset

Characterization of cold sensitivity of mouse CNGA3.

(A) Exemplar whole-cell currents obtained from *Xenopus* oocytes expressing mouse CNGA3 at −80 mV and 1 µM intracellular cGMP in response to temperature ramps from 37°C to 10°C. (B) Exemplar Arrhenius plot obtained from a recording as in (A) showing a bi-phasic temperature dependence of mCNGA3 current and apparent temperature activation threshold for this cell (24°C). (C) Quantification of the effect of cold on mCNGA3 current over 10°C (activation coefficient, [**Q₁₀**]). (D) Quantification of the apparent threshold of thermal activation of mCNGA3 from Arrhenius plots. Data are mean ± SEM; ***p<0.001, t-test.

Figure 8—source data 1 Characterization of cold sensitivity of mouse CNGA3.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig8-data1-v2.xlsx
Download elife-55370-fig8-data1-v2.xlsx

Figure 9

Download asset Open asset

Cold decreases half-maximal effective concentration of cGMP for mouse CNGA3.

(**A, B**) Exemplar current traces obtained in response to square voltage steps from inside-out patches of HEK293T cells expressing CNGA3. Each patch was tested at 22°C and 12°C at indicated ‘intracellular’ cGMP concentrations. (**C, D**) Concentration-dependence of CNGA3 on cGMP measured at 22°C and 12°C at −80 mV and normalized to maximal response at 22°C. Maximal responses were obtained by fitting the experimental data to a modified Hill equation (solid line). Data shown as mean ± SEM from 4 and 5 patches for mouse and squirrel CNGA3 respectively. (E) Quantification of half-maximal effective cGMP concentration (EC₅₀) for mouse and squirrel CNGA3 at different temperatures obtained from Hill fits in (C). Lines connect data points from individual patches measured at 22°C and 12°C. Statistical analysis: non-paired t-test (between 22°C data for different species), paired t-test (between 22°C and 12°C data pairs). (F) Quantification of maximal activity for mouse and squirrel CNGA3 at different temperatures obtained from Hill fits in (D). Lines connect data points from individual patches measured at 22°C and 12°C. Statistical analysis: non-paired t-test (between 12°C data for different species), paired t-test (between 22°C and 12^o C data pairs). Error bars: mean ± SEM. ‘ns’, not significant, p>0.05; **p<0.01; ***p<0.001.

Figure 9—source data 1 Cold decreases half-maximal effective concentration of cGMP for mouse CNGA3.: https://cdn.elifesciences.org/articles/55370/elife-55370-fig9-data1-v2.xlsx
Download elife-55370-fig9-data1-v2.xlsx

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Mus musculus)	Cnga3	This paper	GenBank MN381859	Materials and methods
Gene (Ictidomys tridecemlineatus)	Cnga3	This paper	GenBank MN381860	Materials and methods
Strain, strain background (Mus musculus)	C57Bl/6J	The Jackson Laboratory, Bar Harbor, ME	RRID:IMSR_JAX:000664	Materials and methods
Strain, strain background (Ictidomys tridecemlineatus)	Thirteen-lined Ground Squirrel	Gracheva laboratory’s colony	N/A	Materials and methods
Cell line (H. sapiens)	HEK293T^ΔPIEZO1	Dr. Ardem Patapoutian (Scripps Research Institute) (Lukacs et al., 2015)	N/A	Materials and methods
Sequence-based reagent	mouse CNGA3 cloning primer forward	his paper	N/A	5’- GAGATGGCAAAGGTGAACAC −3’
Sequence-based reagent	mouse CNGA3 cloning primer reverse	this paper	N/A	5’- GAGGCAGAGCCACCTGCATT −3’
Sequence-based reagent	ground squirrel CNGA3 cloning primer forward	this paper	N/A	5’- GGACTGAATGCAACAAGCAAG −3’
Sequence-based reagent	ground squirrel CNGA3 cloning primer reverse	this paper	N/A	5’- CCACGGAGCAGCTCATTTTC −3’
Commercial assay or kit	Quick-RNA Microprep Kit	Zymo, Irvine, Ca	Cat#: R1050	Materials and methods
Commercial assay or kit	SMARTer Stranded Total RNA-Seq Kit - Pico Input Mammalian	Clontech/Takara Bio, Mountain View, CA	Cat#: 635005	Materials and methods
Commercial assay or kit	RNAscope Multiplex Fluorescent Reagent Kit v2 Assay	Advanced Cell Diagnostics, Hayward, CA	Cat#: 323100	Materials and methods
Commercial assay or kit	RNAScope mmCnga3 probe	Advanced Cell Diagnostics, Hayward, CA	Cat#: 406131	Materials and methods
Chemical compound, drug	cGMP-Na salt	Sigma	Cat#: G6129	Materials and methods
Chemical compound, drug	L-cis-Diltiazem hydrochloride	Santa Cruz Biotechnology, Dallas, TX	Cat#: sc-221802	Materials and methods
Software, algorithm	MetaFluor v7.8.2.0	Molecular Devices, San Jose, CA	RRID:SCR_014294	Materials and methods
Software, algorithm	ImageJ v1.51p	http://imagej.nih.gov/ij/; (Schneider et al., 2012)	RRID:SCR_003070	Materials and methods
Software, algorithm	nd Stack Builder (ImageJ plugin)	https://imagej.nih.gov/ij/plugins/track/builder.html	N/A	Materials and methods
Software, algorithm	Trimmomatic v0.36	(Bolger et al., 2014)	RRID:SCR_011848	Materials and methods
Software, algorithm	STAR v2.5.4b	(Dobin et al., 2013)	RRID:SCR_015899	Materials and methods
Software, algorithm	featureCounts v1.6.2	(Liao et al., 2014)	RRID:SCR_012919	Materials and methods
Software, algorithm	R v3.5.1	https://www.r-project.org	RRID:SCR_001905	Materials and methods
Software, algorithm	edgeR (package for R) v3.22.3	(Robinson et al., 2010)	RRID:SCR_012802	Materials and methods
Software, algorithm	pCLAMP v10	Molecular Devices (https://www.moleculardevices.com/)	RRID:SCR_011323	Materials and methods
Software, algorithm	GraphPad Prism v8.2.0	GraphPad Software, San Diego, CA	RRID:SCR_002798	Materials and methods