Aromatic interactions with membrane modulate human BK channel activation
- Department of Chemistry, University of Massachusetts, United States
- Department of Biomedical Engineering, Center for the Investigation of Membrane Excitability Disorders, Cardiac Bioelectricity and Arrhythmia Center, Washington University, United States
- Department of Biochemistry and Molecular Biology, University of Massachusetts, United States
Figures
Figure 1 with 5 supplements
Structure of BK channels and effects of C-linker sequence scrambling on its voltage activation.
(a) Key functional domains and structural organization of the human BK channel (hSol1). See main text for definition of domains; (b) Orientation of the pore lining S6 helices and C-linkers in the …
-
Figure 1—source data 1
Data from electrophysiology experiments showing G-V curves for WT, K0, K2 and K7 hSlo1 channels in 0 [Ca2+] as depicted in Figure 1d.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig1-data1-v3.xlsx
-
Figure 1—source data 2
Data from electrophysiology experiments showing Q-V relation of on-gating currents for WT and K0 as depicted in Figure 1f.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig1-data2-v3.xlsx
Figure 1—figure supplement 1
Structural properties of BK channels.
(a) Domain swapping arrangement of BK channels. Shown is the structure of the human BK channels (hSlo1) with chain A colored blue and C-linker colored green. Other domains are made transparent for …
Figure 1—figure supplement 2
Packing between C-linker and VSD/RCK1 N-lobe of WT hSlo1.
(a) Segments highlighted are: C-linker (residue 329–343, green); RCK1 N-lobe (dark blue, residue 344–427); VSD S0’ (yellow, residue 92–107) and S2-S3 loop (magenta, residue 171–177). The orange …
Figure 1—figure supplement 3
Comparison of the aSlo1-derived homology model of hBK (orange) with the new Cryo-EM structure (PDB 6V38) (cyan) in the metal-bound state.
(a) Overlay of the full-length structures aligned using core residues 100 to 600. The backbone RMSD of two structures 2.18 Å. (b) Overlay of the central pore region (including S6 helices), aligned …
Figure 1—figure supplement 4
Structural and dynamic properties of hSlo1 obtained from simulations of the recently published Cryo-EM structures (PDB: 6V3G and 6V38).
(a) Root-Mean-Square Fluctuations (RMSF) profiles of residues 230–400 (PGD, C-linker and RCK1 N-lobe). C-linker RMSF is highlighted in the green dashed box and in insert. The Cα RMSD of (b) the …
Figure 1—figure supplement 5
A representative structural model of hSlo1 with 12 residues (3x AAG units; colored red) inserted after S337 in the C-linker region (colored green).
(a) Side view; (b) top view. For clarity, only the C-linker and S6 helix (yellow) of chain A (colored as blue ribbon) are highlighted.
Figure 2 with 6 supplements
Dynamic properties of BK channels.
(a) The C-linker N-C Cα distance during a representative 800-ns MD simulations of the WT hSlo1. (b) Residue Root-Mean-Square Fluctuations (RMSF) profiles of PGD, C-linker and RCK1 N-lobe derived …
-
Figure 2—source data 1
Data obtained from simulation studies (see Materials and method section structural and dynamic analysis) calculating C-linker N-C Cα distance for both metal-bound and metal-free states of WT hSlo1 channels as depicted in Figure 2a.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig2-data1-v3.xlsx
-
Figure 2—source data 2
Data obtained from simulation studies (see Materials and method section structural and dynamic analysis) calculating residue RMSF for both metal-bound and metal-free states of the WT hSlo1 channels as depicted in Figure 2b.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig2-data2-v3.xlsx
Figure 2—figure supplement 1
Probabilities of residue-residue contacts between the C-linker and VSD of the neighboring chains.
VSD spans residues 45–250, where residues 45 to 53 belong to S0 helix, 92–107 to S0’, 171–177 to the S2-S3 loop, and 225–230 to the S4-S5 loop. The contact probabilities were calculated from …
Figure 2—figure supplement 2
Probabilities of residue–residue contacts between the C-linker and RCK1 N-lobe of the same chain.
See Materials and methods for additional details.
Figure 2—figure supplement 3
Structural and dynamic properties of the C-linker in WT hSlo1 and mutants.
(a) The C-linker N-C distance (329–343 Cα) as a function of time during 800-ns MD simulations. (b) RMSF profiles of residues 230–400 (PGD, C-linker and RCK1 N-lobe) derived from the same MD …
Figure 2—figure supplement 4
Structural and dynamic properties of WT hSlo1 and C-linker mutants.
The Cα RMSD of (a) the whole channel and (b) residues 100–500 (the Core region) as a function of time during 800-ns MD simulations. (c) Evolution of the number of pore water, showing that all hSlo1 …
Figure 2—figure supplement 5
Optimal (red) and suboptimal (green) dynamic coupling pathways between the critical residues in the Ca2+ and Mg2+ binding sites (Cα colored as purple sphere) and I323 (Cα colored as yellow sphere) in PGD.
Whole channel is shown as transparent ribbon with each chain colored differently. S6 and C-linker of chain C are colored in gray and shown with a cartoon representation. (a) Path between R514 …
Figure 2—figure supplement 6
Correlation between the average intrinsic end-to-end distance of free C-linkers and measured V0.5 of the WT hSlo1 and mutants.
The average distances were calculated from ABSINTH simulations of isolated C-linker peptides. The red dashed line shows the linear relationship derived from the C-linker insertion/deletion study (Niu…
Figure 3
G-V shifts caused by the C-linker mutations correlated with Tyr position.
(a) Macroscopic currents of WT, K0, K2 and K7 mSlo1 channels in 100 μM [Ca2+]i. The currents were elicited by voltage pulses from −200 to 100 mV with 20 mV increments. The voltages before and after …
-
Figure 3—source data 1
Data from electrophysiology experiments showing the relation of the G-V curves to the position of the nearest C-linker Tyr as depicted in Figure 3b.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig3-data1-v3.xlsx
Figure 4
Interactions of the C-linker Tyr residue nearest to the S6 helix with the membrane interface in hSlo1 K0 (Y330, panels a, b) and K7 (Y329, panels c, d) mutants.
Only the S6 helix and C-linker from one subunit are shown for clarity. POPC molecules near the Tyr residue are shown in sticks, with the phosphorous atoms shown in spheres and colored according to …
Figure 5 with 2 supplements
Interactions of the C-linker Tyr residue nearest to the S6 helix with the membrane interface.
(a) Average Tyr sidechain solvent accessible surface area (SASA) of burial by lipid tails, representing the level of hydrophobic contacts between the Tyr sidechain and aliphatic lipid tails. (b) …
-
Figure 5—source data 1
Data extracted from simulation studies (see Materials and method section structural and dynamic analysis) of WT, K0, K2 and K7 comparing different interactions of Tyr with the membrane components as depicted in Figure 5a–d.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig5-data1-v3.xlsx
Figure 5—figure supplement 1
Distributions of various interactions of the C-linker Tyr residue nearest to the S6 helix, with the membrane interface for WT hSlo1 and mutants derived from simulations.
(a) Tyr side chain SASA (Solvent Accessible Surface Area) of burial by lipid tails. (b) Hydrogen bonding of Tyr OH with the lipid polar head groups. (c) Carbon-carbon contacts between the Tyr …
Figure 5—figure supplement 2
A representative snapshot of metal-bound K0 channel showing membrane distortion around the protein.
(a) Top view, (b) side view. The POPC phosphorous atoms have been colored according to their distances to the membrane center. S6 helices are colored in magenta and Tyr 330 side chains are shown as …
Figure 6
Effects of C-linker scrambling mutations of voltage activation of Core-MT BK channels.
(a) Illustration of the structure of the Core-MT BK channel, where the whole CTD is absent. The mini-tail is omitted in the illustration for clarity. (b) Macroscopic currents of the WT Core-MT …
-
Figure 6—source data 1
Data from electrophysiology experiments showing the G-V curves of the full-length and Core-MT WT, K0, K2 and K7 hSlo1 channels in 0 [Ca2+] as depicted in Figure 6c–e.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig6-data1-v3.xlsx
-
Figure 6—source data 2
Data from electrophysiology experiments showing Q-V relation of on-gating currents for full-length and Core-MT WT and K0 as depicted in Figure 6g.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig6-data2-v3.xlsx
Figure 7
Removing Tyr sidechain in the K0 mutant full-length hSlo1 channel recovers WT-like voltage activation.
(a) Macroscopic currents of K0 (Y330G) mutant channel. The currents were elicited in 0 [Ca2+]i by voltage pulses from −30 to 250 mV with 20 mV increments. The voltages before and after the pulses …
-
Figure 7—source data 1
Data from electrophysiology experiments showing G-V curves of the full-length K0 Y330G hSlo1 channels in 0 [Ca2+]i as depicted in Figure 7b.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig7-data1-v3.xlsx
Figure 8
HA model simulation of V0.5 changes with D, L0 and [Ca2+]i.
(a) The HA model for BK channel activation, where L, J, and K are equilibrium constants to represent conformational changes in the PGD, VSD, and CTD domains respectively. D, C, and E are allosteric …
-
Figure 8—source data 1
Data for HA model simulation parameters and results as depicted in Figure 8b,c.
- https://cdn.elifesciences.org/articles/55571/elife-55571-fig8-data1-v3.xlsx
Tables
Table 1
C-linker scrambling mutations and measured V0.5 in the full-length at both 0 [Ca2+] and 100 μM [Ca2+] and Core-MT BK channels at 0 [Ca2+].
The Core-MT constructs are based on the TMD, C-linker of mSlo1, and an 11-residue tail from KV 1.4 of the mouse Shaker family (Budelli et al., 2013; Zhang et al., 2017). The location of the nearest …
| Mutation | Sequence | V0.5 (mV) | ||
|---|---|---|---|---|
| Full-Length | Core-MT | |||
| 0 [Ca2+] | 100 [Ca2+] | 0 [Ca2+] | ||
| WT | EIIEL IGNRK KYGGS YSAVS GRK | 183.4 | 0.2 | 235.0 |
| K0 | EIIEL IGNRY GKGSK YSRAV SKG | 89.6 | −66.7 | 192.6 |
| K0(Y330G) | EIIEL IGNRG GKGSK YSRAV SKG | 169.8 | 47.5 | NM |
| K1 | EIIEL RIGNK YGGSY KSAVR KSG | 136.2 | −4.2 | NM |
| K2 | EIIEL IGRKN YKGGS YSARV SGK | 195.5 | 59.0 | 263.5 |
| K3 | EIIEL IGNYG GRSYS KAKVS RKG | NC | NC | NM |
| K4 | EIIEL IGRNY GGSYS AKKVR SKG | 94.6 | −50.4 | NM |
| K5 | EIIER LIGKK RNYKG GSYSA VSG | NC | NC | NM |
| K6 | EIIEL RKKIR KGNYG GSYSA VSG | NC | NC | NM |
| K7 | EIIEL IGNYG GSYSA VRKSK GRK | 48.7 | −63.7 | 167.5 |
| NC: no current, channel could not be expressed; NM: Mutation Not Made | ||||
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene Mus musculus | mslo1 | GenBank GI: 47143 | ||
| Gene Mus musculus | Core-MT | Dr. Lawrence Salkoff | PMID:24067659 | |
| Biological sample (Xenopus laevis) | oocyte | Xenopus laevis | Xenopus laevis purchased from Nasco, Fort Atkinson, WI | |
| Commercial assay or kit | mMESSAGE T7 Transcription Kit | Thermo Fisher | AM1344 | |
| Software, algorithm | Igor Pro 4.0 | WaveMetrics | https://www.wavemetrics.com/products/igorpro | |
| Sequence-based reagent | For site-directed mutagenesis | This paper | PCR primers | PCR primers seq for mutations made in this study (each mutation utilized two primers: b and c). K0 b: gCtctGCTgTActtGgaCCCcTtgccgTaGCGGTTTCCTATTAACTC c: cCaagTAcAGCagaGcTgtctccAagggGCACATTGTAGTCTGTG K1 b: cTtGtAcgaCCCGccaTaCTTgttGccgatCcTTAACTCTATGATTTCAG c: ggCGGGtcgTaCaAgAGCGCtGTccGcaagAGcggGCACATTGTAGTCTG K2 b: gagTAGctaCCgCCcTtgTagTTcttgcgTCCTATTAACTCTATGATTTC c: gGGcGGtagCTActcCGCcagggtctcAgGAAAGCACATTGTAGTC K4 b: ctTAgcGGAGtaCgaGccTccgTaGtttcTTCCTATTAACTCTATGATTT c: gCtcGtaCTCCgcTAagaaGGTTAGgaGcAaAggGCACATTGTAGTCTGT K7 b: CTAacGGcGCtgtaGctTccCccGtaGTTTCCTATTAACTCTATG c: gCtacaGCgCCgtTAGgaaGagTaagGGAAGAAAGCACATTGTAG K0 on Core-MT b: gCtctGCTgTActtGgaCCCcTtgccgTaGCGGTTTCCTATTAACTC c: cCaagTAcAGCagaGcTgtctccAagggtGGAGTCAAGGAATCATTA K7 on Core-MT b: gaaGagTaagGGAAGAAAGGGAGTCAAG c: GAAGAAAGGGAGTCAAGGAATCAT K2 on Core-MT b: CCTTGACTCCtTTTCcTgagaccctgG c: gGAAAaGGAGTCAAGGAATCATTATG K0 Y330G b: GCCGccGCGGTTTCCTATTAACTC c: GAAACCGCggCGGCAAGGGGTCCAAG |
Additional files
-
Supplementary file 1
Effects of C-linker insertion/deletion mutations on the voltage required for half channel activation (V0.5) of hSlo1 in absence of Ca2+ and Mg2+ (data extracted from: Niu et al., 2004).
The position of insertion (S337) is colored red.
- https://cdn.elifesciences.org/articles/55571/elife-55571-supp1-v3.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/55571/elife-55571-transrepform-v3.docx
