Whole-brain mapping of socially isolated zebrafish reveals that lonely fish are not loners
- The Wolfson Institute for Biomedical Research, University Street, University College London, United Kingdom
- Sainsbury Wellcome Centre, Howland Street, University College London, United Kingdom
Figures
Figure 1 with 1 supplement
Isolation alters social preference behavior and swimming activity.
(A) Histograms of all the VPIs during the social cue period across different conditions: controls (C, left), full isolation (Fi, middle), and partial isolation (Pi, right). For visual clarity, red …
Figure 1—figure supplement 1
Isolation alters social preference behaviour and swimming activity.
(A) Swarm plots comparing the activity levels of fish during the social period expressed as percentage time moving for each rearing condition (C, n = 380; Fi, n = 47; Pi, n = 157). Mean and standard …
Figure 2
Functional maps of the social brain in normal and isolated fish.
(A) Schematic of the custom-built two-photon microscope used for acquiring whole-brain volumes of dorsal-down mounted fish brains (top panel). Horizontal sections of pro-social control fish (C(+S)) …
Figure 3
Changes in baseline brain activity following isolation.
(A) Images of two areas that show strong c-fos activation in fully isolated fish independent of social stimuli (optic tectum and posterior tuberal nucleus (PTN)). Schematics of the horizontal …
Figure 4 with 1 supplement
Buspirone rescues social preference in isolated fish.
(A) Histogram of VPIs during the social cue period in partially isolated (Pi) fish treated with 30 μM and 50 μM of Buspirone (combined). For visual clarity, the bars are colored as in Figure 1. (B) …
Figure 4—figure supplement 1
Buspirone rescues social preference in isolated fish.
(A) Histograms of VPIs during the social cue period in control fish treated with 30 μM of Buspirone and in partially isolated fish treated with 30 μM and 50 μM of Buspirone. The bars are coloured as …
Videos
Video 1
Example of a control and a fully isolated +S fish video during social cue presentation.
Two minutes of behaviour is shown in 20 s (6x playback acceleration). The control fish shows a strong social preference for the social cue and has a stereotypical social phenotype (left). The test …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti- digoxigenin-POD, sheep, polyclonal Fab fragments | Sigma-Aldrich, Rouche | Roche, Cat# 11207733910, RRID:AB_514500 | 1:3000 |
| Sequence-based reagent | cFos _F | This paper | PCR primers | CCGATACACTGCAAGCTGAA |
| Sequence-based reagent | cFos_R | This paper | PCR primers | ATTGCAGGGCTATGGAAGTG |
| Peptide, recombinant protein | Proteinase K | Sigma-Aldrich | Cat# P6556-10MG | 2 mg/ml |
| Commercial assay | TSA Plus Cyanine three system | Sigma-Aldrich, Perkin Elmer | Cat# NEL74401KT | Dilution 1:50 |
| Chemical compound, drug | Buspirone hydrochloride | Sigma-Aldrich | Cat# B7148-1G | 30 uM and 50 uM |
| Software, algorithm | Anaconda, Spyder | Anaconda (https://www.anaconda.com/) | Spyder, RRID:SCR_017585 | Version 4.0.1 |
| Software | ImageJ | NIH (http://imagej.nih.gov/ij/) | RRID:SCR_003070 | |
| Software | ANTs- Advanced Normalisation Tools | http://stnava.github.io/ANTs/ | RRID:SCR_004757 | Version 2.1.0 |
| Other | DAPI staining | Sigma-Aldrich | Cat# D9564-10MG | 1 mg/ml |
| Other | Slc6a4b RNA probe | Norton et al., 2008 | ||
| Other | DAT RNA probe | Filippi et al., 2010 | ||
| Other | Th1 RNA Probe | Filippi et al., 2010 | ||
| Other | Th2 RNA probe | Filippi et al., 2010 |
