The dynamic interplay between ATP/ADP levels and autophagy sustain neuronal migration in vivo
- CERVO Brain Research Center, Canada
- Université Laval, Canada
Figures
Figure 1
Migrating cells express autophagy-related proteins and display active autophagic flux.
(A) Experimental design for the quantification of autophagy in migrating neuroblasts (B–D) Confocal images and quantification showing Atg5, LC3A, and LC3B expression by neuroblasts and astrocytes. …
Figure 2 with 1 supplement
Pharmacological and genetic impairment of autophagy-related genes disrupts cell migration.
(A) Experimental design for the pharmacological impairment of autophagy using bafilomycin. (B) Time-lapse imaging of GFP+ neuroblasts in acute brain sections. (C–E) Distance of migration, speed of …
Figure 2—figure supplement 1
Validation of autophagy impairment in Atg5 cKO mice by electron microscopy.
(A-B) Example of electron microscopic images of neuroblasts in the RMS of Atg5 WT and Atg5 cKO mice. The neuroblasts were labeled with anti-GFP immunogold particles. The autophagosomes are indicated …
Figure 3 with 1 supplement
Genetic impairment of autophagy-related genes in the adult and early postnatal mice disrupts cell migration.
(A) Experimental procedure for GFP- and Cre-mNeptune-encoding retroviral labeling of neuroblasts from Atg5wt/wt and Atg5fl/fl mice. (B) Example of time-lapse imaging of neuroblasts expressing GFP or …
Figure 3—figure supplement 1
Validation of gRNA efficiency by high-resolution melting (HRM) PCR.
SVZ cells were isolated and were cultured in vitro. The cells were transfected with plasmids carrying Cas9 and various gRNAs. The PCR reaction was performed on genomic DNA, and HRM curves were …
Figure 4 with 2 supplements
ATP/ADP ratios are dynamically modulated during cell migration and trigger autophagy via AMPK.
(A–B:) Example and quantification of changes in the ATP/ADP ratios of individual neuroblasts during the different cell migration phases. Yellow boxes indicate the migratory phases. As the duration …
Figure 4—figure supplement 1
Validation of the PercevalHR functionality in migrating neuroblasts.
(A:) Experimental procedure to visualize the impact of rotenone on the ATP/ADP ratio. (B:) Quantification of changes in the PercevalHR ratio in neuroblasts following the incubation of acute brain …
Figure 4—figure supplement 2
Validation of gRNA efficiency by high-resolution melting (HRM) PCR.
SVZ cells were isolated and were cultured in vitro. The cells were transfected with plasmids carrying Cas9 and various gRNAs. The PCR reaction was performed on genomic DNA, and HRM curves were …
Figure 5
Autophagy affects neuronal migration by the recycling of paxillin.
(A) Example of paxillin-GFP and RFP-LC3 punctae in migrating neuroblasts. Arrowheads indicate paxillin-GFP/RFP-LC3 punctae whereas arrows indicate RFP-LC3 punctae. (B) Quantification of …
Figure 6
Autophagy is dynamically regulated by migration-promoting and migration-inhibiting cues and is required for the recycling of paxillin.
(A–C:) Immunoblotting for the lipidated form of LC3 (LC3-II), p62, and paxillin on RMS samples dissected from acute sections previously incubated with BDNF, GABA, GM60001, Y27632, or blebbistatin …
Videos
Video 1
Time-lapse imaging of RFP-GFP-LC3 in migrating neuroblasts.
Time-lapse imaging of RFP-LC3 punctae in neuroblasts. The time is indicated in the upper left corner.
Video 2
Neuronal migration of Atg5 WT and Atg5 cKO neuroblasts in acute sections of the adult RMS.
Time-lapse imaging of GFP+ neuroblasts in sections from Atg5 WT (left) and Atg5 cKO (right) mice. The time is indicated in the upper left corner.
Video 3
Neuronal migration of Cre-mNeptune- and GFP-infected cells in Atg5fl/fl mice.
Example of time-lapse imaging of neuroblasts on acute slices from Atg5fl/fl mice infected with retroviruses expressing GFP and Cre-mNeptune. The images were acquired every 15 s for 1 hr. The time is …
Video 4
The ATP/ADP ratio is dynamically modulated during cell migration.
Time-lapse imaging of neuroblasts infected with PercevalHR-encoding and Td-Tomato-encoding lentiviruses. PercevalHR was used for ratiometric measurements of changes in the ATP/ADP ratio. The ATP/ADP …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (M. musculus, male and female) | CAG-CAT-EGFP | Waclaw et al., 2010 | ||
| Strain, strain background (M. musculus, male and female) | Slc1a3(Glast)CreErt2 mice | Mori et al., 2006 | ||
| Strain, strain background (M. musculus, male and female) | Atg5fl/fl | Riken | B6.129S-Atg5 < tm1Myok> RRID:IMSR_RBRC02975 | |
| Strain, strain background (M. musculus, male and female) | CD1 | Charles Rivers | Strain code: 022 | |
| Strain, strain background (M. musculus, male) | C57BL/6NCRL | Charles Rivers | Strain code: 027 | |
| Strain, strain background (M. musculus, male and female) | GFAP-GFP | Jackson | Strain code: 003257FVB/N-Tg(GFAPGFP)14Mes/J | |
| Transfected construct (Synthetic) | RV-GFP | Molecular Tool Platform, CERVO Brain Research Center | Lot #RV 39 | Retroviral construct |
| Transfected construct (Synthetic) | RV-Cre-mNeptune | Molecular Tool Platform, CERVO Brain Research Center | Lot #RV 34 | Retroviral construct |
| Transfected construct (R. norvegicus) | RV- RFP-GFP-LC3 | Molecular Tool Platform, CERVO Brain Research Center | Lot #RV15 | Retro viral construct |
| Transfected construct (Synthetic) | LV-CMV-PercevalHR | University of North Carolina Vector Core Facility | Lot #43–44213 PercevalHR | Lentiviral construct |
| Transfected construct (Synthetic) | LV-CMV-TdTomato | University of North Carolina Vector Core Facility | Lot #43–44213 TdTomato | Lentiviral construct |
| Antibody | Anti-GFP (Rabbit polyclonal) | Thermo Fisher Scientific | Cat#A-11122; RRID:AB_221569 | DAB (1:1000) |
| Antibody | Anti-GFP (Chicken polyclonal) | Avés | GFP-1020; RRID:AB_10000240 | IF (1:1000) |
| Antibody | Anti-LC3B (Rabbit polyclonal) | Novus | Cat#NB100-2220, RRID:AB_10003146 | IF (1:200) WB (1:1000) |
| Antibody | Anti- Cleaved LC3A (Rabbit polyclonal) | Abgent | Cat#AP1805a, RRID:AB_2137587 | IF (1:100) |
| Antibody | Anti-murine Atg5 (Rabbit polyclonal) | Novus | Cat#NB110-53818, RRID:AB_828587 | IF (1:400) |
| Antibody | Anti-LAMP-1 (CD107a) (Rabbit polyclonal) | Millipore | Cat#AB2971, RRID:AB_10807184 | IF (1:500) |
| Antibody | Anti-paxillin (Mouse monoclonal) | BD Biosciences | Cat#610051, RRID:AB_397463 | IF (1:100) WB (1:1000) |
| Antibody | Anti-P62/SQSTM1 (Rabbit polyclonal) | Proteintech | Cat#18420–1-AP, RRID:AB_10694431 | WB (1:500) |
| Antibody | Anti-GAPDH (Mouse monoclonal) | Thermo Fisher Scientific | Cat#MA5-15738, RRID:AB_10977387 | WB (1:5000) |
| Antibody | Anti-rabbit IgG, biotin-SP conjugate (Goat polyclonal) | Millipore | Cat#AP132B, RRID:AB_11212148 | DAB (1:1000) |
| Antibody | Anti-GFP (Rabbit polyclonal) | Abcam | Cat#ab290, RRID:AB_303395 | EM (1:1000) |
| Antibody | Nanogold-Fab goat anti-rabbit | Nanoprobe | Cat#2004, RRID:AB_2631182 | EM (1:20) |
| Antibody | Anti-Atg12 (Rabbit polyclonal) | Abcam | Cat#ab155589 | IF (1:500) |
| Antibody | Anti-mCherry (16D7) (Rat monoclonal) | Thermo Fisher Scientific | Cat #M11217, RRID:AB_2536611 | IF (1:1000) |
| Recombinant DNA reagent | FUGW-PercevalHR (plasmid) | Addgene | RRID:Addgene_49083 | |
| Recombinant DNA reagent | pCSCMV:tdTomato (plasmid) | Addgene | RRID:Addgene_30530 | |
| Recombinant DNA reagent | ptfLC3 (plasmid) | Addgene | RRID:Addgene_21074 | |
| Recombinant DNA reagent | PU6-BbsI-CBh-Cas9-T2AmCherry (plasmid) | Addgene | RRID:Addgene_64324 | |
| Recombinant DNA reagent | pmRFP-LC3 (plasmid) | Addgene | RRID:Addgene_21075 | |
| Recombinant DNA reagent | pRK GFP paxillin (plasmid) | Addgene | RRID:Addgene_50529 | |
| Recombinant DNA reagent | GW1-pHRed (plasmid) | Addgene | RRID:Addgene_31473 | |
| Sequence-based reagent | Atg12-gRNA1-Fw | This paper | PCR primer | CGGAAACAGCCACCCCAGAG |
| Sequence-based reagent | Atg12-gRNA1-Rs | This paper | PCR primer | GCCCACTAACGGATGTTGACATTACTT |
| Sequence-based reagent | Atg12-gRNA2-Fw | This paper | PCR primer | ACGCTGCTACGTCACTTCC |
| Sequence-based reagent | Atg12-gRNA2-Rs | This paper | PCR primer | GCTCTGGAAGGCTCTCGC |
| Sequence-based reagent | Ulk1-gRNA1-Fw | This paper | PCR primer | TCGCAAGGACCTGATTGGAC |
| Sequence-based reagent | Ulk1-gRNA1-Rs | This paper | PCR primer | CCTCGCAATCCCGGACTC |
| Sequence-based reagent | Ulk1-gRNA2-Fw | This paper | PCR primer | CATCTGCTTTTTATCCCAGCA |
| Sequence-based reagent | Ulk1-gRNA2-Rs | This paper | PCR primer | CTGCAACAGAGCCAGGAG |
| Sequence-based reagent | Ulk2-gRNA1-Fw | This paper | PCR primer | TACTGCAAGCGGGACCT |
| Sequence-based reagent | Ulk2-gRNA1-Rs | This paper | PCR primer | TTTCGCACCAGACAACGGG |
| Sequence-based reagent | Ulk2-gRNA2-Fw | This paper | PCR primer | CTCTGAGTGAAGATACTATCAGAGTG |
| Sequence-based reagent | Ulk2-gRNA2-Rs | This paper | PCR primer | GATCCCTGTGGATTATCCCTTT |
| Commercial assay or kit | DNeasy Blood and Tissue Kit | Qiagen | Cat#69504 | |
| Commercial assay or kit | LightCycler 480 High Resolution Melting Master | Roche | Cat#04909631001 | |
| Commercial assay or kit | VECTASTAIN ABC-Peroxidase Kit | Vector Laboratories | Cat#PK4000 | |
| Commercial assay or kit | HQ Silver Enhancement kit | Product | Cat#2012 | |
| Chemical compound, drug | NeuroCult Proliferation Supplement | StemCell Technologies | Cat#05701 | |
| Chemical compound, drug | NeuroCult Basal Medium | StemCell Technologies | Cat#05700 | |
| Chemical compound, drug | EGF | Sigma-Aldrich | Cat#E4127 | |
| Chemical compound, drug | bFGF | Sigma-Aldrich | Cat#SRP4038-50UG | |
| Chemical compound, drug | Heparin | StemCell Technologies | Cat#07980 | |
| Chemical compound, drug | MgCl2 | Sigma-Aldrich | Cat#M8266; CAS 7786-30-3 | |
| Chemical compound, drug | Paraformaldehyde | Sigma-Aldrich | Cat#P6148; CAS: 30525-89-4 | |
| Chemical compound, drug | Tamoxifen | Sigma-Aldrich | Cat#T5648; CAS: 10540-29-1 | |
| Chemical compound, drug | Anhydrous ethyl alcohol | Commercial Alcohols | 1019C | |
| Chemical compound, drug | Sunflower seed oil | Sigma-Aldrich | Cat#S5007 CAS: 8001-21-6 | |
| Chemical compound, drug | Protease Inhibitor Cocktail Set III | Millipore | 539134 | |
| Chemical compound, drug | Blebbistatin | Research Chemicals Inc Toronto | Cat#B592490-10 CAS: 674289-55-5 | |
| Chemical compound, drug | GM6001 | Abmole | Cat#M2147-10MG CAS: 142880-36-2 | |
| Chemical compound, drug | Y-27632 | Cayman Chemical | Cat#10005583–5 CAS: 129830-38-2 | |
| Chemical compound, drug | Compound C | EMD Millipore | Cat#171260–10 MG CAS: 866405-64-3 | |
| Peptide, recombinant protein | BDNF | Peprotech | Cat#450–02 | |
| Peptide, recombinant protein | GABA | Sigma-Aldrich | Cat#A5835-25G CAS: 56-12-2 | |
| Software, algorithm | Imaris 7.2 | Bitplane, Oxford Instrument | https://imaris.oxinst.com/ | |
| Software, algorithm | MATLAB 2016a | Mathworks | https://www.mathworks.com/ | |
| Software, algorithm | MATLAB scripts PercevalHR imaging analysis | This paper | https://github.com/SagLab-CERVO/PercevalHR-fluorescence-intensity | To track cell and measure PercevalHR fluorescence intensity (Labrecque et al., 2020; copy archived at https://github.com/elifesciences-publications/PercevalHR-fluorescence-intensity) |
| Software, algorithm | ImageJ | NIH | https://imagej.net/Welcome | |
| Software, algorithm | Origin 2016 | OriginLab Corporation | https://www.originlab.com/ | |
| Software, algorithm | Statistica 6.1 | Stat Soft | N/A | |
| Software, algorithm | Primer-Blast software | NCBI | https://www-ncbi-nlm-nih-gov.acces.bibl.ulaval.ca/tools/primer-blast/ | |
| Software, algorithm | ChopChop online software | Labun et al., 2019 | https://chopchop.cbu.uib.no/ | |
| Software, algorithm | LightCycler 480 SW1.5.1 software | Roche | 04994884001 |
