1. Microbiology and Infectious Disease

PrkA controls peptidoglycan biosynthesis through the essential phosphorylation of ReoM

  1. Sabrina Wamp
  2. Zoe J Rutter
  3. Jeanine Rismondo
  4. Claire E Jennings
  5. Lars Möller
  6. Richard J Lewis
  7. Sven Halbedel  Is a corresponding author
  1. FG11 - Division of Enteropathogenic bacteria and Legionella, Robert Koch Institute, Germany
  2. Institute for Cell and Molecular Biosciences, Medical School, University of Newcastle, United Kingdom
  3. Department of General Microbiology, GZMB, Georg-August-Universität Göttingen, Germany
  4. Newcastle Drug Discovery, Northern Institute for Cancer Research, United Kingdom
  5. ZBS 4 - Advanced Light and Electron Microscopy, Robert Koch Institute, Germany
https://doi.org/10.7554/eLife.56048
Share this article
Cite this article
  1. Sabrina Wamp
  2. Zoe J Rutter
  3. Jeanine Rismondo
  4. Claire E Jennings
  5. Lars Möller
  6. Richard J Lewis
  7. Sven Halbedel
(2020)
PrkA controls peptidoglycan biosynthesis through the essential phosphorylation of ReoM
eLife 9:e56048.
https://doi.org/10.7554/eLife.56048
  2. Download BibTeX
  3. Download .RIS
9 figures, 3 tables and 2 additional files

Figures

Figure 1 with 2 supplements
Download asset Open asset
Suppression of the growth defects of a L. monocytogenes ΔgpsB mutant by reoM and reoY mutations.

(A–B) Effect of suppressor mutations on growth of the ΔgpsB mutant. Growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), shg8 (ΔgpsB reoY H87Y), shg10 (ΔgpsB reoY TAA74) and shg12 (ΔgpsB …

Figure 1—figure supplement 1
Download asset Open asset
Overexpression of reoM but not reoY affects growth of the L. monocytogenes ΔgpsB mutant.

(A) Growth of L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB) and LMJR106 (ΔgpsB+reoY) in BHI broth containing 1 mM IPTG at 37°C. (B) Growth of strains EGD-e (wt), LMJR19 (ΔgpsB), LMJR102 (wt+reo…

Figure 1—figure supplement 2
Download asset Open asset
Effect of reoM and reoY deletions on cell morphology.

Strains EGD-e (wt), LMJR19 (ΔgpsB), LMSW30 (ΔreoM), LMSW32 (ΔreoY), LMJR137 (ΔgpsB ΔreoM), and LMJR120 (ΔgpsB ΔreoY) were grown in BHI broth at 37°C to mid-logarithmic growth phase and cell lengths …

Figure 2 with 3 supplements
Download asset Open asset
Effect of the reoM, reoY and clpC genes on levels of MurA in L. monocytogenes and MurAA in B. subtilis.

(A) Effect of reoM and reoY deletions (single or when combined with gpsB deletion) on MurA (above) and DivIVA levels (middle) in L. monocytogenes strains EGD-e (wt), LMJR19 (ΔgpsB), LMSW30 (ΔreoM), …

Figure 2—figure supplement 1
Download asset Open asset
Complementation and epistasis experiments.

(A) Complementation of ΔreoY and ΔmurZ mutants. Western blot showing MurA amounts in L. monocytogenes strains EGD-e (wt), LMSW32 (ΔreoY), LMSW138 (ireoY), LMJR104 (ΔmurZ) and LMSW139 (imurZ, top). A …

Figure 2—figure supplement 2
Download asset Open asset
DivIVA stability in L. monocytogenes ΔclpC, ΔreoM and ΔreoY mutants.

Western blots following DivIVA levels after chloramphenicol treatment. L. monocytogenes strains EGD-e (wt), LMJR138 (ΔclpC), LMSW30 (ΔreoM) and LMSW32 (ΔreoY) were grown to an OD600 of 1.0 and 100 …

Figure 2—figure supplement 3
Download asset Open asset
Effect of reoM and reoY deletions on accumulation of other ClpC substrates in B. subtilis.

(A) Western blot showing GlmS amounts in B. subtilis strains 168 (wt), BKE00860 (ΔclpC), BKE27400 (ΔyrzL/reoM) and BKE22580 (ΔypiB/reoY, top). Strains were grown to mid-logarithmic growth phase for …

Figure 3 with 1 supplement
Download asset Open asset
MurA accumulation affects peptidoglycan biosynthesis and salt sensitivity.

(A) Minimal inhibitory concentrations (MIC) for ceftriaxone of mutants with altered MurA accumulation. Average values and standard deviations are calculated from three independent experiments and …

Figure 3—figure supplement 1
Download asset Open asset
ReoM and ReoY affect thickness of polar peptidoglycan.

(A) Representative micrographs from transmission electron microscopy images of ultrathin sections of fixed whole cells of L. monocytogenes wildtype, ΔreoM and ΔreoY mutants. (B) Quantification of …

Figure 4 with 4 supplements
Download asset Open asset
The PrkA/PrpC pair controls the phosphorylation status of ReoM.

(A–B) Non-denaturing, native PAGE analysis of the phosphorylation (A) and dephosphorylation (B) of ReoM in vitro. The components of each lane in the Coomassie-stained gel are annotated above the …

Figure 4—figure supplement 1
Download asset Open asset
LC-MS analysis of intact ReoM.

ESI-QTOF raw data for (A) unmodified ReoM and (B) mono-phosphorylated ReoM.

Figure 4—figure supplement 2
Download asset Open asset
LC-MS analysis of ReoM T7A.

ESI-QTOF raw data for (A) unmodified ReoM T7A and (B) ReoM T7A following incubation with PrkA-KD. (C) Overlaid deconvoluted mass spectrum demonstrating the lack of phosphorylation of ReoM T7A in the …

Figure 4—figure supplement 3
Download asset Open asset
Dephosphorylation of P-ReoM by PrpC.

LC-MS analysis of ReoM after PrpC incubation in the presence of manganese. (A) ESI-QTOF raw data and (B) deconvoluted mass spectrum demonstrating the presence of non-phosphorylated ReoM.

Figure 4—figure supplement 4
Download asset Open asset
Dephosphorylation of P-PrkA-KD by PrpC.

LC-MS analysis of intact PrkA-KD following incubation with PrpC (A) ESI-QTOF raw data and (B) deconvoluted mass spectrum indicating the presence of non-phosphorylated PrkA-KD.

Figure 5
Download asset Open asset
A ReoM T7A exchange affects growth and MurA levels in a ClpC-dependent manner.

(A) Lethality of the reoM T7A and reoM T7D mutations in L. monocytogenes. L. monocytogenes strains EGD-e (wt), LMSW30 (ΔreoM), LMSW57 (ireoM), LMSW52 (ireoM T7A) and LMSW53 (ireoM T7D) were grown in …

Figure 6 with 3 supplements
Download asset Open asset
Crystal structure of ReoM.

(A) The structure of ReoM depicted as a cartoon with each protomer in the dimer coloured separately (cyan and orange). The secondary structure elements are numbered according to their position in …

Figure 6—figure supplement 1
Download asset Open asset
ReoM and P-ReoM have the same oligomeric state.

Size exclusion chromatography of ReoM and P-ReoM showed that phosphorylation of ReoM does not alter its oligomeric state. Both ReoM (solid) and P-ReoM (dashed) had an elution volume at 14.6 mL.

Figure 6—figure supplement 2
Download asset Open asset
Lethality of ReoM R57A and R62A substitutions.

L. monocytogenes strains EGD-e (wt), LMSW52 (ireoM T7A), LMSW125 (ireoM R57A), and LMSW126 (ireoM R62A) were grown in BHI broth ±1 mM IPTG at 37°C. The experiment was repeated three times and …

Figure 6—figure supplement 3
Download asset Open asset
A possible conformational change of the flexible ReoM N-terminus induced by phosphorylation.

The N-terminus of ReoM might undergo a substantial movement after phosphorylation that would be stabilised in its new conformation by electrostatic interactions between the negatively charged …

Figure 7
Download asset Open asset
Effect of prkA and prpC mutations on growth and MurA levels of L. monocytogenes.

(A) Contribution of PrkA and PrpC to L. monocytogenes growth. L. monocytogenes strains EGD-e (wt), LMSW76 (ΔprpC prkA*), LMSW83 (iprpC) and LMSW84 (iprkA) were grown in BHI broth ±1 mM IPTG at 37°C …

Figure 8 with 1 supplement
Download asset Open asset
PrkA essentiality depends on reoM, reoY and clpC.

(A) Effect of reoM, reoY and clpC deletions on prkA essentiality. L. monocytogenes strains EGD-e (wt), LMSW84 (iprkA), LMSW89 (iprkA ΔreoM), LMSW90 (iprkA ΔreoY) and LMSW91 (iprkA ΔclpC) were grown …

Figure 8—figure supplement 1
Download asset Open asset
Bacterial two hybrid experiment showing interactions between MurA, ReoM, ReoY, ClpC and ClpP.

Plasmids carrying fusions of the T18- and T25-fragments of Bordetella pertussis adenylate cyclase fused to MurA, ReoM, ReoY, ClpC and ClpP of L. monocytogenes were cotransformed into E. coli BTH101 …

Figure 9
Download asset Open asset
ReoM links PrkA-dependent muropeptide sensing with peptidoglycan biosynthesis.

Model illustrating the role of ReoM as substrate of PrkA and as regulator of ClpCP. PrkA recognises free muropeptides, which activate PrkA to phosphorylate ReoM. In its unphosphorlyated form, ReoM …

Tables

Table 1
Summary of the data collection and refinement statistics for ReoM.
Data collection
BeamlineDiamond I03
Wavelength (Å)0.976
Resolution (Å)74.45–1.60 (1.63–1.60)*
Space groupP 21 21 21
a, b, c (Å)38.79, 58.62, 74.45
α, β, γ (°)90, 90, 90
Rpim0.064 (0.533)
CC (1/2) (%)98.6 (62.0)
<I>/<σ(I)>8.2 (2.2)
Completeness (%)99.8 (99.8)
Redundancy4.8 (4.9)
Total observations111229 (5581)
Unique reflections23059 (1129)
Refinement
Rwork (%)15.3
Rfree (%)21.4
Solvent content (%)38.0
# atoms
Protein1399
Ligand/ion20
Water94
B-factors (Å2)
Protein26.4
Ligand/ion50.5
Water37.7
R.m.s deviations
Bonds (Å)0.015
Angles (°)1.79

  1. *Where values in parentheses refer to the highest resolution shell.

Table 2
Plasmids and strains used in this study.
NameRelevant characteristicsSource*/reference
Plasmids
pIMK3Phelp-lacO lacI neoMonk et al., 2008
pMADbla erm bgaBArnaud et al., 2004
pUT18bla Plac-cya(T18)Karimova et al., 1998
pUT18Cbla Plac-cya(T18)Karimova et al., 1998
pKT25kan Plac-cya(T25)Karimova et al., 1998
p25-Nkan Plac-cya(T25)Claessen et al., 2008
pJR127bla erm bgaB ΔclpC (lmo0232)Rismondo et al., 2017
pSH246bla erm bgaB ΔgpsB (lmo1888)Rismondo et al., 2016
pJR68bla erm bgaB ΔmurZ (lmo2552)Rismondo et al., 2017
pJR71Phelp-lacO-murZ lacI neoRismondo et al., 2017
pJR65Phelp-lacO-reoM lacI neothis work
pJR70Phelp-lacO-reoY lacI neothis work
pJR83bla erm bgaB ∆reoY (lmo1921)this work
pJR101kan Plac-cya(T25)-reoMthis work
pJR102kan Plac-reoM-cya(T25)this work
pJR103bla Plac-reoM-cya(T18)this work
pJR104bla Plac-cya(T18)-reoMthis work
pJR109kan Plac-cya(T25)-reoYthis work
pJR111bla Plac-cya(T18)-reoYthis work
pJR116kan Plac-cya(T25)-murAthis work
pJR117kan Plac-murA-cya(T25)this work
pJR118bla Plac-murA-cya(T18)this work
pJR119bla Plac-cya(T18)-murAthis work
pJR121bla Plac-reoY-cya(T18)this work
pJR126bla erm bgaB ∆reoM (lmo1503)this work
pSW29Phelp-lacO-reoM T7A lacI neothis work
pSW30Phelp-lacO-reoM T7D lacI neothis work
pSW36bla erm bgaB ΔprkA (lmo1820)this work
pSW37bla erm bgaB ΔprpC (lmo1821)this work
pSW38Phelp-lacO-prkA lacI neothis work
pSW39Phelp-lacO-prpC lacI neothis work
pSW43kan Plac-cya(T25)-clpCthis work
pSW44kan Plac-cya(T25)-clpPthis work
pSW45kan Plac- clpC-cya(T25)this work
pSW46kan Plac-clpP-cya(T25)this work
pSW47bla Plac-clpC-cya(T18)this work
pSW48bla Plac-clpP-cya(T18)this work
pSW49bla Plac-cya(T18)-clpCthis work
pSW50bla Plac-cya(T18)-clpPthis work
pSW55Phelp-lacO-reoM R66A lacI neothis work
pSW56Phelp-lacO-reoM R70A lacI neothis work
pSW58Phelp-lacO-reoM R57A lacI neothis work
pSW59Phelp-lacO-reoM R62A lacI neothis work
B. subtilis strains
168wild type, lab collection
BKE00860ΔclpCKoo et al., 2017
BKE22180ΔgpsBKoo et al., 2017
BKE22580ΔypiB (reoY)Koo et al., 2017
BKE27400ΔyrzL (reoM)Koo et al., 2017
L. monocytogenes strains
EGD-ewild-type, serovar 1/2a strainGlaser et al., 2001
LMJR19ΔgpsB (lmo1888)Rismondo et al., 2016
LMJR104∆murZ (lmo2552)Rismondo et al., 2017
LMJR116attB::Phelp-lacO-murA lacI neoRismondo et al., 2017
LMJR123ΔmurA (lmo2526) attB::Phelp-lacO-murA lacI neoRismondo et al., 2017
LMJR138ΔclpC (lmo0232)Rismondo et al., 2017
shg8ΔgpsB reoY H87Ythis work
shg10ΔgpsB reoY TAA74this work
shg12ΔgpsB reoM RBS mutationthis work
LMJR96∆gpsB attB::Phelp-lacO-reoM lacI neopJR65 → LMJR19
LMJR102attB::Phelp-lacO-reoM lacI neopJR65 → EGD-e
LMJR106∆gpsB attB::Phelp-lacO-reoY lacI neopJR70 → LMJR19
LMJR120ΔgpsB ΔreoYpJR83 ↔ LMJR19
LMJR137ΔgpsB ΔreoMpJR126 ↔ LMJR19
LMJR171ΔclpC ΔmurZpJR127 ↔ LMJR104
LMSW30ΔreoM (lmo1503)pJR126 ↔ EGD-e
LMSW32ΔreoY (lmo1921)pJR83 ↔ EGD-e
LMSW50ΔclpC ΔreoMpJR127 ↔ LMSW30
LMSW51ΔclpC ΔreoYpJR127 ↔ LMSW32
LMSW52ΔreoM attB::Phelp-lacO-reoM T7A lacI neopSW29 → LMSW30
LMSW53ΔreoM attB::Phelp-lacO-reoM T7D lacI neopSW30 → LMSW30
LMSW57ΔreoM attB::Phelp-lacO-reoM lacI neopJR65 → LMSW30
LMSW72ΔreoM attB::Phelp-lacO-reoM T7A lacI neo ΔclpCpJR127 ↔ LMSW52
LMSW76ΔprpC prkA*pSW37 ↔ EGD-e
LMSW80attB::Phelp-lacO-prkA lacI neopSW38 → EGD-e
LMSW81attB::Phelp-lacO-prpC lacI neopSW39 → EGD-e
LMSW83ΔprpC attB::Phelp-lacO-prpC lacI neopSW37 ↔ LMSW81
LMSW84ΔprkA attB::Phelp-lacO-prkA lacI neopSW36 ↔ LMSW80
LMSW89ΔprkA attB::Phelp-lacO-prkA lacI neo ΔreoMpJR126 ↔ LMSW84
LMSW90ΔprkA attB::Phelp-lacO-prkA lacI neo ΔreoYpJR83 ↔ LMSW84
LMSW91ΔprkA attB::Phelp-lacO-prkA lacI neo ΔclpCpJR127 ↔ LMSW84
LMSW117ΔreoM ΔreoYpJR126 ↔ LMSW32
LMSW118ΔreoY ΔmurZpJR68 ↔ LMSW32
LMSW119ΔreoM ΔmurZpJR68 ↔ LMSW30
LMSW120ΔreoM attB::Phelp-lacO-reoM R66A lacI neopSW55 → LMSW30
LMSW121ΔreoM attB::Phelp-lacO-reoM R70A lacI neopSW56 → LMSW30
LMSW123ΔreoM attB::Phelp-lacO-reoM T7A lacI neo ΔreoYpSW29 → LMSW117
LMSW124ΔreoM attB::Phelp-lacO-reoM T7A lacI neo ΔmurZpSW29 → LMSW119
LMSW125ΔreoM attB::Phelp-lacO-reoM R57A lacI neopSW58 → LMSW30
LMSW126ΔreoM attB::Phelp-lacO-reoM R62A lacI neopSW59 → LMSW30
LMSW138ΔreoY attB::Phelp-lacO-reoY lacI neopJR70 → LMSW32
LMSW139ΔmurZ attB::Phelp-lacO-murZ lacI neopJR71 → LMJR104

  1. *The arrow (→) stands for a transformation event and the double arrow (↔) indicates gene deletions obtained by chromosomal insertion and subsequent excision of pMAD plasmid derivatives (see experimental procedures for details).

Table 3
Oligonucleotides used in this study.
NameSequence (5´→3´)
JR163GCGCCCATGGCTAAGGCATCCATTTCAATAGACGAGAAG
JR164GCGCGTCGACTTATTCTTTTTCCGTATCCATTTGCTGTA
JR169GCGCCCATGGATTCAAAAGATCAAACAATGTTTTACAACTTC
JR170GCGCGTCGACTCATTTCTCACCAATTTCGTTATTTTTCAG
JR197GCGCGGATCCCAATTATTTCGAATGGTGCGGTGTC
JR198TCCTTATTCGTCGACCATCTTTCCTCAGTCCCTTCCTG
JR199GGAAAGATGGTCGACGAATAAGGAATAAATCCTAGTTAGTAGGG
JR200CGCGCGAATTCCCAAGACTCAACCTCTTTCACTC
JR249GCGCCTGCAGAAAAAATTATTGTACGCGGTGGAAAAC
JR250GCGCGGTACCGCGAATAAAGACGCTAAGTTTGTTACATCG
JR253GCGCTCTAGAAAAGGCATCCATTTCAATAGACGAG
JR254GCGCGGTACCTCTTTTTCCGTATCCATTTGCTG
JR255GCGCTCTAGATTCAAAAGATCAAACAATGTTTTACAAC
JR256GCGCGGTACCTTCTCACCAATTTCGTTATTTTTCAG
JR257GCGCCTGCAGGGAAAAAATTATTGTACGCGGTGGAAAAC
JR264GCGCAGATCTGGCAAATACAGCATTGAACTATGTG
JR265GCGCGGATCCAATCGAAGCACCTCATTCCTTC
JR266GCGCGGATCCATGAGAATAATGGGTTTAGATGTCGGC
JR267GCGCGTCGACGCTAGGAATGTAGCAAGGATTTCTTC
SHW815GATCTATCGATGCATGCCATGGGCTAAATGACCAAGGAATTACCG
SHW816CGCGTCGGGCGATATCGGATCCTTTCTTCCGCGTTTTGGTAACG
SHW817CAATCATCATTTTAAAAGCACCTCACTATTTTTCAG
SHW818TGCTTTTAAAATGATGATTGGTAAGCGATTAAGC
SHW819GATCTATCGATGCATGCCATGGAGATAGAGGCAGAATAAGACATC
SHW820CGCGTCGGGCGATATCGGATCCGGTATTTACAACCACTACGTCG
SHW821CGTTCTTATTTCATGAAGCATCCCTCCCTTTC
SHW822TGCTTCATGAAATAAGAACGGAGGAAATGTGCTG
SHW830GCGCGCTCTAGATGGACGATTTACGCAAAGAGCTCAG
SHW831GCGCGCGGTACCTTAGCTTTTACTTTTTTAGAGGTTGTTTTC
SHW832GCGCGCTCTAGAAATTCCAACAGTAATTGAACAAACTAGC
SHW833GCGCGCGGTACCCCTTTTAAGCCAGATTTATTAATGATAATATC
SW77GTAAAACATTGCTTGATCTTTTGAATCCATGGGTTTCAC
SW78GATCAAGCAATGTTTTACAACTTCGGCGATGATTC
SW79GTAAAACATGTCTTGATCTTTTGAATCCATGGGTTTCAC
SW80GATCAAGACATGTTTTACAACTTCGGCG ATGATTC
SW110GCGCGCGGATCCATGCATGCAGAATTTAGAACAGATAG
SW111GCGCGCGTCGACTCATGAAGCATCCCTCCCTTTC
SW112GCGCGCGGATCCATGATGATTGGTAAGCGATTAAGCG
SW113GCGCGCGTCGACTTAATTTGGATAAGGGACTGTACCTTC
SW136CTAAACGAGCTATCATACTTCTAGCATCCTTGTGAC
SW137GTATGATAGCTCGTTTAGAACGAGATGAAATTATCGAG
SW138AATTTCATCTGCTTCTAAACGACGTATCATACTTCTAGC
SW139GTTTAGAAGCAGATGAAATTATCGAGGAACTTGTCAAAG
SW144CCTTGTGAGCAGGAATATAAGCAGGATCGCCTG
SW145TATATTCCTGCTCACAAGGATGCTAGAAGTATGATAC
SW146GTATCATACTTGCAGCATCCTTGTGACGAGGAATATAAG
SW147GGATGCTGCAAGTATGATACGTCGTTTAGAACGAG
Lmo1503FGCTATACCATGGATTCAAAAGATCAAACAATGTTTTACAAC
Lmo1503RCGATATCTCGAGTCATTTCTCACCAATTTCGTTATTTTTCAG
PrkAFGCTATACCATGGCAATGATGATTGGTAAGCGATTAAGCG
PrkARCGATATCTCGAGTCATTTTTTCTTTTTCTTATCTTTTTTCTCCTCAGG
PrpCFGCTATACCATGGCAATGCATGCAGAATTTAGAACAGATAGAG
PrpCRCGATATCTCGAGTCATGAAGCATCCCTCCCTTTC

Additional files

Supplementary file 1

Key resources table.

https://cdn.elifesciences.org/articles/56048/elife-56048-supp1-v2.docx
Transparent reporting form
https://cdn.elifesciences.org/articles/56048/elife-56048-transrepform-v2.docx

Download links