(A) Representative micrograph showing immunogold labelling of FNR in sections of chloroplasts from Wt Arabidopsis detected by IGL-TEM. White arrows indicate example gold particles. (B) Immunogold …
Mature Arabidopsis leaf protein extract was subjected to SDS-PAGE before immunoblotting and detection of (A) FNR, (B) cytochrome f (Cyt f), and (C) TROL. The gel was loaded with 20 µg protein for …
(A) Representative micrograph of a wt chloroplast, with acceptable uranyl acetate staining for detection of sub-chloroplast localisation of proteins. Chloroplast was immunolabelled to detect FNR. (B)…
Leaf extracts of Arabidopsis wt, fnr1, and fnr1 mutants transformed to express genes for the maize FNR proteins ZmFNR1, ZmFNR2, and ZmFNR3 in the fnr1 background were separated into soluble and …
Density of immunogold labelled FNR in different sub-chloroplast compartments of the indicated genotypes. Values are averages of three biological replicates, with combined label and area for the …
Areas of chloroplast sub-compartments were defined as displayed in Figure 1—figure supplement 2, before calculating the percentage area within the chloroplast of each indicated sub-compartment for …
(A) Traces show NADPH fluorescence of dark adapted Arabidopsis chloroplasts measured over a short light exposure from 10 to 40 s. Traces are averages of three to five independent chloroplast …
Arabidopsis plants of the indicated genotypes were grown in 12 hr light conditions at 150 µE/12 hr dark and mature leaf protein extract was subjected to SDS-PAGE before immunoblotting and detection …
(A) ECS measurements after a 20 s high light pulse on dark adapted leaves (grey background) and light acclimated leaves (5 min 150 µE m−2 s−1, actinic light). The relaxation kinetics of ECS were …
Electrochromic band shift (ECS) assay to compare generation of ΔpH without (stimulation of both photosystems) or with 20 µM DCMU (inhibition of photosystem II). (A) ECS measurements on leaves from …
(A) Representative normalised ECS traces following high light exposure to either red light (filled circles) or far red light (empty circles) after dark adaptation (left) and light acclimation at 150 …
Density of immunogold labelled FNR in different sub-chloroplast compartments of Wt Arabidopsis either dark incubated (left panel, same data as in Figure 3) or light incubated (right panel), prior to …
Traces show NADPH fluorescence of dark adapted Arabidopsis chloroplasts measured over a short light exposure from 10 to 40 s. Traces are averages of five separate chloroplast preparations (wt), or …
Analysis of data presented in Figure 1. Fixed effects taking either label density in the stroma as the intercept or label density in the margins/lamellae as the intercept. Linear mixed model fit by …
Deletion test carried out using Satterthwaite’s method with the R package lmerTest (Kuznetsova, Brockhoff & Christensen 2017). The model is a mixed effects model with random intercepts. The square root of response is the response variable, tissue is the fixed effect, and individual the random effect. | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Fixed effect deleted | Sum sq | Mean sq | Num DF | Den DF | F value | Pr (>F) | ||||||||||||||
Sub-compartment | 14.231 | 7.1153 | 2 | 295.58 | 7.4565 | 0.000693 | *** | |||||||||||||
Model summary: | ||||||||||||||||||||
Random effects: | ||||||||||||||||||||
Groups | Name | Variance | Std. Dev. | |||||||||||||||||
individual | (Intercept) | 0.1896 | 0.4354 | |||||||||||||||||
Residual | 0.9542 | 0.9769 | ||||||||||||||||||
Number of obs: 306, groups: individual, 6 | ||||||||||||||||||||
Fixed effects when fnr1 stroma is set as the intercept | ||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | ||||||||||||||||
(Intercept) | 0.9165 | 0.2791 | 4.2686 | 3.283 | 0.0276 | * | ||||||||||||||
Grana | −0.3607 | 0.1714 | 295.5794 | −2.105 | 0.0361 | * | ||||||||||||||
Margin/lamellae | 2.2884 | 0.1714 | 295.5794 | 13.355 | <2−16 | *** | ||||||||||||||
Genotype comparison WT:fnr1 | 0.1230 | 0.4128 | 5.0375 | 0.298 | 0.7776 | |||||||||||||||
WT grana: fnr1 grana | 0.6286 | 0.2845 | 295.5794 | 2.210 | 0.0279 | * | ||||||||||||||
WT margin/lamellae: fnr1 margin/lamellae | −0.4661 | 0.2845 | 295.5794 | −1.638 | 0.1025 | |||||||||||||||
Fixed effects when fnr1 margin/lamellae is set as the intercept | ||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | ||||||||||||||||
(Intercept) | 0.9165 | 0.2791 | 4.2686 | 11.482 | 0.000228 | *** | ||||||||||||||
Grana | −2.6491 | 0.1714 | 295.5794 | −15.460 | <2−16 | *** | ||||||||||||||
Stroma | −2.2884 | 0.1714 | 295.5794 | −13.355 | <2−16 | *** | ||||||||||||||
Genotype comparison WT:fnr1 | −0.3430 | 0.4128 | 5.0375 | −0.831 | 0.443524 | |||||||||||||||
WT grana: fnr1 grana | 1.0947 | 0.2845 | 295.5794 | 3.848 | 0.000146 | *** | ||||||||||||||
WT stroma: fnr1 stroma | −0.4661 | 0.2845 | 295.5794 | 1.638 | 0.102459 | |||||||||||||||
Fixed effects when Wt stroma is set as the intercept | ||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | ||||||||||||||||
(Intercept) | 1.0395 | 0.3041 | 5.8576 | 3.418 | 0.0147 | * | ||||||||||||||
Grana | 0.2679 | 0.2271 | 295.5794 | 1.180 | 0.2391 | |||||||||||||||
Margin/lamellae | 1.8223 | 0.2271 | 295.5794 | 8.024 | 2.43−14 | *** | ||||||||||||||
Genotype comparison WT:fnr1 | −0.1230 | 0.4128 | 5.0375 | −0.298 | 0.7776 | |||||||||||||||
Wt grana: fnr1 grana | −0.6286 | 0.2845 | 295.5794 | −2.210 | 0.0279 | * | ||||||||||||||
Wt margin/lamellae: fnr1 margin/lamellae | 0.4661 | 0.2845 | 295.5794 | 1.638 | 0.1025 | |||||||||||||||
Fixed effects when Wt margin/lamellae is set as the intercept | ||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | ||||||||||||||||
(Intercept) | 2.8618 | 0.3041 | 5.8576 | 9.411 | 9.41−05 | *** | ||||||||||||||
Grana | −1.5544 | 0.2271 | 295.5794 | −6.844 | 4.44−11 | *** | ||||||||||||||
Stroma | −1.8223 | 0.2271 | 295.5794 | −8.024 | 2.43−14 | *** | ||||||||||||||
Genotype comparison WT:fnr1 | 0.343 | 0.4128 | 5.0375 | 0.831 | 0.443524 | |||||||||||||||
Wt grana: fnr1 grana | −1.0947 | 0.2845 | 295.5794 | −3.848 | 0.000146 | *** | ||||||||||||||
Wt stroma: fnr1 stroma | −0.4661 | 0.2845 | 295.5794 | −1.638 | 0.102459 |
Analysis of data presented in Figure 3. Fixed effects taking either label density in the stroma as the intercept or label density in the margins/lamellae as the intercept. Linear mixed model fit by …
Wt Deletion test carried out using Satterthwaite’s method with the R package lmerTest (Kuznetsova, Brockhoff & Christensen 2017). The model is a mixed effects model with random intercepts. The square root of response is the response variable, tissue is the fixed effect, and individual the random effect. | |||||||
Fixed effect deleted | Sum Sq | Mean Sq | Num DF | Den DF | F value | Pr (>F) | |
Sub-compartment | 4.991 | 1.6637 | 3 | 6 | 36.152 | 0.0003089 | *** |
Model summary: | |||||||
Random effects: | |||||||
Groups | Name | Variance | Std. Dev. | ||||
Individual | (Intercept) | 0.21097 | 0.4593 | ||||
Residual | 0.04602 | 0.2145 | |||||
Number of obs: 12, groups: individual, 3 | |||||||
Fixed effects when stroma is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 1.1743 | 0.2927 | 2.6475 | 4.012 | 0.034961 | * | |
Grana | 0.3104 | 0.1752 | 6 | 1.772 | 0.126711 | ||
Lamellae | 1.4748 | 0.1752 | 6 | 8.42 | 0.000153 | *** | |
Margin | 1.3736 | 0.1752 | 6 | 7.842 | 0.000227 | *** | |
Fixed effects when lamellae is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 2.6491 | 0.2927 | 2.6475 | 9.051 | 0.004601 | ** | |
Grana | −1.1644 | 0.1752 | 6 | −6.648 | 0.00056 | *** | |
Margin | −0.1012 | 0.1752 | 6 | −0.578 | 0.584522 | ||
Stroma | −1.4748 | 0.1752 | 6 | −8.42 | 0.000153 | *** | |
fnr1 Deletion test carried out using Satterthwaite’s method with the R package lmerTest (Kuznetsova, Brockhoff & Christensen 2017). The model is a mixed effects model with random intercepts. The square root of response is the response variable, tissue is the fixed effect, and individual the random effect. | |||||||
Fixed effect deleted | Sum Sq | Mean Sq | Num DF | Den DF | F value | Pr (>F) | |
Sub-compartment | 5.6516 | 1.8839 | 3 | 6 | 26.204 | 0.000759 | *** |
Model summary: | |||||||
Random effects: | |||||||
Groups | Name | Variance | Std. Dev. | ||||
Individual | (Intercept) | 0.07521 | 0.2742 | ||||
Residual | 0.07189 | 0.2681 | |||||
Number of obs: 12, groups: individual, 3 | |||||||
Fixed effects when stroma is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 1.2117 | 0.2214 | 4.4836 | 5.472 | 0.003875 | ** | |
Grana | −0.1584 | 0.2189 | 6 | −0.724 | 0.496563 | ||
Lamellae | 0.9353 | 0.2189 | 6 | 4.272 | 0.005251 | ** | |
Margin | 1.5161 | 0.2189 | 6 | 6.925 | 0.000449 | *** | |
Fixed effects when lamellae is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 2.1469 | 0.2214 | 4.4836 | 9.695 | 0.000356 | *** | |
Grana | −1.0937 | 0.2189 | 6 | −4.996 | 0.002463 | ** | |
Margin | 0.5808 | 0.2189 | 6 | 2.653 | 0.037882 | * | |
Stroma | −0.9353 | 0.2189 | 6 | −4.272 | 0.005251 | ** | |
fnr1:ZmFNR1 Deletion test carried out using Satterthwaite’s method with the R package lmerTest (Kuznetsova, Brockhoff & Christensen 2017). The model is a mixed effects model with random intercepts. The square root of response is the response variable, tissue is the fixed effect, and individual the random effect. | |||||||
Fixed effect deleted | Sum Sq | Mean Sq | Num DF | Den DF | F value | Pr (>F) | |
Sub-compartment | 4.5242 | 1.5081 | 3 | 6.01 | 23.558 | 0.001009 | ** |
Model summary: | |||||||
Random effects: | |||||||
Groups | Name | Variance | Std. Dev. | ||||
Individual | (Intercept) | 0.0005984 | 0.02446 | ||||
Residual | 0.064017 | 0.25302 | |||||
Number of obs: 12, groups: individual, 3 | |||||||
Fixed effects when stroma is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 1.1754 | 0.1468 | 7.9979 | 8.009 | 4.34−05 | *** | |
Relevel grana | 0.2318 | 0.2066 | 6.01 | 1.122 | 0.304712 | ||
Relevel lamellae | 1.3774 | 0.2066 | 6.01 | 6.668 | 0.000547 | *** | |
Relevel margin | 1.2849 | 0.2066 | 6.01 | 6.22 | 0.000793 | *** | |
Fixed effects when lamellae is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 2.55285 | 0.14676 | 7.9979 | 17.395 | 1.22−07 | *** | |
Relevel grana | −1.14567 | 0.20659 | 6.01002 | −5.546 | 0.001444 | ** | |
Relevel margin | −0.09252 | 0.20659 | 6.01002 | −0.448 | 0.669949 | ||
Relevel stroma | −1.37744 | 0.20659 | 6.01002 | −6.668 | 0.000547 | *** | |
fnr1:ZmFNR2 | |||||||
Deletion test carried out using Satterthwaite’s method with the R package lmerTest (Kuznetsova, Brockhoff & Christensen 2017). The model is a mixed effects model with random intercepts. The square root of response is the response variable, tissue is the fixed effect, and individual the random effect. | |||||||
Fixed effect deleted | Sum Sq | Mean Sq | Num DF | Den DF | F value | Pr (>F) | |
Sub-compartment | 5.4414 | 1.8138 | 3 | 6 | 22.849 | 0.001106 | ** |
Model summary: | |||||||
Random effects: | |||||||
Groups | Name | Variance | Std. Dev. | ||||
Individual | (Intercept) | 0.02741 | 0.1656 | ||||
Residual | 0.07938 | 0.2817 | |||||
Number of obs: 12, groups: individual, 3 | |||||||
Fixed effects when stroma is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 1.1886 | 0.1887 | 6.6796 | 6.3 | 0.000488 | *** | |
Grana | 0.4864 | 0.23 | 6 | 2.114 | 0.078885 | . | |
Lamellae | 1.8298 | 0.23 | 6 | 7.954 | 0.00021 | *** | |
Margin | 0.9239 | 0.23 | 6 | 4.016 | 0.006989 | ** | |
Fixed effects when lamellae is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 3.0184 | 0.1887 | 6.6796 | 15.998 | 1.42−06 | *** | |
Grana | −1.3434 | 0.23 | 6 | −5.84 | 0.00111 | ** | |
Margin | −0.9059 | 0.23 | 6 | −3.938 | 0.00764 | ** | |
Stroma | −1.8298 | 0.23 | 6 | −7.954 | 0.00021 | *** | |
fnr1:ZmFNR3 | |||||||
Deletion test carried out using Satterthwaite’s method with the R package lmerTest (Kuznetsova, Brockhoff & Christensen 2017). The model is a mixed effects model with random intercepts. The square root of response is the response variable, tissue is the fixed effect, and individual the random effect. | |||||||
Fixed effect deleted | Sum Sq | Mean Sq | Num DF | Den DF | F value | Pr (>F) | |
Sub-compartment | 9.0046 | 3.0015 | 3 | 8 | 25.416 | 0.0001923 | *** |
Model summary: | |||||||
Random effects: | |||||||
Groups | Name | Variance | Std. Dev. | ||||
Individual | (Intercept) | 0 | 0 | ||||
Residual | 0.1181 | 0.3436 | |||||
Number of obs: 12, groups: individual, 3 | |||||||
Fixed effects when stroma is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 1.06794 | 0.19841 | 8 | 5.383 | 0.00066 | *** | |
Grana | 0.06284 | 0.28059 | 8 | 0.224 | 0.828395 | ||
Lamellae | 1.99447 | 0.28059 | 8 | 7.108 | 0.000101 | *** | |
Margin | 1.44343 | 0.28059 | 8 | 5.144 | 0.00088 | *** | |
Fixed effects when lamellae is set as the intercept: | |||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||
(Intercept) | 3.0624 | 0.1984 | 8 | 15.435 | 3.09−07 | *** | |
Grana | −1.9316 | 0.2806 | 8 | −6.884 | 0.000127 | *** | |
Margin | −0.551 | 0.2806 | 8 | −1.964 | 0.085144 | . | |
Stroma | −1.9945 | 0.2806 | 8 | −7.108 | 0.000101 | *** |
Analysis performed using the data in Figure 6. Fixed effects taking either label density in the stroma as the intercept or label density in the margins/lamellae as the intercept. Linear mixed model …
Deletion test carried out using Satterthwaite’s method with the R package lmerTest (Kuznetsova, Brockhoff & Christensen 2017). The model is a mixed effects model with random intercepts. The square root of response is the response variable, tissue is the fixed effect, and individual the random effect. | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Fixed effect deleted | Sum Sq | Mean Sq | Num DF | Den DF | F value | Pr (>F) | |||||||||||||||
Sub-compartment | 0.30184 | 0.10061 | 3 | 12 | 2.3613 | 0.1227 | |||||||||||||||
Model summary: | |||||||||||||||||||||
Random effects: | |||||||||||||||||||||
Groups | Name | Variance | Std. Dev. | ||||||||||||||||||
Individual | (Intercept) | 0.1073 | 0.3276 | ||||||||||||||||||
Residual | 0.04261 | 0.2064 | |||||||||||||||||||
Number of obs: 24, groups: individual, 6 | |||||||||||||||||||||
Fixed effects when dark adapted stroma is set as the intercept:: | |||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||||||||||||||||
(Intercept) | 1.1743 | 0.2235 | 6.3067 | 5.253 | 0.00164 | ** | |||||||||||||||
Grana | 0.3104 | 0.1685 | 12 | 1.842 | 0.09033 | . | |||||||||||||||
Lamellae | 1.4748 | 0.1685 | 12 | 8.75 | 1.48−06 | *** | |||||||||||||||
Margins | 1.3736 | 0.1685 | 12 | 8.15 | 3.11−06 | *** | |||||||||||||||
Light:dark comparison | 0.4157 | 0.3161 | 6.3067 | 1.315 | 0.23427 | ||||||||||||||||
Light:dark grana | 0.1421 | 0.2384 | 12 | 0.596 | 0.5622 | ||||||||||||||||
Light:dark lamellae | 0.1482 | 0.2384 | 12 | 0.622 | 0.54562 | ||||||||||||||||
Light:dark margins | 0.5963 | 0.2384 | 12 | 2.502 | 0.02782 | * | |||||||||||||||
Fixed effects when dark adapted lamellae is set as the intercept:: | |||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||||||||||||||||
(Intercept) | 2.64913 | 0.223542 | 6.306738 | 11.851 | 1.52−05 | *** | |||||||||||||||
Grana | −1.16437 | 0.168543 | 12.000001 | −6.908 | 1.63−05 | *** | |||||||||||||||
Margins | −0.101175 | 0.168543 | 12.000001 | −0.6 | 0.5595 | ||||||||||||||||
Stroma | −1.474807 | 0.168543 | 12.000001 | −8.75 | 1.48−06 | *** | |||||||||||||||
Light:dark comparison | 0.563988 | 0.316136 | 6.306738 | 1.784 | 0.1223 | ||||||||||||||||
Light:dark grana | −0.006164 | 0.238356 | 12.000001 | −0.026 | 0.9798 | ||||||||||||||||
Light:dark margins | 0.44808 | 0.238356 | 12.000001 | 1.88 | 0.0846 | . | |||||||||||||||
Light:dark stroma | −0.148241 | 0.238356 | 12.000001 | −0.622 | 0.5456 | ||||||||||||||||
Fixed effects when light acclimated stroma is set as the intercept: | |||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||||||||||||||||
(Intercept) | 1.5901 | 0.2235 | 6.3067 | 7.113 | 0.00031 | *** | |||||||||||||||
Grana | 0.4525 | 0.1685 | 12 | 2.685 | 0.01986 | * | |||||||||||||||
Lamellae | 1.623 | 0.1685 | 12 | 9.63 | 5.37−07 | *** | |||||||||||||||
Margins | 1.97 | 0.1685 | 12 | 11.688 | 6.48−08 | *** | |||||||||||||||
Dark:light comparison | −0.4157 | 0.3161 | 6.3067 | −1.315 | 0.23427 | ||||||||||||||||
Dark:light grana | −0.1421 | 0.2384 | 12 | −0.596 | 0.5622 | ||||||||||||||||
Dark:light lamellae | −0.1482 | 0.2384 | 12 | −0.622 | 0.54562 | ||||||||||||||||
Dark:light margins | −0.5963 | 0.2384 | 12 | −2.502 | 0.02782 | * | |||||||||||||||
Fixed effects when light acclimated lamellae is set as the intercept: | |||||||||||||||||||||
Estimate | Std. Error | DF | t value | Pr (>|t|) | |||||||||||||||||
(Intercept) | 3.213118 | 0.223542 | 6.306738 | 14.374 | 4.68−06 | *** | |||||||||||||||
Grana | −1.170535 | 0.168543 | 12.000001 | −6.945 | 1.55−05 | *** | |||||||||||||||
Margins | 0.346905 | 0.168543 | 12.000001 | 2.058 | 0.062 | . | |||||||||||||||
Stroma | −1.623048 | 0.168543 | 12.000001 | −9.63 | 5.37−07 | *** | |||||||||||||||
Dark:light comparison | −0.563988 | 0.316136 | 6.306738 | −1.784 | 0.1223 | ||||||||||||||||
Dark:light grana | 0.006164 | 0.238356 | 12.000001 | 0.026 | 0.9798 | ||||||||||||||||
Dark:light margins | −0.44808 | 0.238356 | 12.000001 | −1.88 | 0.0846 | . | |||||||||||||||
Dark:light stroma | 0.148241 | 0.238356 | 12.000001 | 0.622 | 0.5456 |
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Gene (Arabidopsis thaliana) | FNR1; FNR2 | GenBank | AT5G66190; AT1G20020 | |
Gene (Zea mays) | FNR1; FNR2; FNR3; TROL | GenBank | BAA88236; BAA88237; ACF85815; ACF79627.1 | |
Strain, strain background (Escherichia coli) | BL21(DE3) | Thermo Fisher | EC0114 | Competent cells |
Genetic reagent (A. thaliana) | Columbia; Columbia fnr1; Columbia ZmFNR1; Columbia ZmFNR3 | Arabidopsis Biological Resource Center (ABRC) See Twachtmann et al., 2012 for over-expression line generation | wt; AT1G20020 T-DNA insertion mutant; Line expressing BAA88236 under control of the AT1G20020 promoter; Line expressing ACF85815 under control of the AT1G20020 promoter | See Hanke et al., 2008 for mutant isolation; |
Antibody | Anti-maize FNR2 (Rabbit polyclonal) | This paper (Okutani et al., 2005) | BAA88237 | IG-TEM (1:200), WB (1:50,000). Raised in rabbit using recombinant mature purified maize FNR2 protein |
Antibody | Anti-maize Cyt f (Rabbit polyclonal) | This paper (Okutani et al., 2005) | IG-TEM (1:200), WB (1:5000) Raised in rabbit using Cyt f protein purified from maize leaves | |
Antibody | Anti-maize TROL (guinea pig polyclonal) | This paper | WB (1:10,000) Raised in guinea pig using TROL protein purified as described in the Materials and methods | |
Recombinant DNA reagent | pCold His-TROL (plasmid) | Takara-Bio; This paper | ACF79627.1 | Cloned as described in the Materials and methods |
Recombinant DNA reagent | pSAt-FNR1pro-Zm-FNR2 (plasmid) | From Twachtmann et al., 2012 | AT1G20020;BAA88237 | Plasmid for expressing maize FNR2 under control of the Arabidopsis FNR1 promoter |
Sequence-based reagent | TROL -F | Eurofins genomics (Ebersberg, Germany) | PCR primers | GTCGACGAGGATCGACAAAA |
Sequence-based reagent | TROL -R | Eurofins genomics (Ebersberg, Germany) | PCR primers | GAATTCCTAGACCCGGTTTCTT |
Peptide, recombinant protein | Maize TROL | Eurofins genomics (Ebersberg, Germany) | ACF79627.1 | Cloned and purified as described in the Materials and methods |
Summary of published information about Arabidopsis and maize FNR iso-proteins.
Taken from Hanke et al., 2005, Okutani et al., 2005, Lintala et al., 2009, Lintala et al., 2007, and Twachtmann et al., 2012. Kinetic parameters are for the reverse direction to photosynthesis (NADPH-dependent reduction of Fd).
Additional statistical analysis.
(a) Table of mixed effects model investigating changes in FNR density between different chloroplast sub-compartments in WT Arabidopsis. Analysis of data presented in Figure 1—figure supplement 2. Fixed effects taking either label density in the stroma as the intercept or label density in the margins/lamellae as the intercept. Linear mixed model fit by REML. Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘’ 1. (b) Table of mixed effects model investigating changes in cytochrome f density between different chloroplast sub-compartments in WT Arabidopsis. Analysis of data presented in Figure 1—figure supplement 2. Fixed effects taking either label density in the stroma as the intercept or label density in the margins/lamellae as the intercept. Linear mixed model fit by REML. Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘’ 1. (c) Table of fitting parameters and errors in comparison of light-dependent NADP+ reduction by different genotypes. Analysis performed using the data in Figure 4. Fits were calculated from experiments on individual chloroplast preparations, and then the parameters, and the fitting errors averaged. (d) Table of statistical analysis on the contribution of the fast phase to total amplitude of light-dependent fluorescence change in the chloroplast assay of NADP+ reduction. Analysis performed using the data averaged in Figure 4 and in (c). (e) Table of fitting parameters and errors in comparison of dark NADPH oxidation by different genotypes. Analysis performed using the data in Figure 4. Fits were calculated from experiments on individual chloroplast preparations, and then the parameters, and the fitting errors averaged. (f) Table of Pm values and statistical analysis of plants used for PAM analysis of the high light response. Analysis performed using the data in Figure 5, with example traces given in Figure 5—figure supplement 2. Pm determination of dark adapted leaves in order to calculate PSI parameters in response to high light treatment of Wt, fnr1, and fnr1 plants expressing either ZmFNR1, ZmFNR2, or ZmFNR3 Arabidopsis plants (see Figure 5). n = 5–7 replicates. Signif. codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 ‘.’ 0.1 ‘’ 1.