Inflammatory osteolysis is regulated by site-specific ISGylation of the scaffold protein NEMO
- Department of Orthopaedic Surgery and Cell Biology & Physiology, Washington University School of Medicine, United States
- Bone and Mineral Division, Department of Medicine, Washington University School of Medicine, United States
- Shriners Hospital for Children, United States
Figures
Figure 1 with 1 supplement
NEMOK270A mutant expression in BMMs exacerbates RANKL-induced osteoclastogenesis.
(A) Domain structure of NEMO (B) Western blot showing expression of pMX-NEMOWT (NM) and pMX-NEMO mutants (NM-K270A, NEMO-D304N and NM-K319A). (C) BMMs from WT and (LysM-cre-NEMO f/f) NEMO-cKO mice were transduced with viral particles (generated by transfecting pMX- retroviral vectors in PLAT-E cells) expressing NEMOWT (NM-WT) and NEMOK270A (NM-KA) and cultured in the presence of MCSF (10 ng/ml) and RANKL (50 ng/ml). (D) Representative TRAP staining for osteoclast (n = 8) and (D) quantification of TRAP positive OCs. qPCR analysis for OC marker genes (E) TRAP, (F) CTSK, (G) MMP9, (H) β3integrin, (I) DC-STAMP and (J) NFATC1 (p=0.057). Representative data (n = 3 independent experiments). (K) BMMs from RelA_luc reporter mice expressing NM-WT and NM-KA were cultured in the presence of MCSF (10 ng/ml) for 3 days followed by RANKL stimulation with RANKL (50 ng/ml) for 6 hr and RelA-luciferase activity measurement (n = 3). pMX-Flag-NEMOWT-RFP (NM-WT), pMX-Flag-NEMOK270A-RFP (NM-KA). (*p<0.05, **p<0.01 and ***p<0.001).
-
Figure 1—source data 1
Western blot showing expression ofpMX-NEMOWT(NM) andpMX-NEMOmutants (NM-K270A, NEMO-D304N and NM-K319A).
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig1-data1-v2.pdf
-
Figure 1—source data 2
qPCR analysis for OC marker genes.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig1-data2-v2.xlsx
-
Figure 1—source data 3
RelA-luciferase activity.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig1-data3-v2.xlsx
Figure 1—figure supplement 1
BMMs from wild type mice were transduced with viral particles (generated by transfecting pMX- retroviral vectors in PLAT-E cells) expressing NEMOWT (NM-WT), NEMOK270A (NM-KA), NEMO-D304N and NEMO-K319A constructs followed by culture in the presence of MCSF (10 ng/ml) and RANKL (50 ng/ml) for 4 days.
(A) Representative images for TRAP staining for osteoclast (n = 8). (B) Wild type BMMs were transduced with different dilution (1x, 0.5x, 0.25x, 0.1x and 0.05x) of retroviral particles expressing NEMOK270A (NM-KA). Wild type BMMs were also transduced with viral particles expressing NEMO-D304N and NEMO-K319N at 1x dilution. Western-blot using anti-flag antibody shows higher expression of NEMOK270A even at low viral dilution. pMX-Flag-NEMOWT-RFP (NM-WT), pMX-Flag-NEMOK270A-RFP (NM-KA).
Figure 2 with 1 supplement
Expression of NEMOK270A in vivo leads to inflammatory osteolysis and joint destruction.
NEMOK270A was conditionally expressed in myeloid cells (NM-KA mice) by crossing NEMOK270A f/f mice with LysozymeM cre expressing mice. (A) Whole body images of NM-KA mice compared to littermate wild type control mice (6 weeks old). The arrows point to deformed joints and swelling. (B) Photomicrograph of spleen and bone from NM-WT and NM-KA mice. MicroCT analysis of bone from NM-WT and NM-KA mice showing (C) femur trabecular bone, (D) knee joint osteolysis (arrow) and quantification of (E) Bone volume/total volume (BV/TV), (F) Connectivity density, (G) Trabecular number (Tb.N), (H) Trabecular thickness (Tb.Th) and (I) Trabecular separation (Tb.Sp) in the femur trabecular region (n = 6). Long bones from 6 weeks old NM-WT and NM-KA mice were processed for histology and stained for TRAP to visualize TRAP+ osteoclasts in (K) bone sections and (K) Articular surfaces of knee joint (arrow). Representative images (n = 6) Serum was collected from NM-WT and NM-KA to measure serum (L) TRAP and (M) CTX concentration as an indicator of increased osteoclast activity (n = 6–8). LysM-cre-NEMOWT-f/f (NM-WT), LysM-cre-NEMOK270A-f/f (NM-KA) mice. (*p<0.05, **p<0.01 and ***p<0.001).
-
Figure 2—source data 1
MicroCT analysis of bone from NM-WT and NM-KA mice.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig2-data1-v2.xlsx
-
Figure 2—source data 2
Serum concentration of TRAP and CTX.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig2-data2-v2.xlsx
Figure 2—figure supplement 1
Generation of NEMO transgenic mice.
Schematic diagram showing generation of conditional (A) NEMO-K270A-KI (NM-KA) and (B) NEMO-WT-Tg (NM-WT-Tg) mice (6 weeks old). (C) MicroCT images of paw and ankle joint showing osteolysis in NM-KA mice (arrow). X-ray images of NM-WT and NM-KA mice showing significant bone loss and deformities in (D) whole body (E) Knee joint (F) ankle and paw (arrow pointing towards osteolysis and deformed bones). (G) Whole body images of NM-WT and NM-WT-Tg mice (6 weeks old). (H) Photomicrograph of spleen and bone from NM-WT and NM-WT-Tg mice. MicroCT analysis showing quantification of (I) Bone volume/total volume (BV/TV), (J) Trabecular number (Tb.N), (K) Trabecular thickness (Tb.Th) and (L) Trabecular separation, between NM-WT and NM-WT-Tg mice (n = 3).
Figure 3 with 1 supplement
NEMOK270A mutation instigates systemic inflammation.
Serum was collected from NM-WT and NM-KA mice (n = 8–10) to measure concentration of inflammatory cytokines (A) Interleukin (IL) 1b, (B) IL-4, (C) IL-6, (D) IL-10, (E) IL-13, (F) IL-17, (G) Monocyte chemoattractant protein1 or CCL2, (H) Tumor necrosis factor alpha, (I) Macrophage colony stimulating factor, (J) macrophage Inflammatory protein (MCP)−1 or CCL3, (K) keratinocyte chemoattractant or neutrophil activating protein three or CXCL1 and (L) granulocyte colony stimulating factor (GCSF). (M) BMMs from NM-WT and NM-KA mice were isolated and cultured in the presence of MCSF (10 ng/ml) and RANKL (10 ng/ml). Representative TRAP staining for osteoclast (n = 8) is shown. (N–R) Representative qPCR analysis for OC marker genes TRAP, CTSK, β3integrin, DC-STAMP and NFATC1 (n = 3). (S) BMMs from NM-WT and NM-KA mice were isolated and cultured in the presence of MCSF (10 ng/ml) four days followed by serum starvation and stimulation with RANKL (50 ng/ml) for different time points (n = 8). Representative western-blot showing activation of p65 (phos-p65/p65 ratio) post RANKL stimulation in BMMs from NM-WT and NM-KA mice. LysM-cre-NEMO-WT-f/f (NM-WT), LysM-cre-NEMO-K270A-f/f (NM-KA) mice. (*p<0.05, **p<0.01 and ***p<0.001).
-
Figure 3—source data 1
Serum concentration of cytokines from NM-WT and NM-KA mice measured by ELISA.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Representative qPCR analysis for OC marker genes.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig3-data2-v2.xlsx
-
Figure 3—source data 3
Representative western-blot of p65 (phos-p65/p65 ratio) post RANKL stimulation in BMMs from NM-WT and NM-KA mice.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig3-data3-v2.pdf
Figure 3—figure supplement 1
BrdU was injected to NM-WT and NM-KA mice.
1 day after injection single cell suspensions from bone marrow were prepared by flushing the marrow out of femur and tibia. Following RBC lysis, cells were stained with different antibody cocktails. Flow analysis showing percentage of (A) Lin-Sca1+Kit+ (LSK) cells in haemopoietic stem cells (HSC), (B) percentage of common myeloid progenitor (CMP), granulocyte-monocyte progenitors (GMP) cells; proliferation of (C) LSK, (D) CMP and (E) GMP cells, (F) Myeloid cells and (G–J) proliferation of neutrophils populations. LysM-cre-NEMO-WT-f/f (NM-WT), LysM-cre-NEMO-K270A-f/f (NM-KA) mice.
Figure 4 with 1 supplement
NEMOK270A mutation hampers autophagy.
PLAT-E cells were transfected with retroviral pMX-Flag-NEMO-WT-RFP (NM-WT) and pMX-flag-NEMO-K270-RFP (NM-KA) expression vector. (A) Fluorescence images showing distribution of NM-WT-RFP in cytoplasm compared to puncta (yellow arrows) (juxtaposed to nuclei- DAPI stained) formation in case of NM-KA-RFP in PLAT-E cells. (B) Western blot for LC3 using WES (protein simple). BMMs were cultured for 2 days with RANKL (preOC) followed by 6 hr of serum starvation and western blotting. Fold change of LC3 relative to actin is indicated on top. (C) Quantification of LC3+ cells per high magnification field. (D) For flow cytometry, BMMs were transduced with pMX-GFP-LC3-RFP retrovirus generated in PLAT-E packing cells, and flow analysis was done to detect GFP signal or LC3 flux. Contour plots showing LC3-GFP+ expressing cells in NM-WT and NM-KA preOC (Blue: NM-WT without serum starvation, Red: NM-KA without serum starvation, and Black: after 6 hr of serum starvation), (E) Histograms representing shift in LC3-GFP+ cells following induction of autophagy (Red histogram: background signal in uninfected cells, Blue histogram: No serum starvation or 10% FBS control, yellow: 6 hr serum starvation, and pink: chloroquine), (F) Change in Mean fluorescent intensity (MFI) showing LC3-GFP signal in NM-WT and NM-KA preOC cells post autophagy induction. LysM-cre-NEMO-WT-f/f (NM-WT), LysM-cre-NEMO-K270A-f/f (NM-KA) mice. (*p<0.05). (*p<0.05, **p<0.01 and ***p<0.001).
-
Figure 4—source data 1
Western blot for LC3 using WES (protein simple).
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig4-data1-v2.pdf
-
Figure 4—source data 2
Quantification of LC3+ cells.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig4-data2-v2.xlsx
-
Figure 4—source data 3
LC3-GFP FACS analysis.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig4-data3-v2.xlsx
Figure 4—figure supplement 1
Autophagy is negatively impacted in NEMOK270A cells.
(A) Pre-OC (RANKL-treated BMMs) from NM-WT and NM-KA mice were pelleted and processed for electron microscopic and Immunofluorescence (IF) analysis after 6 hr of serum starvation. Representative Electron microscopic images (x7500) showing nucleus, Cell membrane (CM) lysosome (L) in NM-WT preOC and cytoplasmic aggregates (yellow arrow) in NM-KA preOC. (B) Representative IF images for NEMO (red), LC3 (green) and NEMO-LC3 colocalization (yellow). Arrows indicate accumulation of NEMO in LC3 positive vacuole-like structures. (C) Representative western blot showing expression of LC3 from BMMs starved and stimulated with RANKL as shown. (D) Representative Western blot for mTOR expression in BMMs from NM-WT and NM-KA mice treated as shown. (E) Pre-osteoclasts were treated with chloroquine as indicated and number of TRAP+ multi nucleated osteoclasts (MNC) per well were counted in triplicate wells from three independent experiments (*p<0.05).
Figure 5 with 1 supplement
NEMOK270A is restricted to autophagosomes whereas NEMOWT is delivered to lysosomes.
preOC from NM-WT and NM-KA mice were pelleted and processed for Immunofluorescence (IF) and electron microscopic analyses after 6 hr of serum starvation. (A) Representative IF images showing NEMO (red) and LAMP1 (green). Arrows indicate colocalization of NEMO in LAMP1 positive vacuole-like structures in NM-WT, which is decreased in NM-KA preOC. (B) Representative electron microscopic images (x7500) lysosome (L), Autophagosome (AP) and APL (Autophagolysosome). (C) Representative IF images showing changes in cellular NEMO organization in response to autophagy induction by serum starvation in NM-WT and NM-KA preOC cells. NEMO-puncta (white) and nucleus (blue). (D) NEMO-puncta quantification. LysM-cre-NEMO-WT-f/f (NM-WT), LysM-cre-NEMO-K270A-f/f (NM-KA) mice. (*p<0.05, **p<0.01 and ***p<0.001).
-
Figure 5—source data 1
NEMO-puncta quantification.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
preOC from NM-WT and NM-KA mice were processed for Immunofluorescence (IF) analysis after 6 hr of serum starvation.
(A) NEMO-puncta determination in IgG control and (B) chloroquinone (CQ) treated pOC and quantification. (C) NEMO puncta quantification in presence of chloroquinone (CQ).
Figure 6 with 1 supplement
Intact NEMO K270 residue is essential for post-translational modification (PTM) by ISG15.
(A) Volcano plot showing changes in autophagy and PTM related proteins in immunoprecipitated lysates from NM-WT compared with NM-KA BMMs using anti-NEMO antibody. preOC from NM-WT and NM-KA mice were processed for Immunofluorescence (IF) and Immuno-electron microscopy (EM) analysis after 6 hr of serum starvation. (B) Representative IF images of NEMO (red) and ISG15 (green) co-localization in preOC. White arrows indicate foci of expression of ISG15 (enlarged inset at bottom of panel B). Yellow arrows indicating NEMO-ISG15 co-localization. (C) ISGylated proteins (upper panel) and free ISG15 in response to RANKL treatment. (D) BMMs from WT and ISG15-KO mice were isolated and cultured in the presence of MCSF (10 ng/ml) and RANKL (50 ng/ml) for four days. Representative TRAP staining for osteoclast (D) and quantification (E). (**p<0.01).
-
Figure 6—source data 1
Proteomic data from immunoprecipitated lysates from NM-WT compared with NM-KA BMMs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig6-data1-v2.xlsx
-
Figure 6—source data 2
Western blots for ISGylated proteins and free ISG15 in response to RANKL treatment.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig6-data2-v2.pdf
-
Figure 6—source data 3
Osteoclast quantification from WT and ISG15-KO in vitro cultures.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig6-data3-v2.xlsx
Figure 6—figure supplement 1
Representative Immuno-EM images (x7,500) showing localization of NEMO (black arrows) and ISG15 (blue arrow) in NM-WT and NM-KA cells; lysosomes (L), autophagosome (AP).
Large black dot: NEMO (18 nm gold particle), small black dot: ISG15 (12 nm gold particle). BMMs from NM-WT and NM-KA mice cells treated with RANKL for different time points followed by western blot.
Figure 7 with 1 supplement
ISGylation of NEMO is essential to restrain osteoclastogenesis.
BMMs from NM-WT and NM-KA mice were transduced with viral particles (generated by transfecting pMX- retroviral vectors in PLAT-E cells) expressing ISG15 and cultured in the presence of MCSF (10 ng/ml) and RANKL (50 ng/ml) for 4 days. (A) Representative TRAP staining for osteoclast (n = 6) and (B) quantification of TRAP positive OCs. (C) BMMs from NM-WT and NM-KA mice were transduced with ISG15 and pMRX-GFP-LC3-RFP retrovirus generated in PLAT-E packing cells. The cells were cultured for 2 days (preOC) followed by 6 hr of serum starvation and flow analysis to detect GFP signal or LC3 flux. (C) Histograms representing shift in LC3-GFP+ cells following induction of autophagy. Blue histogram: serum starvation, yellow histogram: serum starvation + ISG15 expression (D) Change in Mean Fluorescent Intensity (MFI) showing LC3-GFP signal. (E) Wild type BMMs transduced with viral particles (generated by transfecting pMX- retroviral vectors in PLAT-E cells) expressing NEMO+/-ISG15, NEMO-K270A+/-ISG15 NEMO-WT::ISG15 (fused) and NEMO-K270A::ISG15 (fused) protein and cultured in the presence of MCSF (10 ng/ml) and RANKL (50 ng/ml) for 4 days.(E) Representative TRAP staining for osteoclast (n = 3) and (F) quantification of TRAP positive OCs. (G) NEMO puncta regulation by ISG15: Live images of preOC expressing RFP-NEMOWT+/-ISG15, RFP-NEMOK270A+/-ISG15, GFP-NEMOWT::ISG15 and GFP-NEMOK270A::ISG15 fusion protein. Yellow arrows indicate NEMOK270A puncta. ISG15 panel which is not tagged serves as background control. (H) Quantification of LC3 puncta+ preOC cells shown in Figure 7—figure supplement 1. (I) WB for LC3 in preOC expressing NEMOWT+/-ISG15, NEMOK270A+/-ISG15, NEMOWT::ISG15 and NEMOK270A::ISG15 fusion protein. (*p<0.05, **p<0.01 and ***p<0.001). (::) denotes fusion. (J) Representative IF images (NEMO (Red); LAMP1(green)). NEMO localization in preOC expressing NEMOWT+/-ISG15, NEMOK270A+/-ISG15, NEMOWT::ISG15 and NEMOK270A::ISG15 fusion protein. Green arrow- Lysosome and Yellow arrow-localization of NEMO in Lysosome.
-
Figure 7—source data 1
quantification of TRAP positive OCs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data1-v2.xlsx
-
Figure 7—source data 2
LC3-GFP FACS analysis.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data2-v2.xlsx
-
Figure 7—source data 3
Quantification of TRAP positive OCs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data3-v2.xlsx
-
Figure 7—source data 4
Quantification of LC3 positive puncta in pre-OC cells shown in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data4-v2.xlsx
-
Figure 7—source data 5
Western blot for LC3 expression in preOC expressing different NEMO and ISG15 constructs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data5-v2.pdf
Figure 7—figure supplement 1
LC3 puncta accumulation of NEMOK270A is reduced by forced fusion with ISG15.
(A) Representative IF images for LC3 puncta+ cells (arrow) in preOC expressing NEMOWT+/-ISG15, NEMOK270A+/-ISG15, NEMOWT::ISG15 and NEMOK270A::ISG15 fusion protein (quantified in Figure 7H).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-floxed | Dr. Manolis Pasparakis, Cologne, Germany | NM-f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-K270A-floxed | Mouse Genetics Core, Washington University in St.Louis | NM-KA-f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-WT-Tg-floxed | Mouse Genetics Core, Washington University in St.Louis | NM-WT-Tg f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Lyz2 (Lysozyme M)-cre | LysM-cre | C57BL/6 background | |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-flox | This Paper | NM-cKO | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-K270A-f/f | This Paper | NM-KA | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-WT-f/f | This Paper | NM-WT-Tg | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | RELA (NF-ĸB)-GFP-luciferase reporter | The Jackson Laboratory | NF-ĸB reporter mice | C57BL/6 background |
| Recombinant DNA reagent | pMX- retroviral vector | Cell biolabs | Cat# RTV-010 | Retroviral vector |
| Recombinant DNA reagent | pMX-GFP | This paper | GFP version of pMX retroviral vector | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-RFP | This paper | NEMO WT with flag tag and RFP on pMX backbone-Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K270A-RFP | This paper | NEMO K270A mutant with flag tag and RFP on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-D304N | This paper | NEMO D304N mutant on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K319A | This paper | NEMO K319A mutant with Flag tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-GFP | This paper | NEMO WT with Flag tag and GFP on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-HA-ISG15 | This paper | ISG15 with HA tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-ISG15-GFP | This paper | NEMO WT-ISG15 fusion construct with GFP tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K270A-ISG15-GFP | This paper | NEMO K270A-ISG15 fusion construct with GFP tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | PMRX-GFP-LC3-RFP retrovirus | AddGene | Cat# 84573 | LC3 wth GFP and RFP on PMRX backbone |
| Recombinant DNA reagent | Xtreme gene 9 | Roche | Cat# 6365809001 | Transfection reagent |
| Cell line (Homo-sapiens) | PLAT-E | Cell biolabs | Cat# RV-101 | For generating retroviruses |
| Commercial assay or kit | TRAP-Leukocyte kit | Millipore-Sigma | Cat# 387A-1KT | Identify osteoclasts |
| Commercial assay or kit | luciferase activity | GoldBio | Cat# I920-50 | NFkB activity assay |
| Commercial assay or kit | BCA assay | Thermo Fisher | Cat# 23227 | Quantitation of protein |
| Other | Cell lysis buffer | Cell Signaling | Cat# 9803S | Western blot reagent |
| Antibody | donkey anti-rabbit and anti-mouse | LI-COR Biosciences | Cat# 926–32213, RRID:AB_621848 | WB(1:10,000) |
| Antibody | NEMO (Rabbit polyclonal/Mouse monoclonal) | Santa Cruz | Cat# SC-8330, RRID:AB_2124846 | IF(1:200), WB(1:1000) |
| Antibody | LAMP-1 (Mouse monoclonal) | Santa Cruz | Cat# SC-20011, RRID:AB_626853 | IF(1:200) |
| Antibody | ISG15 (Mouse monoclonal) | Santa Cruz | Cat# SC-166755, RRID:AB_2126308 | IF(1:200), WB(1:1000) |
| Antibody | phos-p65 (Rabbit polyclonal) | Cell Signaling | Cat# 3031, RRID:AB_330559 | WB(1:1000) |
| Antibody | p65 (Rabbit polyclonal) | Cell Signaling Technology, | Cat# 8242, RRID:AB_10859369 | WB(1:1000) |
| Antibody | LC3 (Rabbit polyclonal) | Cell Signaling Technology, | Cat# 3868, RRID:AB_2137707 | IF(1:200), WB(1:1000) |
| Antibody | Flag (Rabbit polyclonal) | Millipore-Sigma | Cat# F1804, RRID:AB_262044 | WB(1:1000) |
| Antibody | β-actin (Mouse monoclonal) | Millipore-Sigma | Cat# A2228, RRID:AB_476697 | WB(1:5000) |
| Antibody | anti-B220 (Rat monoclonal) | Thermo Fisher | Cat# 14-0452-82, RRID:AB_467254 | FACS (1 µL per test) |
| Antibody | anti-CD3e (Armenian hamster monoclonal) | Biolegend | Cat# 100301, RRID:AB_312666 | FACS (1 µL per test) |
| Antibody | anti-Gr1 (Rat monoclonal) | Thermo Fisher | Cat# 14-5931-82, RRID:AB_467730 | FACS (1 µL per test) |
| Antibody | anti-Ter119 (Rat monoclonal) | BD Bioscience | Cat#550565, RRID:AB_393756 | FACS (1 µL per test) |
| Antibody | anti-Sca1 PerCP Cy5.5 (Rat monoclonal) | Thermo Fisher | Cat# 122523, RRID:AB_893621 | FACS (1 µL per test) |
| Antibody | anti-c-Kit APC eFluor 780 (Mouse monoclonal) | Thermo Fisher | Cat# 47-1171-82, RRID:AB_1272177 | FACS (1 µL per test) |
| Antibody | anti-CD34 FITC (Mouse monoclonal) | Thermo Fisher | Cat# 343503, RRID:AB_343503 | FACS (1 µL per test) |
| Antibody | CD16/32 eFluor450 (Rat monoclonal) | Thermo Fisher | Cat# 48-0161-82, RRID:AB_1272191 | FACS (1 µL per test) |
| Antibody | colloidal gold conjugated secondary antibodies | Jackson ImmunoResearch Laboratories | Cat# 715-205-150, RRID:AB_2340822 | Electron microscopy (1:25) |
| Antibody | Alexa Fluor 568 (goat anti-mouse IgG) | Thermo Fisher | Cat# A11031, RRID:AB_144696 | IF (1:2000) |
| Antibody | Alexa Fluor 488 (goat-anti-rabbit IgG) | Thermo Fisher | Cat# A11034, RRID:AB_2576217 | IF (1:2000) |
| Commercial assay or kit | multiplex mouse cytokine kits | R and D Systems | Cat# AYR006 | Inflammation markers |
| Commercial assay or kit | multiplex mouse cytokine kits | Millipore-Sigma | Cat# MCYTMAG-70K-PX32 | Inflammation markers |
| Commercial assay or kit | RatLaps (CTX-1) EIA | Immunodiagnostic Systems | Cat# AC-06F1 | Serum cross‐linked telopeptide of type I collagen (CTX‐I)-bone resorption marker |
| Commercial assay or kit | Mouse TRAP (TRAcP 5b) kits | Immunodiagnostic Systems | Cat# SB TR-103 | osteoclast marker |
| Commercial assay or kit | PureLink RNA mini kit | Thermo Fisher | Cat# 12183025 | RNA isolation |
| Other | iTaq universal SYBR green super-mix | BioRad | Cat# 1725120 | Real-Time PCR reagent |
| Sequence-based reagent | TRAP_F | IDT | PCR primer | CGACCATTGTTAGCCACATACG |
| Sequence-based reagent | TRAP_R | IDT | PCR primer | CACATAGCCCACACCGTTCTC |
| Sequence-based reagent | CTSK_F | IDT | PCR primer | ATGTGGGTGTTCAAGTTTCTGC |
| Sequence-based reagent | CTSK_R | IDT | PCR primer | CCACAAGATTCTGGGGACTC |
| Sequence-based reagent | MMP9_F | IDT | PCR primer | ACTGGGCTTAGATCATTCCAGCGT |
| Sequence-based reagent | MMP9_R | IDT | PCR primer | ACACCCACATTTGACGTCCAGAGA |
| Sequence-based reagent | NFATC1_F | IDT | PCR primer | CCGGGACGCCCATGCAATCTGTTAGT |
| Sequence-based reagent | NFATC1_R | IDT | PCR primer | GCGGGTGCCCTGAGAAAGCTACTCTC |
| Software, algorithm | ImageJ | Imagej.nih.gov | IF image processing, count | |
| Software, algorithm | GraphPad | Graphpad prism-8 software | Statistical Analysis software | Graph preparation, statistical analysis |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Inflammatory osteolysis is regulated by site-specific ISGylation of the scaffold protein NEMO
eLife 9:e56095.
https://doi.org/10.7554/eLife.56095
