Inflammatory osteolysis is regulated by site-specific ISGylation of the scaffold protein NEMO
- Department of Orthopaedic Surgery and Cell Biology & Physiology, Washington University School of Medicine, United States
- Bone and Mineral Division, Department of Medicine, Washington University School of Medicine, United States
- Shriners Hospital for Children, United States
Figures
Figure 1 with 1 supplement
NEMOK270A mutant expression in BMMs exacerbates RANKL-induced osteoclastogenesis.
(A) Domain structure of NEMO (B) Western blot showing expression of pMX-NEMOWT (NM) and pMX-NEMO mutants (NM-K270A, NEMO-D304N and NM-K319A). (C) BMMs from WT and (LysM-cre-NEMO f/f) NEMO-cKO mice …
-
Figure 1—source data 1
Western blot showing expression ofpMX-NEMOWT(NM) andpMX-NEMOmutants (NM-K270A, NEMO-D304N and NM-K319A).
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig1-data1-v2.pdf
-
Figure 1—source data 2
qPCR analysis for OC marker genes.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig1-data2-v2.xlsx
-
Figure 1—source data 3
RelA-luciferase activity.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig1-data3-v2.xlsx
Figure 1—figure supplement 1
BMMs from wild type mice were transduced with viral particles (generated by transfecting pMX- retroviral vectors in PLAT-E cells) expressing NEMOWT (NM-WT), NEMOK270A (NM-KA), NEMO-D304N and NEMO-K319A constructs followed by culture in the presence of MCSF (10 ng/ml) and RANKL (50 ng/ml) for 4 days.
(A) Representative images for TRAP staining for osteoclast (n = 8). (B) Wild type BMMs were transduced with different dilution (1x, 0.5x, 0.25x, 0.1x and 0.05x) of retroviral particles expressing …
Figure 2 with 1 supplement
Expression of NEMOK270A in vivo leads to inflammatory osteolysis and joint destruction.
NEMOK270A was conditionally expressed in myeloid cells (NM-KA mice) by crossing NEMOK270A f/f mice with LysozymeM cre expressing mice. (A) Whole body images of NM-KA mice compared to littermate wild …
-
Figure 2—source data 1
MicroCT analysis of bone from NM-WT and NM-KA mice.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig2-data1-v2.xlsx
-
Figure 2—source data 2
Serum concentration of TRAP and CTX.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig2-data2-v2.xlsx
Figure 2—figure supplement 1
Generation of NEMO transgenic mice.
Schematic diagram showing generation of conditional (A) NEMO-K270A-KI (NM-KA) and (B) NEMO-WT-Tg (NM-WT-Tg) mice (6 weeks old). (C) MicroCT images of paw and ankle joint showing osteolysis in NM-KA …
Figure 3 with 1 supplement
NEMOK270A mutation instigates systemic inflammation.
Serum was collected from NM-WT and NM-KA mice (n = 8–10) to measure concentration of inflammatory cytokines (A) Interleukin (IL) 1b, (B) IL-4, (C) IL-6, (D) IL-10, (E) IL-13, (F) IL-17, (G) Monocyte …
-
Figure 3—source data 1
Serum concentration of cytokines from NM-WT and NM-KA mice measured by ELISA.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Representative qPCR analysis for OC marker genes.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig3-data2-v2.xlsx
-
Figure 3—source data 3
Representative western-blot of p65 (phos-p65/p65 ratio) post RANKL stimulation in BMMs from NM-WT and NM-KA mice.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig3-data3-v2.pdf
Figure 3—figure supplement 1
BrdU was injected to NM-WT and NM-KA mice.
1 day after injection single cell suspensions from bone marrow were prepared by flushing the marrow out of femur and tibia. Following RBC lysis, cells were stained with different antibody cocktails. …
Figure 4 with 1 supplement
NEMOK270A mutation hampers autophagy.
PLAT-E cells were transfected with retroviral pMX-Flag-NEMO-WT-RFP (NM-WT) and pMX-flag-NEMO-K270-RFP (NM-KA) expression vector. (A) Fluorescence images showing distribution of NM-WT-RFP in …
-
Figure 4—source data 1
Western blot for LC3 using WES (protein simple).
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig4-data1-v2.pdf
-
Figure 4—source data 2
Quantification of LC3+ cells.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig4-data2-v2.xlsx
-
Figure 4—source data 3
LC3-GFP FACS analysis.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig4-data3-v2.xlsx
Figure 4—figure supplement 1
Autophagy is negatively impacted in NEMOK270A cells.
(A) Pre-OC (RANKL-treated BMMs) from NM-WT and NM-KA mice were pelleted and processed for electron microscopic and Immunofluorescence (IF) analysis after 6 hr of serum starvation. Representative …
Figure 5 with 1 supplement
NEMOK270A is restricted to autophagosomes whereas NEMOWT is delivered to lysosomes.
preOC from NM-WT and NM-KA mice were pelleted and processed for Immunofluorescence (IF) and electron microscopic analyses after 6 hr of serum starvation. (A) Representative IF images showing NEMO …
-
Figure 5—source data 1
NEMO-puncta quantification.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
preOC from NM-WT and NM-KA mice were processed for Immunofluorescence (IF) analysis after 6 hr of serum starvation.
(A) NEMO-puncta determination in IgG control and (B) chloroquinone (CQ) treated pOC and quantification. (C) NEMO puncta quantification in presence of chloroquinone (CQ).
Figure 6 with 1 supplement
Intact NEMO K270 residue is essential for post-translational modification (PTM) by ISG15.
(A) Volcano plot showing changes in autophagy and PTM related proteins in immunoprecipitated lysates from NM-WT compared with NM-KA BMMs using anti-NEMO antibody. preOC from NM-WT and NM-KA mice …
-
Figure 6—source data 1
Proteomic data from immunoprecipitated lysates from NM-WT compared with NM-KA BMMs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig6-data1-v2.xlsx
-
Figure 6—source data 2
Western blots for ISGylated proteins and free ISG15 in response to RANKL treatment.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig6-data2-v2.pdf
-
Figure 6—source data 3
Osteoclast quantification from WT and ISG15-KO in vitro cultures.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig6-data3-v2.xlsx
Figure 6—figure supplement 1
Representative Immuno-EM images (x7,500) showing localization of NEMO (black arrows) and ISG15 (blue arrow) in NM-WT and NM-KA cells; lysosomes (L), autophagosome (AP).
Large black dot: NEMO (18 nm gold particle), small black dot: ISG15 (12 nm gold particle). BMMs from NM-WT and NM-KA mice cells treated with RANKL for different time points followed by western blot.
Figure 7 with 1 supplement
ISGylation of NEMO is essential to restrain osteoclastogenesis.
BMMs from NM-WT and NM-KA mice were transduced with viral particles (generated by transfecting pMX- retroviral vectors in PLAT-E cells) expressing ISG15 and cultured in the presence of MCSF (10 …
-
Figure 7—source data 1
quantification of TRAP positive OCs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data1-v2.xlsx
-
Figure 7—source data 2
LC3-GFP FACS analysis.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data2-v2.xlsx
-
Figure 7—source data 3
Quantification of TRAP positive OCs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data3-v2.xlsx
-
Figure 7—source data 4
Quantification of LC3 positive puncta in pre-OC cells shown in Figure 7—figure supplement 1.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data4-v2.xlsx
-
Figure 7—source data 5
Western blot for LC3 expression in preOC expressing different NEMO and ISG15 constructs.
- https://cdn.elifesciences.org/articles/56095/elife-56095-fig7-data5-v2.pdf
Figure 7—figure supplement 1
LC3 puncta accumulation of NEMOK270A is reduced by forced fusion with ISG15.
(A) Representative IF images for LC3 puncta+ cells (arrow) in preOC expressing NEMOWT+/-ISG15, NEMOK270A+/-ISG15, NEMOWT::ISG15 and NEMOK270A::ISG15 fusion protein (quantified in Figure 7H).
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-floxed | Dr. Manolis Pasparakis, Cologne, Germany | NM-f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-K270A-floxed | Mouse Genetics Core, Washington University in St.Louis | NM-KA-f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-WT-Tg-floxed | Mouse Genetics Core, Washington University in St.Louis | NM-WT-Tg f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Lyz2 (Lysozyme M)-cre | LysM-cre | C57BL/6 background | |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-flox | This Paper | NM-cKO | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-K270A-f/f | This Paper | NM-KA | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-WT-f/f | This Paper | NM-WT-Tg | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | RELA (NF-ĸB)-GFP-luciferase reporter | The Jackson Laboratory | NF-ĸB reporter mice | C57BL/6 background |
| Recombinant DNA reagent | pMX- retroviral vector | Cell biolabs | Cat# RTV-010 | Retroviral vector |
| Recombinant DNA reagent | pMX-GFP | This paper | GFP version of pMX retroviral vector | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-RFP | This paper | NEMO WT with flag tag and RFP on pMX backbone-Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K270A-RFP | This paper | NEMO K270A mutant with flag tag and RFP on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-D304N | This paper | NEMO D304N mutant on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K319A | This paper | NEMO K319A mutant with Flag tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-GFP | This paper | NEMO WT with Flag tag and GFP on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-HA-ISG15 | This paper | ISG15 with HA tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-ISG15-GFP | This paper | NEMO WT-ISG15 fusion construct with GFP tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K270A-ISG15-GFP | This paper | NEMO K270A-ISG15 fusion construct with GFP tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | PMRX-GFP-LC3-RFP retrovirus | AddGene | Cat# 84573 | LC3 wth GFP and RFP on PMRX backbone |
| Recombinant DNA reagent | Xtreme gene 9 | Roche | Cat# 6365809001 | Transfection reagent |
| Cell line (Homo-sapiens) | PLAT-E | Cell biolabs | Cat# RV-101 | For generating retroviruses |
| Commercial assay or kit | TRAP-Leukocyte kit | Millipore-Sigma | Cat# 387A-1KT | Identify osteoclasts |
| Commercial assay or kit | luciferase activity | GoldBio | Cat# I920-50 | NFkB activity assay |
| Commercial assay or kit | BCA assay | Thermo Fisher | Cat# 23227 | Quantitation of protein |
| Other | Cell lysis buffer | Cell Signaling | Cat# 9803S | Western blot reagent |
| Antibody | donkey anti-rabbit and anti-mouse | LI-COR Biosciences | Cat# 926–32213, RRID:AB_621848 | WB(1:10,000) |
| Antibody | NEMO (Rabbit polyclonal/Mouse monoclonal) | Santa Cruz | Cat# SC-8330, RRID:AB_2124846 | IF(1:200), WB(1:1000) |
| Antibody | LAMP-1 (Mouse monoclonal) | Santa Cruz | Cat# SC-20011, RRID:AB_626853 | IF(1:200) |
| Antibody | ISG15 (Mouse monoclonal) | Santa Cruz | Cat# SC-166755, RRID:AB_2126308 | IF(1:200), WB(1:1000) |
| Antibody | phos-p65 (Rabbit polyclonal) | Cell Signaling | Cat# 3031, RRID:AB_330559 | WB(1:1000) |
| Antibody | p65 (Rabbit polyclonal) | Cell Signaling Technology, | Cat# 8242, RRID:AB_10859369 | WB(1:1000) |
| Antibody | LC3 (Rabbit polyclonal) | Cell Signaling Technology, | Cat# 3868, RRID:AB_2137707 | IF(1:200), WB(1:1000) |
| Antibody | Flag (Rabbit polyclonal) | Millipore-Sigma | Cat# F1804, RRID:AB_262044 | WB(1:1000) |
| Antibody | β-actin (Mouse monoclonal) | Millipore-Sigma | Cat# A2228, RRID:AB_476697 | WB(1:5000) |
| Antibody | anti-B220 (Rat monoclonal) | Thermo Fisher | Cat# 14-0452-82, RRID:AB_467254 | FACS (1 µL per test) |
| Antibody | anti-CD3e (Armenian hamster monoclonal) | Biolegend | Cat# 100301, RRID:AB_312666 | FACS (1 µL per test) |
| Antibody | anti-Gr1 (Rat monoclonal) | Thermo Fisher | Cat# 14-5931-82, RRID:AB_467730 | FACS (1 µL per test) |
| Antibody | anti-Ter119 (Rat monoclonal) | BD Bioscience | Cat#550565, RRID:AB_393756 | FACS (1 µL per test) |
| Antibody | anti-Sca1 PerCP Cy5.5 (Rat monoclonal) | Thermo Fisher | Cat# 122523, RRID:AB_893621 | FACS (1 µL per test) |
| Antibody | anti-c-Kit APC eFluor 780 (Mouse monoclonal) | Thermo Fisher | Cat# 47-1171-82, RRID:AB_1272177 | FACS (1 µL per test) |
| Antibody | anti-CD34 FITC (Mouse monoclonal) | Thermo Fisher | Cat# 343503, RRID:AB_343503 | FACS (1 µL per test) |
| Antibody | CD16/32 eFluor450 (Rat monoclonal) | Thermo Fisher | Cat# 48-0161-82, RRID:AB_1272191 | FACS (1 µL per test) |
| Antibody | colloidal gold conjugated secondary antibodies | Jackson ImmunoResearch Laboratories | Cat# 715-205-150, RRID:AB_2340822 | Electron microscopy (1:25) |
| Antibody | Alexa Fluor 568 (goat anti-mouse IgG) | Thermo Fisher | Cat# A11031, RRID:AB_144696 | IF (1:2000) |
| Antibody | Alexa Fluor 488 (goat-anti-rabbit IgG) | Thermo Fisher | Cat# A11034, RRID:AB_2576217 | IF (1:2000) |
| Commercial assay or kit | multiplex mouse cytokine kits | R and D Systems | Cat# AYR006 | Inflammation markers |
| Commercial assay or kit | multiplex mouse cytokine kits | Millipore-Sigma | Cat# MCYTMAG-70K-PX32 | Inflammation markers |
| Commercial assay or kit | RatLaps (CTX-1) EIA | Immunodiagnostic Systems | Cat# AC-06F1 | Serum cross‐linked telopeptide of type I collagen (CTX‐I)-bone resorption marker |
| Commercial assay or kit | Mouse TRAP (TRAcP 5b) kits | Immunodiagnostic Systems | Cat# SB TR-103 | osteoclast marker |
| Commercial assay or kit | PureLink RNA mini kit | Thermo Fisher | Cat# 12183025 | RNA isolation |
| Other | iTaq universal SYBR green super-mix | BioRad | Cat# 1725120 | Real-Time PCR reagent |
| Sequence-based reagent | TRAP_F | IDT | PCR primer | CGACCATTGTTAGCCACATACG |
| Sequence-based reagent | TRAP_R | IDT | PCR primer | CACATAGCCCACACCGTTCTC |
| Sequence-based reagent | CTSK_F | IDT | PCR primer | ATGTGGGTGTTCAAGTTTCTGC |
| Sequence-based reagent | CTSK_R | IDT | PCR primer | CCACAAGATTCTGGGGACTC |
| Sequence-based reagent | MMP9_F | IDT | PCR primer | ACTGGGCTTAGATCATTCCAGCGT |
| Sequence-based reagent | MMP9_R | IDT | PCR primer | ACACCCACATTTGACGTCCAGAGA |
| Sequence-based reagent | NFATC1_F | IDT | PCR primer | CCGGGACGCCCATGCAATCTGTTAGT |
| Sequence-based reagent | NFATC1_R | IDT | PCR primer | GCGGGTGCCCTGAGAAAGCTACTCTC |
| Software, algorithm | ImageJ | Imagej.nih.gov | IF image processing, count | |
| Software, algorithm | GraphPad | Graphpad prism-8 software | Statistical Analysis software | Graph preparation, statistical analysis |
