1. Genetics and Genomics

A non-mosaic transchromosomic mouse model of Down syndrome carrying the long arm of human chromosome 21

  1. Yasuhiro Kazuki  Is a corresponding author
  2. Feng J Gao
  3. Yicong Li
  4. Anna J Moyer
  5. Benjamin Devenney
  6. Kei Hiramatsu
  7. Sachiko Miyagawa-Tomita
  8. Satoshi Abe
  9. Kanako Kazuki
  10. Naoyo Kajitani
  11. Narumi Uno
  12. Shoko Takehara
  13. Masato Takiguchi
  14. Miho Yamakawa
  15. Atsushi Hasegawa
  16. Ritsuko Shimizu
  17. Satoko Matsukura
  18. Naohiro Noda
  19. Narumi Ogonuki
  20. Kimiko Inoue
  21. Shogo Matoba
  22. Atsuo Ogura
  23. Liliana D Florea
  24. Alena Savonenko
  25. Meifang Xiao
  26. Dan Wu
  27. Denise AS Batista
  28. Junhua Yang
  29. Zhaozhu Qiu
  30. Nandini Singh
  31. Joan T Richtsmeier
  32. Takashi Takeuchi
  33. Mitsuo Oshimura
  34. Roger H Reeves  Is a corresponding author
  1. Department of Biomedical Science, Institute of Regenerative Medicine and Biofunction, Graduate School of Medical Science, Tottori University, Japan
  2. Chromosome Engineering Research Center (CERC), Tottori University, Japan
  3. Department of Physiology, Johns Hopkins University School of Medicine, United States
  4. Department of Genetic Medicine, John Hopkins University School of Medicine, United States
  5. Department of Animal Nursing Science, Yamazaki University of Animal Health Technology, Hachioji, Japan
  6. Department of Physiological Chemistry and Metabolism, Graduate School of Medicine, The University of Tokyo, Japan
  7. Department of Molecular Hematology, Tohoku University Graduate School of Medicine, Japan
  8. Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Japan
  9. Bioresource Engineering Division, RIKEN BioResource Research Center (BRC), Japan
  10. Departments of Pathology and Neurology, John Hopkins University School of Medicine, United States
  11. Department of Neuroscience, John Hopkins University School of Medicine, United States
  12. Department of Biomedical Engineering, Zhejiang University, China
  13. Department of Pathology, John Hopkins University School of Medicine, United States
  14. Department of Anthropology, Penn State University, United States
  15. Division of Biosignaling, School of Life Sciences, Faculty of Medicine, Tottori University, Japan
  16. Department of Anthropology, California State University, United States
https://doi.org/10.7554/eLife.56223
Share this article
Cite this article
  1. Yasuhiro Kazuki
  2. Feng J Gao
  3. Yicong Li
  4. Anna J Moyer
  5. Benjamin Devenney
  6. Kei Hiramatsu
  7. Sachiko Miyagawa-Tomita
  8. Satoshi Abe
  9. Kanako Kazuki
  10. Naoyo Kajitani
  11. Narumi Uno
  12. Shoko Takehara
  13. Masato Takiguchi
  14. Miho Yamakawa
  15. Atsushi Hasegawa
  16. Ritsuko Shimizu
  17. Satoko Matsukura
  18. Naohiro Noda
  19. Narumi Ogonuki
  20. Kimiko Inoue
  21. Shogo Matoba
  22. Atsuo Ogura
  23. Liliana D Florea
  24. Alena Savonenko
  25. Meifang Xiao
  26. Dan Wu
  27. Denise AS Batista
  28. Junhua Yang
  29. Zhaozhu Qiu
  30. Nandini Singh
  31. Joan T Richtsmeier
  32. Takashi Takeuchi
  33. Mitsuo Oshimura
  34. Roger H Reeves
(2020)
A non-mosaic transchromosomic mouse model of Down syndrome carrying the long arm of human chromosome 21
eLife 9:e56223.
https://doi.org/10.7554/eLife.56223
  2. Download BibTeX
  3. Download .RIS
7 figures, 5 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
Construction of TcMAC21 mice (HSA21q-MAC).

(A) Schematic diagram of HSA21q-MAC construction. (B) Chimeric mice obtained via injection of mouse ES cells carrying the HSA21q-MAC. The arrow indicates a GFP-positive, TcMAC21 mouse. (C) FISH of TcMAC21 lymphocytes (n = 4 and 20 metaphases analyzed in each sample). Digoxigenin-labeled human COT-1 DNA as FISH probe for HSA21q-MAC detection. (D) G-banding based karyotype of TcMAC21 containing the HSA21q-MAC. (E) WGS showing the positions of 4 deletions in HSA21q (A, B, C, and D). These are shown normalized to PCG numbers, not physical DNA length. The regions of homology with mouse chromosomes 16, 17 and 10 are indicated. (F) Summary of genome positions of deletions and numbers of affected PCGs and non-PCGs on the HSA21q-MAC (based on GRCh38.p12, BioMart-Ensembl, May 2019), and see Figure 1—source data 1 for details.

Figure 1—source data 1

WGS of TcMAC21.

Construction of TcMAC21 mice (HSA21q-MAC).

https://cdn.elifesciences.org/articles/56223/elife-56223-fig1-data1-v3.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Construction of TcMAC21 mice (HSA21q-MAC).

(A) Information for vectors used to generate the hybrid chromosome, HSA21q-MAC. (B–D) FISH images to verify the critical steps: (B) before Cre-loxP mediated recombination, CHO cells containing a HSA21-loxP and a MAC; (C) after recombination, CHO cells containing the HSA21q-MAC (yellow arrow) and by-product (21p-cen) (white arrow); (D) mouse ES cell containing the HSA21q-MAC (yellow arrow). FISH probes: digoxigenin-labeled human COT-1 DNA for human chromosome detection (red, in B-D), biotin-labeled mouse COT-1 DNA for mouse chromosome detection (green, in B-C), biotin-labeled mouse minor satellite DNA for mouse centromere detection (green, in D), and chromosomal DNA counterstained with DAPI.

Figure 2
Download asset Open asset
HSA21 expression pattern in P1 TcMAC21 brain.

(A) RNA-Seq summary of HSA21 PCG and non-PCG transcript levels in TcMAC21. (B) Transcript levels of individual PCG and non-PCGs across the length of HSA21q in TcMAC21. (C) HSA21 dosage imbalance analysis of TcMAC21 among 117 HSA21 mouse orthologs whose FPKM ≥1 in Eu. Three expression values are shown: 1. the FPKM ratio of HSA21 PCG of TcMAC21 to its ortholog of Eu (gray open squares); 2. the FPKM ratio of HSA21 mouse ortholog of TcMAC21 to that of Eu (blue dot); 3. the FPKM ratio of total expression (HSA21 PCG + its mouse ortholog) of TcMAC21 to the HSA21 mouse ortholog of Eu (red circles). The positions of deleted regions are indicated in red. Eu and Ts65Dn littermates, n = 2 per group. See also Figure 2—source data 1 for expression levels (FPKM) of all HSA21 and its orthologs in Eu and TcMAC21. (D) RNA-Seq verification by Taqman RT-PCR. Correlation between CT value from Taqman RT-PCR and Log10(FPKM) from RNA-Seq for 10 HSA21q genes and mouse actin (mACTB) in TcMAC21. (E) Taqman assay comparing expression of 10 HSA21 genes between forebrain, hindbrain, and heart using the same amount of total RNA. The sample size of Taqman assay in D and E is that n = 2 for TcMAC21 and n = 3 for Eu (negative control).

Figure 2—source data 1

RNA-seq of TcMAC21 and Eu.

HSA21 expression pattern in P1 TcMAC21 brain.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig2-data1-v3.xlsx
Figure 2—source data 2

Effects of HSA21 on gene expression of other mouse chromosomes analyzed by RNA-seq.

HSA21 expression pattern in P1 TcMAC21 brain, source data.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig2-data2-v3.docx
Figure 3 with 1 supplement
Download asset Open asset
Mosaicism analysis in TcMAC21.

(A) UV light to illuminate GFP of nine organs from TcMAC21 (exposure time is 4 s and 0.2 s in spleen and the other tissues, respectively) (n = 2). BF, bright field. Scale bar (6 mm). (B) RT-PCR analyses for HSA21 gene expression in different TcMAC21 tissues (n = 2). (C) Representative FISH image of cells from TcMAC21 tissues with digoxigenin-labeled human COT-1 DNA as FISH probe for HSA21q-MAC (red) and with DAPI as a nuclear counterstain (blue). FISH of Eu tissues with human COT-1 showing no signal (Figure 3—figure supplement 1C). (D) Retention rate of the HSA21q-MAC in various TcMAC21 tissues analyzed by FISH (n = 2, 200 interphase cells analyzed in each sample). (E) Retention rate of the HSA21q-MAC in three lymphocyte populations analyzed by FCM (n = 2). See Figure 3—source data 2 for statistical tables used to generate D and E.(F) Mosaicism analysis of HSA21q-MAC in Purkinje cells (PC) of TcMAC21 by immunostaining. White arrows indicate cell bodies of randomly selected PC in RFP-channel, and red arrows indicate corresponding locations in GFP-channel. N = 3 per group, one 30 um brain slice per animal, and 100 randomly selected PCs per slice.

Figure 3—source data 1

HSA21 genes tested by human specific Taqman assay.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig3-data1-v3.docx
Figure 3—source data 2

Data tables for Figure 3D-E.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig3-data2-v3.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Mosaicism analysis.

(A) Tails from GFP negative and positive TcMAC21 littermates are analyzed using Taqman RT-PCR assay for testing expression of human-APP (hAPP, centromere-proximal), human-PRMT2 (hPRMT2, telomere-proximal), and mouse actin (mActin, endogenous control). N = 12 per group. (B) TcMAC21 and Eu pups are visualized with GFP flashlights. (C) FISH of kidney cells of Eu and TcMAC21 with human COT-1 (red), and chromosomal DNA counterstained with DAPI.

Figure 4 with 1 supplement
Download asset Open asset
Morphological analysis of the heart, brain and skull in TcMAC21.

(A–C) CHD analysis. (A) Wet dissection of hearts from E18.5 Eu (top, normal) and TcMAC21(bottom, DORV and VSD (black arrow)), and a small slit-like conus VSD also seen in TcMAC21. Eu (n = 19), TcMAC21 (n = 21). (B) Histology of E14.5 Eu (normal) and two TcMAC21 mice with different heart defects, VSD and AVSD (black arrow indicating locations of defects); AO, aorta; AoV, aortic valve; LA, left atrium; LV, left ventricle; PT, pulmonary trunk; PulV, pulmonary valve; RA, right atrium; RV, right ventricle. Eu (n = 20), TcMAC21 (n = 21). (C) Summary data of CHD analysis. (D) Representative T2-weighted MR images (top, ex vivo) and statistical analysis of whole brain volume, percentage of cerebellum and hippocampus relative to brain; mid-sagittal slices from Eu (S1) and TcMAC21 (S2) and coronal slices from Eu (C1) and TcMAC21 (C2), scale bar (5 mm); n = 7 per group and data are analyzed by two-way ANOVA and expressed as mean ± SEM. (E–F) Results of a principal components analysis (PCA) of 3D geometric morphometric analysis of Eu and TcMAC21 cranial shape. PC1 shows a 24.2% separation between Eu and TcMAC21 mice while PC2 captures variation in each genotype. Eu (n = 10), TcMAC21 (n = 9).

Figure 4—source data 1

Absolute volume of brain structures in TcMAC21 and Eu.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig4-data1-v3.docx
Figure 4—source data 2

Percentage of brain volume in TcMAC21 and Eu.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig4-data2-v3.docx
Figure 4—figure supplement 1
Download asset Open asset
Lateral ventricle in ex vivo and in vivo MRI.

(A) 3D rendering of Eu and TcMAC21 brains MRI images. No clear ventricle space is seen in PFA-fixed samples (ex vivo MRI) and clear ventricles and CSF are seen in live samples (in vivo MRI). LV: lateral ventricle, 3/4 V: the third and fourth ventricle; scale bar (5 mm) (B) Quantitative analysis of LV volume of live Eu and TcMAC21 mice. LV are visualized in four matching transverse levels of MRI images from the dorsal to the ventral (adjacent levels spaced 312.5 um apart, scale bar (5 mm)). Absolute and percentage of brain volumes of LV are compared (N = 3 pairs and data are analyzed by two-tailed t-test and expressed as mean ± SEM).

Figure 5 with 1 supplement
Download asset Open asset
Evaluation of DS-like pathology in TcMAC21.

(A–C) APP protein levels and amyloid plaques in brains of 15–24 month-old TcMAC21 and Eu (n = 6 per group). (A) western blot of total APP in hippocampus and cortex. (B) ELISA of total Aβ40 and Aβ42 levels in hippocampus and cortex. (C) amyloid plaques visualized by immunostaining with β-amyloid antibody 6E10; APPswe/PS1∆E9 mouse is a positive control for plaque formation, scale bar (1 mm). (D) CFU level of GM and GEMM in TcMAC21 spleen and bone marrow (n = 6 per group). GM, granulocyte/macrophage; GEMM, granulocyte/erythroid/monocyte/megakaryocyte. (E–G) Chromatid and chromosome aberrations in bone marrow cells after X-ray irradiation (n = 3 per group). (E) Chromatid aberration. (F) Chromosome aberration. (G) Chromatid and/or chromosome exchange. chtg (chromatid gap); chtb (chromatid break); chrg (chromosome gap); chrb (chromosome break); ace (acentric fragment); chte (chromatid exchange); chre (chromosome exchange); mar (marker chromosome, including dicentric chromosome, ring chromosome, robertsonian translocation, and other abnormal size of chromosome). All data are analyzed by two-tailed t-test and expressed as mean ± SEM.

Figure 5—source data 1

Peripheral blood analyses in TcMAC21 and Eu.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig5-data1-v3.docx
Figure 5—figure supplement 1
Download asset Open asset
Hematological phenotypes.

(A) Histological analysis of spleen (R and W indicate red pulp and white pulp, respectively). (B–D) Colony assay of spleen and bone marrow. (B) representative colony images of bone marrow; statistical analysis of colony-formation unites (CFU) of erythroid (E), granulocyte/erythroid/monocyte/megakaryocyte (GEMM), granulocyte/macrophage (GM), macrophage (M) and megakaryocyte (Meg) in bone marrow (C) and spleen (D), n = 6 per group unless otherwise stated in figures, and data are analyzed by two-tailed t-test and expressed as mean ± SD.

Figure 6 with 1 supplement
Download asset Open asset
Growth profile, nesting and open field in TcMAC21.

(A) The mass of TcMAC21 and Eu at P1, P6, P14, P20, P27, P35 and P90 (n ≥ 9 per group; two-way ANOVA and Tukey’s post-hoc). (B) Nesting (female: Eu (n = 19), TcMAC21 (n = 13); male: Eu (n = 7), TcMAC21 (n = 7); one-way ANOVA and Tukey’s post-hoc). (C–D) 30 min open field (female: Eu (n = 12), TcMAC21 (n = 11); male: Eu (n = 11), TcMAC21 (n = 12)). (C) Total travel distance (one-way ANOVA and Tukey’s post-hoc). (D) Dynamics of % of time spent in the central zone, and dash lines shows that the center zone covers 34% of the whole open field (repeated measures ANOVA with LSD-post-hoc). All data are expressed as mean ± SEM and see Figure 6—source data 2 for detailed statistical analysis.

Figure 6—source data 1

Husbandry information for TcMAC21.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig6-data1-v3.docx
Figure 6—source data 2

Statistics for Figure 6.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig6-data2-v3.xlsx
Figure 6—figure supplement 1
Download asset Open asset
The experimental design for behavioral tests and electrophysiology to assess learning and memory in both Eu and TcMAC21.
Figure 7 with 3 supplements
Download asset Open asset
Learning and memory deficits in TcMAC21.

(A) MWM: acquisition trials (left, escape latency and escape distance), short delay probe (middle) and long delay probe (right). Red dash lines indicate 17% chance level (female: Eu (n=10), TcMAC21 (n=11); male: Eu (n=11), TcMAC21 (n=12)). (B–D) RRWM (female: Eu (n=8), TcMAC21 (n=9)). (B) Representative tracking plots of long delay probe trials of day 1 to day 3 of RRWM to visualize the progress of forgetting old platform SE position and learning new platform NW position. (C) Quantitative analysis of forgetting old platform SE position. Before RRWM training, each mouse’s “% of retained memory of SE of trial 1 of R day 1” is normalized as 100%. After RRWM day 1 training, “% of retained memory of SE of trial 1 of R day 2” of the mouse = “% of time in SE area in trial 1 of R day 2” / “% of time in SE area in trial 1 of R day 1” × 100%. After RRWM day 2 training, “% of retained memory of SE of trial 1 of R day 3” of the mouse = “% of time in SE area in trial 1 of R day 3” / “% of time in SE area in trial 1 of R day 1” × 100%. (D) Long delay probe trials from day 1 to day 3 of RRWM for comparing abilities of learning and memorizing new target platform NW position. (E–F) TBS-induced LTP at SC-CA1 synapses (male: Eu (n=5, 13 total slices), TcMAC21 (n=5, 14 total slices)). (E) Normalized fEPSP slopes are plotted every 1 min. Sample traces represent fEPSPs taken before TBS stimulation “1” and 60 min after TBS stimulation “2”. Arrow indicates LTP induction, and scale bars represent 0.5 mV (vertical), 5 ms (horizontal). (F) The amplitude of fEPSP slopes are averaged at 60 min after the stimulation. Repeated measures ANOVA with LSD-post hoc test in (A–D) and two-tailed t-test in (E–F), and data are expressed as mean ± SEM and see Figure 7—source data 1 for detailed statistical analysis.

Figure 7—source data 1

Statistics of Figure 7.

https://cdn.elifesciences.org/articles/56223/elife-56223-fig7-data1-v3.xlsx
Figure 7—figure supplement 1
Download asset Open asset
Visual discrimination.

(A) Water tank specifications. The inner circle, the target area, is defined as a circle inscribed in the platform quadrant, covering ~17% of water maze tank. (B) Design of visual discrimination: platform changes every two trials from W, to E, and to S. (C–D) Visual discrimination performance of TcMAC21 and Eu measured by escape latency (p=0.27, (C) and escape distance (p=0.19, (D). Female: Eu (n = 13), MAC21 (n = 11); male: Eu (n = 11), MAC21 (n = 12). Data are analyzed by repeated measures ANOVA with LSD post-hoc and expressed as mean ± SEM. See Figure 7—source data 1A for detailed statistical analysis.

Figure 7—figure supplement 2
Download asset Open asset
MWM.

(A) Scheme for classic MWM: four full days of training, each day has 10 trials including eight acquisition trials (trial 1–4 and trial 6–9 in day 1, trial 2–9 in day 2–4), short delay probe trials (~30 min delay, trial 10 in day 1–4), and long delay probe trials (24 hr long delay, trial 1 in day 2–4; 72 hr long delay, trial 1 in day 7). Trial 5 of day one is a probe trial drill and no data from trial 5 of Day one is used for analysis: the platform is lowered to a position that mice are not able to climb onto, and mice are allowed to swim for 10 s, and then a tester raises the platform and guide mice to the platform. (B) Swimming speed in MWM acquisition trials. (C–E) Analysis of MWM acquisition, short delay probe and long delay probe, and Data are analyzed by repeated measures ANOVA with LSD post-hoc and expressed as mean ± SEM of consolidated female and male. Female: Eu (n = 10), MAC21 (n = 11); male: Eu (n = 11), MAC21 (n = 12). See Figure 7—source data 1B for detailed statistical analysis.

Figure 7—figure supplement 3
Download asset Open asset
RRWM.

(A) RRWM scheme: four full days of training, the targeting platform is in NW (relocated from SE of MWM) during reversal session 1 (R day one and R day 2) and then relocated to SW during reversal session 2 (R day three and R day 4). Each day has 10 trials, including eight acquisition trials (trial 2–9) and two probe trials (trial 10 of R day 1–4 is 30 min short delay, Trial 1 of R day one also known as the 72 hr delay probe trial of MWM, Trial 1 of R day 2–4 is 24 hr long delay). (B) Acquisition and short delay probe trials in reversal 1. (C) Acquisition, short delay probe and long delay probe trials in reversal 2. Data are analyzed by repeated measures ANOVA with LSD post-hoc and expressed as mean ± SEM. Female: Eu (n = 8), TcMAC21 (n = 9), and see Figure 7—source data 1C for detailed statistical analysis.

Tables

Table 1
PCG content of HSA21p vs. HSA21q.
HSA21pgene startHSA21q Paraloggene start
FP565260.45011799DNMT3L44246339
FP565260.35022493ICOSLG44217014
GATD3B5079294GATD3A44133610
FP565260.25116343GATD3A44133610
FP565260.15130871PWP244107373
FP565260.65155499TRAPPC1044012309
CU639417.15972924H2BFS43565189
SIK1B6111134SIK143414483
CBSL6444869CBS43053191
U2AF1L56484623U2AF143092956
CRYAA26560714CRYAA43169008
SMIM11B7744962SMIM11A34375480
FAM243B7768884FAM243A34400317
SMIM34B7784482SMIM34A34418715
KCNE1B7816675KCNE134446688
BAGE210413477
TPTE10521553
Table 1—source data 1

The analysis of HSA21 genes.

PCG content of HSA21p vs. HSA21q.

https://cdn.elifesciences.org/articles/56223/elife-56223-table1-data1-v3.xlsx
Table 2
Comparison of TcMAC21 and other mouse models of DS.
IssuesTcMAC21Tc1Ts65DnTs1CjeDp(16)1Yey/+ or Dp1TybDp(10)1Yey/+; Dp(16)1Yey/+; Dp(17)1Yey/+
MosaicismNoYesNoNoNoNo
Freely segregating chromosomeYesYesYesNoNoNo
Trisomic HSA21q PCG/orthologs
(% of 213 HSA21q)		199
(93.4%)		158
(74.2%)		110
(51.6%)		68
(31.9%)		122
(57.3%)		180 (40;122;18)
(84.5%)
Trisomic HSA21q PCG/orthologs, excluding KRTAPs1501099268104160
* Trisomic mouse PCGs with no human ortholog00771012
† Trisomic or monosomic PCGs that are not HSA21 orthologs00Trisomic
~44 MMU17		Monosomic ~ 7
MMU12		00

  1. *Refer to data file S1A for the name and location of each mouse PCG conserved with Hsa21 (MMU10, 16, 17). Gene annotation is based on ‘GRCh38, P12’ and ‘GRCm.P6’.

    †The reference of the translocation breakpoints of Ts65Dn and Ts1Cje is “Duchon A, Raveau M, Chevalier C, Nalesso V, Sharp AJ, Herault Y. Identification of the translocation breakpoints in the Ts65Dn and Ts1Cje mouse lines: relevance for modeling Down syndrome. Mamm Genome. 2011;22(11, 12):674–684.’ The number of genes is based on ‘GRCm.P6’.

Key resources table
Reagent type
(species) or resource		DesignationSource or referenceIdentifiersAdditional
information
Strain, strain background (Mus musculus)TcMAC21This paperSee details in Table 3
AntibodyAnti-APP (mouse monoclonal)MilliporeMAB348,
RRID:AB_94882		(1:500)
AntibodyAnti-β-Amyloid (6E10, mouse monoclonal)CovanceSIG-39320,
RRID:AB_662798		(1:500)
AntibodyAnti-Calbindin (rabbit monoclonal)Cell signaling13176,
RRID:AB_2687400		(1:250)
Commercial assay or kitHuman/rat β amyloid (Aβ40)Wako294–64701
Commercial assay or kitHuman/rat β amyloid (Aβ42)Wako290–62601
Commercial assay or kitTaqMam Gene Expression Master MixApplied Biosystems4369016
Commercial assay or kitRNeasy Mini KitQiagen74104
Commercial assay or kitNEBNext Poly (A) mRNA Magnetic Isolation ModuleNEBE7490
Commercial assay or kitNEBNext Ultra II RNA Library Prep KitNEBE7770
Commercial assay or kitLipofectamine 2000 Transfection ReagentThermoFisher11668027
Chemical compound, drugHuman COT-1 DNAThermoFisher15279–011
Chemical compound, drugMouse COT-1 DNAThermoFisher18440–016
Chemical compound, drugMouse minor satellite DNAGift of Dr. Vladimir Larionov (NIH)
Software, algorithmMorphoJKlingenberg lab
Software, algorithmRR-project
Software, algorithmAny-mazeStoeltingco
Software, algorithmGraphPad PrismGraphPad
Software, algorithmSTATISTICATIBCO
Table 3
Experimental animal information.
ExperimentGenetic backgroundAgeEuTcMAC21
Figure 1WGSB6;DBA1-month-oldNot testedMale: N = 1
Figure 2RNA-seqB6;DBAP1Male: N = 2Male: N = 2
Figure 3GFP expressionB6;DBA1–10 month-oldMale: N = 2Male: N = 2
Figure 3Mosaicism analysis by FISHB6;DBA1–10 month-oldMale: N = 1Male: N = 2
Figure 3Mosaicism analysis by FCMICR;B6;CBA10-month-oldMale: N = 1Male: N = 2
Figure 3Mosaicism analysis by immunostainingB6;DBA4.5-month-oldMale: N = 3Male: N = 3
Figure 4CHD by wet dissectionB6;DBAE18.5N = 19, gender unknownN = 21, gender unknown
Figure 4CHD by histologyB6;DBAE14.5N = 20, gender unknownN = 20, gender unknown
Figure 4Brain MRIB6;DBA4.5-month-oldMale: N = 7Male: N = 7
Figure 4Craniofacial morphology by micro-CTB6;DBA4.5-month-oldMale: N = 10Male: N = 9
Figure 5Western, ELISA, and amyloid plaque stainingB6;DBA15–24 month-oldMale: N = 6Male: N = 6
Figure 5Peripheral blood analysesB6;DBA10–12 month-oldMale: N = 6Male: N = 5
Figure 5Colony-forming cell assaysICR;B6;DBA10-month-oldMale: N = 6Male: N = 6
Figure 5Radiosensitivity testICR;B6;DBA16–18 week-oldMale: N = 3Male: N = 3
Figure 6NestingB6;DBA3–4 month-oldFemale: N = 16; Male: N = 7Female: N = 13; Male: N = 7
Figure 6Open fieldB6;DBA3-month-oldFemale: N = 12; Male: N = 11Female: N = 11; Male: N = 12
Figure 7Classic MWMB6;DBA3-month-oldFemale: N = 10; Male: N = 11Female: N = 11; Male: N = 12
Figure 7RRWMB6;DBA3-month-oldFemale: N = 8Female: N = 9
Figure 7TBS-LTPB6;DBA3.5-month-oldMale: N = 5Male: N = 5
Table 4
Primer sequences for genomic PCR or RT-PCR analyses.
Gene or aimPrimer name (forward)Forward primer(5'−3')Primer name (reverse)Reverse primer(5'−3')Product size
Genomic PCRMAC1m11 5LTGACAGAGAGCTTCCTCCTGCCTCTGTAEGFP-FCCTGAAGTTCATCTGCACCA5.0 kb
 Chr.21-loxP#21CEN < 1 > 2LAAATGCATCACCATTCTCCCAGTTACCCPGKr1GGAGATGAGGAAGAGGAGAACA4.5 kb
 Cre-loxP recombinationTRANSL1TGGAGGCCATAAACAAGAAGACTRANSR1CCCCTTGACCCAGAAATTCCA409 bp
 Cre-loxP recombinationkj neoCATCGCCTTCTATCGCCTTCTTGACGPGKr1GGAGATGAGGAAGAGGAGAACA~600 bp
 D21S265SHGC-40FGGGTAAGAAGGTGCTTAATGCTCSHGC-40RTGAATATGGGTTCTGGATGTAGTG178 bp
 APPSHGC-31514FCTGGGCAATAGAGCAAGACCSHGC-31514RACCCATATTATCTATGGACAATTGA115 bp
 D21S260D21S260FAGCTGTTCATGCTTCCATCTD21S260RAGAGCCCAGAATATTGACCC270 bp
 SOD1SHGC-6902FATTCTGTGATCTCACTCTCAGGSHGC-6902RTCGCGACTAACAATCAAAGT133 bp
 D21S261SHGC-3610FAACACCTTACCTAAAACAGCASHGC-3610RTGGACCTTTTGATTTTTCCT130 bp
 AML1SHGC-30487FGTAACCTGGTTAACATAGGGTTTCSHGC-30487RGTAGGGGAGGCTAATGGCAT150 bp
 CBR1J04056FGATCCTCCTGAATGCCTGJ04056RGTAAATGCCCTTTGGACC245 bp
 SIM2WI-22186FGGGCCTCATGGTAAGAGTCAWI-22186RGAAAAATGTCGGTGGTATCTCC250 bp
 HLCSWI-15188FTTCAGTACCTCCCCAGATGCWI-15188RCTTAGTAGTGCAGACCTTTACCCC125 bp
 TTC3WI-19945FTGGACAAATATAAGGCATGTTCAWI-19945RGTCACCTTCCTCTGCCTTTG267 bp
 D21S394D21S394FGGAGCCGGTTCTTCGAAGGD21S394RCAGCGTCCGGAATTCCTGC71 bp
 D21S336D21S336FTCTGGTTCCCAGGATTGTAAD21S336RAGAGTTGCTGTAAGCATCAAAGT350 bp
 D21S55D21S55FAGGCTCCTTCACCTCTTGACD21S55RCATCCTCTTTGCATTAGG159 bp
 GIRK2GIRK2FGTTTGTCTTCAGCTCACCGIRK2RCCCAAAATACTACACATCC266 bp
 ERGM21535FAATGGCGTCAGCCTCTCCM21535RCAGTTTGCCTTACGAGTGGTAGC254 bp
 ETS2SHGC-11267FTACCATGCCAATGGTTTATAAGGSHGC-11267RATGTGACTGGGAACATCTTGC177 bp
 D21S268D21S268FCAACAGAGTGAGACAGGCTCD21S268RTTCCAGGAACCACTACACTG213 bp
 PCP4WI-14954FGAATTCACTCATCGTAACTTCATTTWI-14954RCCTTGTAGGAAGGTATAGACAATGG126 bp
 D21S266D21S266FCACAATGTAGATGTAGCACAGTTAGD21S266RTGAGTCTGAAGAAAGGCAAATGAAG166 bp
 D21S15D21S15FGAGGATAAACCGATTCACAGCTAGGAATACD21S15RGTGCACGTAATTAATGACCATGATATTGCT218 bp
 MX1WI-18875FTGGACTGACGACTTGAGTGCWI-18875RCTCATGTGCATCTGAGGGTG143 bp
 TFF1SGC35308FCAGGGATCTGCCTGCATCSGC35308RATCGATCTCTTTTAATTTTTAGGCC183 bp
 PWP2SHGC-33273FGATCTTGACCGGGAAAAGGGSHGC-33273RAACAAGTGGCAAAATGCATAC150 bp
 APECEDA009B16FAAAATCCTCCCTTTAAGAGCA009B16RGGGTGTTAGGTACTGGCT118 bp
 PFKLsts-X15573FAGGGCTTCTGAGGCCAGCsts-X15573RAGGGCACTCTGTCCTCCTGC239 bp
 UBE2G2WI-11417FTTCAACAGTCATTAGGTTCCACCWI-11417RGTGAGATCGGGAGAGGGAG129 bp
RT-PCRAPPWI-18826FACGTTTGTTTCTTCGTGCCTWI-18826RGCCCCGTAAAAGTGCTTACA136 bp
 SOD1SHGC-6902FATTCTGTGATCTCACTCTCAGGSHGC-6902RTCGCGACTAACAATCAAAGT133 bp
 IFNAR2U29584FCGAAGTTTCAGTCGGTGAGU29584RGGCATTCAGGTTTTATCCC181 bp
 TTC3WI-19945FTGGACAAATATAAGGCATGTTCAWI-19945RGTCACCTTCCTCTGCCTTTG267 bp
 PCP4WI-14954FGAATTCACTCATCGTAACTTCATTTWI-14954RCCTTGTAGGAAGGTATAGACAATGG126 bp
 MX1WI-18875FTGGACTGACGACTTGAGTGCWI-18875RCTCATGTGCATCTGAGGGTG143 bp
 TFF3WI-7267FGGCTGTGATTGCTGCCAGWI-7267RGTGGAGCATGGGACCTTTAT124 bp
 TFF1SGC35308FCAGGGATCTGCCTGCATCSGC35308RATCGATCTCTTTTAATTTTTAGGCC183 bp
 GADPHRPC1CCATCTTCCAGGAGCGAGARPC2TGTCATACCAGGAAATGAGC722 bp

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/56223/elife-56223-transrepform-v3.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Yasuhiro Kazuki
  2. Feng J Gao
  3. Yicong Li
  4. Anna J Moyer
  5. Benjamin Devenney
  6. Kei Hiramatsu
  7. Sachiko Miyagawa-Tomita
  8. Satoshi Abe
  9. Kanako Kazuki
  10. Naoyo Kajitani
  11. Narumi Uno
  12. Shoko Takehara
  13. Masato Takiguchi
  14. Miho Yamakawa
  15. Atsushi Hasegawa
  16. Ritsuko Shimizu
  17. Satoko Matsukura
  18. Naohiro Noda
  19. Narumi Ogonuki
  20. Kimiko Inoue
  21. Shogo Matoba
  22. Atsuo Ogura
  23. Liliana D Florea
  24. Alena Savonenko
  25. Meifang Xiao
  26. Dan Wu
  27. Denise AS Batista
  28. Junhua Yang
  29. Zhaozhu Qiu
  30. Nandini Singh
  31. Joan T Richtsmeier
  32. Takashi Takeuchi
  33. Mitsuo Oshimura
  34. Roger H Reeves
(2020)
A non-mosaic transchromosomic mouse model of Down syndrome carrying the long arm of human chromosome 21
eLife 9:e56223.
https://doi.org/10.7554/eLife.56223