Systemic hypoxia inhibits T cell response by limiting mitobiogenesis via matrix substrate-level phosphorylation arrest
- The Lautenberg center for Immunology and Cancer Research, The Institute for Medical Research Israel-Canada, The Hebrew University Medical School, Israel
- The Ruth and Bruce Rappaport, Faculty of Medicine, Technion - Israel Institute of Technology, Israel
- Faculty of Medicine, Hebrew University of Jerusalem; The Allergy and Immunology Unit, Shaare Zedek Medical Center, Israel
Figures
Figure 1 with 1 supplement
Systemic chronic oxygen restriction inhibits CD8+ T cell activation and response.
(A) Schematic of the experiment presented in panels B-H. C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 transduction units (TU) of Lv-OVA or left untreated. Twenty-four hours …
Figure 1—figure supplement 1
Systemic chronic oxygen restriction inhibits CD8+ T cell activation and response.
(A–C) C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left untreated. Twenty-four hours following the viral challenge, mice were transferred to chambers and …
Figure 2 with 2 supplements
Following mitochondrial remodeling, activated CD8+ T cell become tolerant to inhibition of OXPHOS.
(A) Schematic of experiment presented in panels B-E. CellTrace-labeled splenocytes were activated with anti-CD3/28 and transferred to chambers containing 1% O2 for 5 (middle/red), or 18 hr …
Figure 2—figure supplement 1
Oligomycin inhibits CD8+ T cell respiration, activation, and proliferation.
(A) Oxygen Consumption Rate (OCR) of isolated naïve CD8+ T cells treated with the indicated oligomycin, FCCP concentrations or left untreated. (n = 5 biological replicates). (B) Bar graph …
Figure 2—figure supplement 2
Acquisition of respiratory restriction tolerance is not correlated with increased glycolytic activity.
(A) Extra Cellular Acidification Rate (ECAR), measured by seahorse, of Naïve CD8+ T cells (gray), T-Early (red) and T-Late (pink) under basal conditions (BASAL) or oligomycin treatment (Max). Dashed …
Figure 3 with 1 supplement
Respiratory restriction has only marginal effect on cytoplasmic function during early activation.
(A) Heatmap showing relative amounts of key energy-related metabolites (as indicated in the figure) extracted from CD8+ T cells activated for 5 hr using anti-CD3/28 (T-Early) oligomycin treated or …
Figure 3—figure supplement 1
Inhibition of ANT2 leads to increased mitochondrial membrane polarization in CD8+ T cells.
(A) Label-free quantification (LFQ) of ANT1 relatively to the LFQ of ANT2 in naïve CD8+ T cells measured by MS analysis.(n = 5 mice grouped into six replicates, P value ****<0.0001). (B) Flow …
Figure 4 with 1 supplement
Respiratory restriction leads to energetic crisis within the matrix compartment in early activated CD8+ T cell.
(A-D) Splenocytes from mito-Dendra2 mice were activated with anti-CD3/28 for 5 hr and then transferred to a chamber containing 1% O2 or left in atmospheric oxygen pressure (21% O2). Twenty-four …
Figure 4—figure supplement 1
Respiratory restriction induces an energetic crisis within the matrix compartment in early activated CD8+ T Cell.
A) Splenocytes were stimulated using anti CD3/CD28 for 9, 12 and 24 hr. Cells were then treated with oligomycin for one hour or left untreated. Isolated CD8+ T cells were then analyzed using qRT-PCR …
Figure 5 with 1 supplement
FCCP treatment rescues respiratory-restricted CD8+ T cells by stimulating matrix-localized substrate-level phosphorylation, elevating ATP, and reducing AMP/GMP concentrations.
(A-D) CellTrace-labeled splenocytes were stimulated using anti-CD3/28. Nine hours post activation cells were left untreated or treated with 1 μM FCCP, 60 nM oligomycin or with a combination of FCCP …
Figure 5—figure supplement 1
Schematic of the suggested model; respiratory restriction through inhibition of complex V by oligomycin leads to increase in mitochondrial membrane potential and decreased electron flow.
(Top) Decreased electron flow leads to inhibition of TCA cycle and substrate-level phosphorylation since that these processes are coupled. (Bottom) Schematic of the suggested model for rescuing …
Figure 6 with 1 supplement
Short oxygen exposure rescues CD8+ T cells activated under hypoxia in vivo.
(A) Schematic describing the experiment in B-E. CellTrace-labeled mouse splenocytes were activated with anti-CD3/28 under 1% or atmospheric oxygen pressure (21% O2). Twenty-four hours post …
Figure 6—figure supplement 1
Short oxygen exposure rescues CD8+ T cells activated under hypoxia in vivo.
C57BL6 mice were primed intradermally in the ear pinna with 5 × 106 TU of Lv-OVA or left uninfected. Twenty-four hours after the viral challenge, mice were divided into four groups: (1) Lv-OVA …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-mouse-CD8α (Rat Monoclonal) clone 53–6.7 | Biolegend | Cat# 10071 Cat# 10072 Cat# 10072 | FACS 1:500 |
| Antibody | Anti-mouse-CD44 (Rat Monoclonal) clone IM7 | Biolegend | Cat# 10452 | FACS 1:1000 |
| Antibody | Anti-mouse-CD69 (Armenian Hamster Monoclonal) clone H1.2F3 | Biolegend | Cat# 10451 | FACS 1:500 |
| Antibody | Anti-mouse-CD25 (Rat Monoclonal) clone 3C7 | Biolegend | Cat# 10190 | FACS 1:500 |
| Antibody | Anti-mouse-CD62L (Rat Monoclonal) clone MEL-14 | Biolegend | Cat# 10441 | FACS 1:500 |
| Antibody | Anti-mouse TCR Vα2 (Rat Monoclonal) clone B20.1 | Biolegend | Cat# 12780 | FACS 1:1000 |
| Antibody | Anti-mouse-Ki67 (Rat Monoclonal) clone 16A8 | Biolegend | Cat# 652423 | FACS 1:100 |
| Antibody | Purified anti mouse-C3ϵ (Armenian Hamster monoclonal) clone 145–2 C11 | Biolegend | Cat# 100340 | Activation 0.1 μg/ml |
| Antibody | Purified anti mouse-CD28 (Syrian Hamster monoclonal) clone 37.51 | Biolegend | Cat# 102116 | Activation 0.1 μg/ml |
| Antibody | Purified anti-human-CD3ϵ (Mouse monoclonal) clone OKT3 | Biolegend | Cat# 317326 | Activation 0.1 μg /ml |
| Antibody | Purified anti-human-CD28 (Mouse monoclonal) clone CD28.2 | Biolegend | Cat# 302934 | Activation 0.1 μg/ml |
| Antibody | Anti-human-CD8α (Mouse monoclonal) clone HIT8a | Biolegend | Cat# 30090 | FACS 1:400 |
| Antibody | Anti-human-CD25 (Mouse monoclonal) clone M-A251 | Biolegend | Cat# 35610 | FACS 1:500 |
| Antibody | Anti-mouse AMPKα (Rabbit monoclonal) | Cell Signalling | Cat# 2532 | WB 1:1000 |
| Antibody | Anti-mouse phospho-AMPKα (Rabbit monoclonal) | Cell Signalling | Cat#: 2531 | WB 1:1000 |
| Antibody | Donkey Anti-Rabbit IgG H and L (HRP) (Donkey polyclonal) | abcam | Cat# ab97085 | WB 1:10000 |
| Antibody | Anti-Ubiquitin (Mouse monoclonal) clone FK2 | Merck-Millipore | Cat# ST1200 | IP 2 μg |
| Chemical compound, drug | Oligomycin A | Cayman Chemicals | Cat# 11342 | 1 nM - 1 μM |
| Chemical compound, drug | Rotenone | Cayman Chemicals | Cat# 13995 | 1 μM |
| Chemical compound, drug | Antimycin A | Cayman Chemicals | Cat# 19433 | 1 μM |
| Chemical compound, drug | FCCP | Cayman Chemicals | Cat# 15218 | 1 μM |
| Chemical compound, drug | Bongkrekic Acid (ammonium salt) | Cayman Chemicals | Cat# 19079 | 1 μM - 2 μM |
| Chemical compound, drug | EZview Red Protein G Affinity Gel | Sigma-Aldrich | Cat# E3403 | |
| Chemical compound, drug | Protease Inhibitor Cocktail | Sigma-Aldrich Israel | P8340 | WB and IP 1:100 |
| Sequence-based reagent | Ubc F | This paper | PCR primers | GCCCAGTGTTACCACCAAGA |
| Sequence-based reagent | Ubc R | This paper | PCR primers | CCCATCACACCCAAGAACA |
| Sequence-based reagent | Rpl13 F | This paper | PCR primers | ATGACAAGAAAAAGCGGATG |
| Sequence-based reagent | Rpl13 R | This paper | PCR primers | CTTTCCTGCCTGTTTCCGTA |
| Sequence-based reagent | mt-Rnr F | This paper | PCR primers | CATACTGGAAAGTGTGCTTGGA |
| Sequence-based reagent | mt-Rnr R | This paper | PCR primers | GTGTAGGGCTAGGGCTAGGA |
| Sequence-based reagent | mt-Rnr1 F | This paper | PCR primers | ACCGCGGTCATACGATTAAC |
| Sequence-based reagent | mt-Rnr1 R | This paper | PCR primers | CCCAGTTTGG GTCTTAGCTG |
| Sequence-based reagent | mt-Rnr2 F | This paper | PCR primers | GGGATAACAGCGCAATCCTA |
| Sequence-based reagent | mt-Rnr2 R | This paper | PCR primers | GATTGCTCCGGTCTGAACTC |
| Commercial assay, kit | MitoProbe TMRM Assay Kit for Flow Cytometry | Thermo Fischer: | Cat# M20036 | FACS 50 nM |
| Commercial assay, kit | ProteaseMAX Surfactant | Promega Corp | Cat# V2071 | |
| Commercial assay, kit | CellTrace Violet Cell Proliferation Kit, for flow cytometry | Thermo Fischer: Molecular Probes | Cat# C34571 | FACS 1:100 |
| Commercial assay, kit | EasySep Mouse CD8+T Cell Isolation Kit | STEMCELL Technologies | Cat# 19853A | |
| Commercial assay, kit | Direct-zol RNA MiniPrep Plus | Zymo Research | Cat# R2071 | |
| Commercial assay, kit | ProtoScript First Strand cDNA Synthesis Kit | New England BioLabs, Inc | Cat# E6300L | |
| Commercial assay, kit | Power SYBR Green PCR Master Mix | Applied Biosystems | Cat# 4367660 | |
| Strain, strain background Mus musculus | C57BL/6J | Jackson Laboratory | Stock No: 000664 | Wild type |
| Strain, strain background Mus musculus | Slc25a5tm1.1Nte/J | Jackson Laboratory | Stock No: 029482 | ANT2flox/lox |
| Strain, strain background Mus musculus | C57BL/6-Tg(TcraTcrb)1100Mjb/J | Jackson Laboratory | Stock No: 003831 | OT1 |
| Strain, strain background Mus musculus | B6.Cg-Tg(Lck-cre)1CwiN9 (Lck-Cre) | Taconic | Model # 4197 | Lck-Cre |
| Strain, strain background Mus musculus | Gt(ROSA)26Sortm1.1(CAG-Mito-Dendra2) Dcc | Dr. Tsvee Lapidot from the Weizmann Institute of Science | mito-Dendra2 | |
| Recombinant DNA reagent | Lv-OVA-GFP | Dr. Avihai Hovav from the Hebrew University of Jerusalem | Ovalbumin and GFP expressing lentiviral plasmid | |
| Recombinant DNA reagent | pCMV-VSV-G | a gift from Bob Weinberghttps://www.addgene.org/8454/ | Addgene Plasmid #8454 | VSV-G envelope expressing plasmid |
| Recombinant DNA reagent | psPAX2 | a gift from Didier Trono https://www.addgene.org/12260/ | Addgene Plasmid #12260 | Lentiviral packaging plasmid |
| Software, algorithm | Kaluza software | Beckman Coulter | FACS acquisition software | |
| Software, algorithm | FACS Express 6 | De Novo Software | FACS analysis software | |
| Software, algorithm | Seahorse Wave | Agilent | OCR and EACAR analysis | |
| Software, algorithm | Perseus | Metabolic and proteomic analysis | ||
| Software, algorithm | Prism 8 | GraphPad | Graphs and Heatmaps, statistical analysis | |
| Software, algorithm | Thermo Xcalibur | Thermo Fisher Scientific | Metabolomics LC-MS data acquisition | |
| Software, algorithm | TraceFinder 4.1 | Thermo Fisher Scientific | Metabolomics LC-MS data analysis |
Additional files
-
Supplementary file 1
Matrix protein annotated by GO with either ATP or GTP domains.
- https://cdn.elifesciences.org/articles/56612/elife-56612-supp1-v3.docx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/56612/elife-56612-transrepform-v3.docx
