Figures and data in ODELAM, rapid sequence-independent detection of drug resistance in isolates of Mycobacterium tuberculosis

Figures
Tables
Additional files

12 figures, 4 tables and 1 additional file

Figures

Figure 1

Download asset Open asset

Growth of Mtb strain H37Rv into microcolonies over time observed with ODELAM.

(A) Selected time-lapse snapshots of Mtb colonies growing on a solid medium. Mtb CFUs are shown growing on a 60 μm x 60 μm region of 7H9-GO agar over 96 hrs time course. (B) Growth curves for a total of 1276 colonies were recorded from a 1.2 mm x 0.9 mm region over 96 hrs and plotted. (C) Population histograms of the all extracted growth parameters (Doubling Time, Lag Time, Exponential Time and Number of doublings).

Figure 2

Download asset Open asset

Growth of Mtb strain H37Rv during exposure to ofloxacin.

(A) Growth curves of H37Rv under increasing OFX drug concentrations measured by ODELAM. The flattening of the curves corresponds to the MIC of about 0.5 µg/ml OFX and corresponds to the batch culture dose response (B). (C) Population histograms of the growth parameters showing that the time in exponential growth (T-Exp) is reduced as OFX concentration increases, which in turn leads to a reduced number of doublings.

Figure 3

Download asset Open asset

Growth of Mtb strain TRS10 during exposure to ofloxacin.

(A) Growth of clinical isolate TRS10 appears to slow under increasing OFX pressure. (B) Batch culture dose response curve for TRS10, indicating an MIC of 16 µg/ml OFX. (C) ODELAM histograms with increasing OFX concentration, showing that up to the MIC, doubling time appears to increase while the time in exponential phase is less affected.

Figure 4

Download asset Open asset

Effect Size of OFX on growth parameters.

(A) Effect size as measured by the Kolmogorov-Smirnov statistic vs OFX concentrations for H37Rv. Note, the number of doublings observed tracks with the time growing exponentially (T-Exp). (B) Effect size as measured by the Kolmogorov-Smirnov statistic vs OFX concentrations for TRS10. Note, doubling time (Td) tracks with number of doublings (B).

Figure 5

Download asset Open asset

Comparison of ODELAM and MIC assay in detecting heteroresistance.

(A) Dilution of TRS10 into H37Rv and the corresponding MICs obtained from a bulk culture assay. (B) Comparison of the percentage of TRS10 in H37Rv generated by dilution against the percentage of CFUs observed to grow more than 2× by ODELAM. The blue dots are replicate measurements from a given dilution and the red line is the mean of each replicate. (C) ODELAM growth curves for TRS10/H37Rv mixtures. Blue traces are resistant and red traces are sensitive to OFX.

Figure 6

Download asset Open asset

ODELAM analysis of Mtb strain ADB42 reveals heteroresistance to OFX.

(A) Batch culture-based dose response curve of ADB42 showing an OFX MIC of about 16 µg/ml. (B) At 2 µg/ml OFX, tails in the doubling time, T-Exp, and number of doublings indicate that a second population may be present.

Figure 7

Download asset Open asset

Growth kinetics generated by ODELAM for heteroresistant cultured clinical isolate ADB42.

TOP (A) Growth curves of ADB42 growing at 2 µg/ml OFX. Of the 1476 CFUs in the heteroresistant culture, sensitive and resistant components were segregated by selecting those that doubled fewer than 2× (1203 CFUs; red traces) or more than 2× (273 CFUs; blue traces) (**B and C**) Traces of sensitive and resistant components presented separately for clarity. BOTTOM: Histograms of growth parameters derived from traces shown in A with sensitive and resistant components demarcated by the gray vertical lines.

Figure 8

Download asset Open asset

Assessment of ADB42 heteroresistance by spot assay.

(A) Prevalence of the DNA gyrase II (Rv0006) D94G mutation before and after exposure to 32 μg/ml OFX for 24 hrs as detected by DNA sequencing. (B and C) Clones isolated from ADB42 grown on 7H10 media and 7H10 media with 2 μg/ml OFX for five days, before spotting on media lacking OFX (B) or containing OFX (C). 33 of 96 clones were observed to grow in the presence of OFX, indicating resistance to OFX.

Figure 9

Download asset Open asset

ODELAM experiment summary of 96 individual clones of ADB42 grown on 2 μg/ml OFX.

Sensitive and resistant clones of ADB42 segregate according to their number of doublings (Num Dbl) and time in exponential phase (T-Exp). Sub-populations in the ADB42 clones were not observed.

Figure 10

Download asset Open asset

OFX induced lysis of Mtb bacilli.

Some CFUs were observed to lose area after exposure to OFX, which is attributable cell lysis indicated by arrows (A). Tracking of images in A and plotting CFUs area over time detects lysis events as a reduction in CFU area (B). The percentage of colonies that lost area is plotted for each strain against drug concentration (C).

Figure 11

Download asset Open asset

Strategy to fit Gompertz function parameters on a simulated growth curve with noise added.

(A) Illustration of the parameters used to fit the Gompertz function as described in Materials and methods. Note the value dT, the time between T-Lag and the maximum growth velocity, is used for estimating the growth curve but T-Exp is reported. T-Exp is the time between the maximum and minimum acceleration or twice the value dT. (B) Initial estimates of each parameter were generated from a line connecting the first and last data points in a truncated simulated growth curve, which represents the time of experimental data acquisition. Bottom panel shows the differences between the line generated and the simulation. The initial estimate for T-Lag is determined by the maximum difference between the line generated and the simulation (blue vertical lines). T-Exp (or 2× dT) is determined where the absolute difference between the line and the simulated data is minimized (red vertical line). (C) Same as B with longer simulation time, showing initial estimates are similar.

Figure 12

Download asset Open asset

Time required for reliably determining the kinetic parameters in silico.

(A) Column 1, the difference between the true parameter, in this case Num Dbl = 5, T-Lag = 6, and dT = 42, and the estimated parameter are plotted as more of the growth curve is observed over time. As more timepoints of the growth curve are included or “observed” in the fit algorithm, the estimated parameters approach their true values. The red dashed lines are 1 standard deviation of 25 growth curves each with random noise added. Column 2, the percent difference between the true value and the estimated value are unstable and do not decrease consistently as more time points are included in the estimation. Column 3, percent convergence given by the difference between two consecutive time point estimations and divided by the true parameter value and decreases steadily over time. The blue line represents a convergence threshold of 5% between consecutive estimations and this threshold is met when all parameters fall below the convergence threshold. (**B–C**) Heat maps showing the ratio of time needed for the $T ‐ E x p$ parameter to converge to a given precision, $T_{o}$ divided by the total time for the growth curve to begin to plateau $T ‐ L a g + T ‐ E x p$ . The ratio is given explicitly as $\frac{T_{o}}{T_{l a g} + T_{e x p}}$ . The heatmaps indicate that for given lag times and time in exponential phase the parameters converge after the growth curve begins to plateau. This means that for a drug that causes growth cessation at 20 hours, a measurement of roughly 1.5× that, or 30 hrs of observation, is required for the $T ‐ E x p$ parameter to converge to less 5% precision.

Tables

Table 1

Summary growth statistics of isolates.

Condition tested	CFUs total	Num of rep	Med td (hrs)	IQR td (hrs)	Med T-Lag time (hrs)	IQR T-Lag time (hrs)	Med T-Exp (hrs)	IQR T-Exp (hrs)	Med Num Dbl	IQR Num Dbl
Control-H37Rv	5413	8	22.9	7.8	0.0	3.7	52.5	33.8	3.1	1.6
0.0625 μg/ml-H37Rv	3380	4	23.4	9.6	0.0	2.8	51.8	28.1	3.0	1.5
0.125 µg/ml-H37Rv	2946	4	24.3	10.0	0.0	2.9	53.0	29.5	3.0	1.4
0.5 µg/ml-H37Rv	2231	4	22.6	10.7	0.9	6.2	35.2	16.2	2.0	0.9
2 µg/ml-H37Rv	5354	8	19.2	13.7	3.9	6.1	17.3	8.2	0.9	0.6
4 µg/ml-H37Rv	1412	4	21.1	12.5	3.9	5.2	14.7	7.7	0.6	0.4
8 µg/ml-H37Rv	1728	4	20.8	12.1	2.8	4.0	11.5	6.5	0.5	0.3
16 μg/ml-H37Rv	894	4	22.9	24.4	1.5	4.4	11.2	12.4	0.5	0.3
Control-TRS10	3449	8	28.4	8.5	2.8	9.3	79.7	54.2	3.5	2.5
0.0625 µg/ml-TRS10	2181	4	28.2	6.9	1.9	8.1	81.7	55.6	3.8	2.6
0.125 µg/ml-TRS10	2014	4	28.5	7.6	0.0	5.4	80.3	61.2	3.7	2.8
0.5 µg/ml-TRS10	1167	4	28.3	6.3	0.0	6.0	81.8	62.5	3.8	3.1
2 µg/ml-TRS10	2982	8	30.6	17.9	2.3	9.2	73.7	42.6	2.8	2.2
4 µg/ml-TRS10	1190	4	53.1	26.0	0.0	7.4	65.7	38.7	1.5	1.1
8 µg/ml-TRS10	1063	4	57.8	28.4	0.0	2.1	56.7	27.4	1.3	0.7
16 µg/ml-TRS10	966	4	46.0	21.8	0.0	13.8	61.8	44.8	1.6	1.3
Control-ADB42	5599	8	24.4	7.8	1.1	8.2	64.3	42.9	3.4	2.0
0.0625 µg/ml-ADB42	3762	4	24.7	7.2	0.0	5.2	63.8	35.7	3.4	1.8
0.125 µg/ml-ADB42	3980	4	25.3	7.4	0.0	4.8	63.8	35.1	3.4	1.7
0.5 µg/ml-ADB42	3121	4	25.0	9.7	0.0	6.2	40.6	31.7	2.0	1.4
2 µg/ml-ADB42	4995	8	26.9	18.0	1.9	8.0	29.5	43.3	1.1	1.7
4 µg/ml-ADB42	1440	4	36.7	27.7	5.0	13.9	38.8	51.6	0.9	1.9
8 µg/ml-ADB42	1287	4	54.7	56.2	4.1	13.2	40.0	39.2	0.6	0.9
16 µg/ml-ADB42	910	4	17.5	34.8	31.5	32.6	46.6	36.4	0.6	1.0

Table 2

Ratios of resistant cells as calculated by application of the binomial distribution and experimental observations.

Total number of sample reads (number of trials)	Number of D94G SNPs detected (number of success) p=r	Ratio of resistant cells to sensitive cells (probability of trial success)	95% Confidence interval [Low]-[High]
62	9	0.09–0.24	[2, 9 - 9, 21]
Total number of colonies picked (number of trials)	Number of resistant colonies (number of success) p=r
96	33	0.28–0.44	[17,33 - 33,61]
	One or two cells contribute to colony p=1-(1 r)²	0.14–0.26	[17,33 - 33,61]
Total number of colonies tracked	Number that fit resistance criterion	Ratio of resistant cells to sensitive cells
963	237	0.2461
473	114	0.2410
1476	273	0.1850
1043	244	0.2339
359	101	0.2557
561	157	0.2799
573	146	0.2548
459	123	0.2680
	Mean resistance ratio	0.2456

Table 3

Sequence data gyrA SNPs in OFX sensitive and resistant clones.

		QRDR	QRDR
Position in the gyrase protein	21	94	95	247
H37Rv	E	D	S	G
TRS10	Q	G	T	S
ADB42 OFX Sensitive	Q	D	T	G
ADB42 OFX Resistant	Q	G	T	G

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (Mycobacterium tuberculosis)	H37Rv	ATCC	ATCC −27294
Strain, strain background (Mycobacterium tuberculosis)	TRS10	PMID:24687490	10
Strain, strain background (Mycobacterium tuberculosis)	ADB42	PMID:24687490	42
Sequence-based reagent	Primer a for QRDR amplification	IDT	gyrA_1Fw	CCTGCGTTCGATTGCAAACG
Sequence-based reagent	Primer b for QRDR amplification	IDT	gyrA_1Rv	CGTGGTTGACCTGATACGG
Commercial assay or kit	RiboZero rRNA removal (bacterial)	Illumina Inc		(discontinued)
Commercial assay or kit	AMPure XP	Agencourt Bioscience Corporation	Beckman Coulter A63881
Commercial assay or kit	NEBNext Ultra RNA Library Prep Kit for Illumina	New England Biolabs	E7530S
Commercial assay or kit	NEBNext Multiplex Oligos for Illumina	New England Biolabs	Dual Index Primers Set 1 E7335S
Commercial assay or kit	Kapa qPCR quantification kit	Roche	KK4824
Commercial assay or kit	Illumina NextSeq 500 High Output v2 Kit	Illumina Inc
Commercial assay or kit	MagJet Genomic DNA kit	Thermo Fisher Scientific	K2722
Commercial assay or kit	Lysing Matrix B	MP Biomedicals
Chemical compound, drug	Ofloxacin	Sigma	O8757-1G
Software, algorithm	DuffNGS	PMID:21317536		https://sourceforge.net/projects/duffyrnaseq/
Software, algorithm	Bowtie 2	PMID:22388286
Software, algorithm	MicroManager v1.4	PMID:25606571		https://micro-manager.org/
Software, algorithm	MATLAB	Mathworks		www.mathworks. com
Software, algorithm	ODELAY-ODELAM	This manuscript		https://github.com/AitchisonLab/